Содержание

Как работают положения о МЗП и МРОТ в ЯНАО

Выбрать журналАктуальные вопросы бухгалтерского учета и налогообложенияАктуальные вопросы бухгалтерского учета и налогообложения: учет в сельском хозяйствеБухгалтер Крыма: учет в унитарных предприятияхБухгалтер Крыма: учет в сельском хозяйствеБухгалтер КрымаАптека: бухгалтерский учет и налогообложениеЖилищно-коммунальное хозяйство: бухгалтерский учет и налогообложениеНалог на прибыльНДС: проблемы и решенияОплата труда: бухгалтерский учет и налогообложениеСтроительство: акты и комментарии для бухгалтераСтроительство: бухгалтерский учет и налогообложениеТуристические и гостиничные услуги: бухгалтерский учет и налогообложениеУпрощенная система налогообложения: бухгалтерский учет и налогообложениеУслуги связи: бухгалтерский учет и налогообложениеОплата труда в государственном (муниципальном) учреждении: бухгалтерский учет и налогообложениеАвтономные учреждения: акты и комментарии для бухгалтераАвтономные учреждения: бухгалтерский учет и налогообложениеБюджетные организации: акты и комментарии для бухгалтераБюджетные организации: бухгалтерский учет и налогообложениеКазенные учреждения: акты и комментарии для бухгалтераКазенные учреждения: бухгалтерский учет и налогообложениеОплата труда в государственном (муниципальном) учреждении: акты и комментарии для бухгалтераОтдел кадров государственного (муниципального) учрежденияРазъяснения органов исполнительной власти по ведению финансово-хозяйственной деятельности в бюджетной сфереРевизии и проверки финансово-хозяйственной деятельности государственных (муниципальных) учрежденийРуководитель автономного учрежденияРуководитель бюджетной организацииСиловые министерства и ведомства: бухгалтерский учет и налогообложениеУчреждения здравоохранения: бухгалтерский учет и налогообложениеУчреждения культуры и искусства: бухгалтерский учет и налогообложениеУчреждения образования: бухгалтерский учет и налогообложениеУчреждения физической культуры и спорта: бухгалтерский учет и налогообложение

20192020

НомерЛюбой

Электронная версия

Комментатор Нобель Арустамян уволился с «Матч ТВ» из-за интервью с Павлом Мамаевым

https://www. znak.com/2021-08-25/kommentator_nobel_arustamyan_uvolilsya_s_match_tv_iz_za_intervyu_s_pavlom_mamaevym

2021.08.25

Комментатор и журналист Нобель Арустамян уволился с «Матч ТВ» после шести лет работы на телеканале. Поводом для ухода стало интервью с полузащитником «Ростова» Павлом Мамаевым. В Instagram он рассказал, что не хотел участвовать в этом проекте, который больше был похож на «Пусть говорят» или «Окна», чем на программу спортивного телеканала.

Нобель Арустамян / Instagram

«Мне важно оставаться честным с аудиторией и самим собой. В последнее время этот вопрос встал особенно остро. Интервью, как с Павлом Мамаевым, — то, что я не хочу, не могу и не буду делать в какой бы то ни было форме. Это противоречит моим профессиональным и этическим ценностям», — написал Арустамян.

Комментатор рассказал, что получил редакционное задание взять интервью у Мамаева. Он ехал на встречу с ним в Ростов как «на честный разговор с футболистом», а в итоге «оказался соучастником пиар-перформанса», потому что «получил заранее подготовленного героя для программы вроде „Окна“».

«Не осуждаю тех, кто занимается подобным, но мне было жутко дискомфортно. Не копаюсь в личной жизни людей, никогда этим не занимался и не буду», — отметил Арустамян.

Журналист говорил руководству «Матча», что «такой контент не должен появляться в эфире спортивного канала», но его доводы не приняли. По этой причине он написал заявление об увольнении по собственному желанию.

Генеральный продюсер «Матч ТВ» Тина Канделаки, комментируя уход Арустамяна, сказала, что уважает позицию журналиста. «Нобель давно развивает свои личные ресурсы, и собственные интересы ему важнее интересов канала, о чем он мне честно сказал в разговоре», — заявила она.

Интервью Павла Мамаева вышло в эфире «Матч ТВ» вечером 24 августа.

Павел Мамаев вместе с другим российским футболистом Александром Кокориным в октябре 2018 года устроили серию драк после того, как отметили десятилетие своей дружбы. От рук футболистов пострадали три человека. Спортсменов обвинили в побоях, хулиганстве и умышленном причинении легкого вреда здоровью.

Суд приговорил Кокорина к 1,5 года лишения свободы в колонии общего режима, Мамаева — к 1 году и 5 месяцам лишения свободы. Павел Мамаев сейчас находится в стадии развода и делит имущество со своей женой.

6 сентября 2019 года суд удовлетворил ходатайства об условно-досрочном освобождении из колонии Кокорина и Мамаева. Спортсмены вышли на свободу в середине сентября 2019 года. После освобождения Мамаев начал выступать за «Ростов», а Кокорин играл за «Зенит», «Сочи», «Спартак», после чего перешел в итальянскую «Фиорентину».

Хочешь, чтобы в стране были независимые СМИ? Поддержи Znak.com

Администрация муниципального образования Толькинское | Главная

Телефоны:

8(34932) 3-13-35
Факс:
8(34932) 3-13-23

Электронный адрес:

Адрес:

629382, ЯНАО, Красноселькупский район, с.Толька, ул.Центральная, д.34

Часы работы:

Рабочее время:

с 830 до 1800

Перерыв на обед:

с 1230 до 1400

Выходные дни:

Суббота ,Воскресенье

 ТЕЛЕФОН ГОРЯЧЕЙ ЛИНИИ ПО ВОПРОСАМ ЗАЩИТЫ ПРАВ ПОТРЕБИТЕЛЕЙ 8(34932)2-22-72

ОТКРЫТА ГОРЯЧАЯ ЛИНИЯ ДЛЯ ИНФОРМАЦИИ О ВЫЯВЛЕНИИ БЕЗНАДЗОРНЫХ ЖИВОТНЫХ. ТЕЛЕФОН ГОРЯЧЕЙ ЛИНИИ: 3-14-39 В РАБОЧИЕ ДНИ.

ОТКРЫТА ГОРЯЧАЯ ЛИНИЯ ПО ВОПРОСУ ВОДОСНАБЖЕНИЯ, ТЕПЛОСНАБЖЕНИЯ И ЭЛЕКТРОСНАБЖЕНИЯ В СЕЛЕ ТОЛЬКА. ТЕЛЕФОНЫ ГОРЯЧЕЙ ЛИНИИ: +7(951) 988-73-89 КРУГЛОСУТОЧНО, 3-14-39 с 8:30 до 18:00 В РАБОЧИЕ ДНИ.

ОТКРЫТА ГОРЯЧАЯ ЛИНИЯ ДЛЯ ИНФОРМИРОВАНИЯ ПО ВОПРОСАМ БЛАГОУСТРОЙСТВА СЕЛА ТОЛЬКА. ТЕЛЕФОН ГОРЯЧЕЙ ЛИНИИ 3-14-39 с 8-30 до 18-00 В РАБОЧИЕ ДНИ (ответственный – Столбовая Елена Петровна).

Региональный проект «Разработка и реализация программы системной поддержки и повышения качества жизни граждан старшего поколения «СТАРШЕЕ ПОКОЛЕНИЕ» в рамках реализации Национального проекта «Демография»

Региональный проект «Организация переобучения и повышения квалификации женщин, находящихся в отпуске по уходу за ребенком в возрасте до трех лет, а также женщин, имеющих детей дошкольного возраста, не состоявших в трудовых отношениях и обратившихся в органы службы занятости населения Ямало-Ненецкого автономного округа» в рамках реализации Национального проекта «Демография»

Дата создания: 27-02-2014
Дата последнего изменения: 22-07-2021

Департамент природно-ресурсного регулирования, лесных отношений и развития нефтегазового комплекса ЯНАО запустили проект по экологическому мониторингу зелёных массивов в регионе с помощью специальных устройств – фотоловушек. Приборы фиксируют нарушителей, загрязняющих окружающую среду.

Вниманию граждан мужского пола 1995-2003 годов рождения, подлежащих призыву на военную службу! В целях недопущения или устранения нарушений требований Федерального закона от 28 марта 1998 года № 53-ФЗ «О воинской обязанности и военной службе» вам необходимо прибыть в военно-учётный стол Администрации муниципального образования Толькинское для уточнения документов воинского учёта! При себе иметь паспорт, а также удостоверение гражданина, подлежащего призыву на военную службу. Справки по телефону 3-13-23

Ямальцы - члены олимпийской сборной России,участники олимпиады в Токио

Просим не захламлять территорию села автотранспортными средствами, техническое состояние которых исключает их эксплуатацию. Администрацией поселения определено место для размещения такого автотранспорта - свалка ТБО. Просим вывезти свои непригодные к эксплуатации автомобили в указанное место. В противном случае будет применяться административная ответственность.

Информирую Вас о том, что в целях содействия занятости отдельных категорий граждан путем приобретения или развития имеющихся знаний, компетенций и навыков, обеспечивающих конкурентоспособность и профессиональную мобильность на рынке труда, в рамках федерального проекта «Содействие занятости» национального проекта «Демография» реализуются мероприятия по профессиональному обучению и дополнительному профессиональному образованию граждан.

Начался приём заявок на участие в конкурсе по благоустройству «Лучший двор», «Лучший дом», «Лучший подъезд», «Лучший цветник». Срок подачи до 10 августа 2021 г. Заявки принимаются в отделе ЖКХ Администрации поселения.Тел.для справок 3-14-39

24 июня 2021 года с 830 до 1230, с 1400 до 1700 часов будет проводиться региональный день приёма граждан. Предварительная запись на личный приём будет осуществляться с 21 июня 2021 года в Администрации муниципального образования Толькинское по адресу: с. Толька, ул. Центральная, д. 34, с 08:30 до 12:30 часов и с 14:00 до 17:00 часов в будние дни.

ресурсов | Бесплатный полнотекстовый | Глобализация добычи и прав коренных народов в российской Арктике: непреходящая роль государства в управлении природными ресурсами

3. Глобализация управления в нефтегазовом секторе: теоретический подход

Как правила и стандарты, регулирующие добычу нефти и газа. Газовый сектор перешел от государственного правительства к глобальному управлению, включая частные усилия, такие как Инициатива прозрачности добывающих отраслей (EITI) и требования международных финансовых институтов, ожидается, что государство будет лишь одним из многих действующих лиц, формирующих поведение компании.Управление может происходить на многих уровнях и вовлекать множество различных участников; правила и стандарты разрабатываются в различных учреждениях. Несмотря на то, что их нелегко обеспечить соблюдение, глобальные правила и стандарты часто превосходят требования законодательства штата в отношении защиты окружающей среды и консультаций с общественностью.

Например, права коренных народов могут быть более четко кодифицированы на международном уровне, чем во внутреннем законодательстве. Можно было бы ожидать, что глобальное управление тогда предоставит коренным общинам больше рычагов воздействия на нарушения прав, чем внутренние правовые системы.

Глобализация управления в добывающем секторе проявляется в нескольких тенденциях: рост зависимости добывающих компаний от международных финансовых институтов; разработка глобальных экологических и социальных стандартов; участие негосударственных субъектов (корпораций и НПО) в формировании управления; и институционализация глобальных стандартов на местном уровне [26,27,28,29]. По мере глобализации управления природными ресурсами оно расширилось и стало охватывать ряд регулирующих и стандартных институтов развития, таких как Организация Объединенных Наций, в частности, в рамках Конвенции Международной организации труда (МОТ), Арктического совета, Организации экономического сотрудничества и развития.
(ОЭСР) и Инициативы ответственной заботы, среди прочего.Многосторонние инициативы, такие как Глобальная инициатива по отчетности, Добровольные принципы безопасности и прав человека, Инициатива прозрачности добывающих отраслей (EITI) и другие, способствуют прозрачности, побуждая компании отслеживать социальные и экологические воздействия и сообщать о них [29,30,31]. Кроме того, компании могут участвовать в схемах добровольной сертификации экологического менеджмента, таких как Международная организация по стандартизации-14000 (ISO 14000), Системы менеджмента профессионального здоровья и безопасности-18000 (OHSAS-18000), Схема экологического менеджмента и аудита Европейского Союза ( EMAS) и так далее.Некоторые глобальные стандарты, например, Конвенция МОТ No 169 и Оперативная директива 4.20 Всемирного банка по коренным народам, специально посвящены защите прав коренных народов. В этой статье используется концепция сетей, генерирующих управление (GGN), чтобы понять, как можно управлять добывающими отраслями.
несколькими участниками, действующими в разных масштабах [32,33,34,35,36]. GGN в данном исследовании - это сеть нефтедобычи, включающая компании, инвестиционные банки, партнеров по акционерному капиталу, международные и местные офисы, а также государственные агентства на разных уровнях и субъектов гражданского общества (НПО и ассоциации коренных народов).Взаимодействие между участниками из государства, частного сектора и гражданского общества в этих сетях связывает транснациональный и местный уровни. Основными компонентами GGN являются (i) транснациональные узлы дизайна глобального управления, (ii) форумы переговоров и (iii) площадки реализации. В транснациональных узлах дизайна глобального управления (см. Рисунок 2) глобальные институты такие как Организация Объединенных Наций (ООН), Арктический совет (AC), Международный валютный фонд (МВФ), Международная финансовая корпорация (IFC), Всемирный банк (WB), Инициатива прозрачности добывающей промышленности (EITI) и другие В схемах сертификации экологического менеджмента разрабатываются новые регулирующие мировые стандарты, такие как руководящие принципы для нефтяных компаний по обеспечению устойчивости добычи нефти и защите прав коренных народов. Решения по управлению принимаются не только в узлах проектирования, но также на «форумах переговоров» и «местах реализации» [33]. Форумы переговоров могут включать как глобальных, так и местных участников, могут принимать форму глобальных конференций и встреч (например, в Арктическом совете или его рабочей группе по устойчивому развитию, с участием коренных народов в качестве постоянных участников) и могут проводиться на национальном уровне. региональный или местный уровень. Местные форумы могут проводиться во время публичных слушаний или выходить из движений сопротивления снизу вверх со стороны местных субъектов, которые обращаются к глобальным институтам.

Места реализации - это географические территории, на которых механизмы управления внедрены и адаптированы к местным условиям. В разрезе добычи нефти ключевыми объектами реализации являются места разведки, добычи и транспортировки нефти. На этих участках местные заинтересованные стороны, и особенно коренное население, испытывают на себе влияние добычи нефти. Эти места внедрения связаны с транснациональным уровнем сетями государственных, рыночных и общественных субъектов, которые взаимодействуют и ведут переговоры по разработке глобальной политики и стандартов, а также внедрению этих стандартов в управление нефтяными компаниями.

GGN связывают транснациональные пространства с «пространством мест», термин, введенный Мануэлем Кастельсом [6]. Эти связи могут быть установлены по-разному. В хорошо развитых GGN сеть включает субъектов гражданского общества, действующих в локальном пространстве мест, участвующих в сети снизу вверх. Они могут участвовать в рыночных кампаниях под руководством НПО, направленных на изменение корпоративной практики, подчеркивая недовольство местной деятельностью транснациональных корпораций. GGN также включает участников, действующих в транснациональных пространствах, с целью стимулирования сверху вниз институциональных изменений в конкретных местах путем введения наборов новых правил и стандартов, которые должны применяться на местном уровне. Эти субъекты могут сотрудничать по новым правилам, изданным транснациональными субъектами и учреждениями, такими как инвесторы и акционеры, финансирующие добычу. Нефтяные компании могут добровольно принять определенные глобальные стандарты для повышения своей конкурентоспособности на рынке, привлечения финансовой поддержки и соблюдения требований финансовых учреждений, предоставляющих ссуды или инвестиции. В идеале сети GGN способствуют постоянному взаимодействию и обмену информацией между местными и транснациональными субъектами с конечной целью поощрения устойчивого развития в конкретных местах.Этот тип надежного GGN наблюдается в лесном секторе [33]. Созданы и переработаны новые способы глобального управления и принятия решений, чтобы приспособиться к глобализации добычи нефти.

Таким образом, компании добывающего сектора могут выйти за рамки требований национального законодательства, приняв и внедрив глобальные стандарты. Нефтегазовые компании принимают мировые стандарты, чтобы избежать репутационных рисков, удовлетворить своих акционеров, ограничить давление со стороны НПО и организаций коренных народов и, что наиболее важно, обеспечить будущие инвестиции. Например, частные российские нефтяные компании ищут ссуды у международных кредитных организаций, таких как МВФ, Всемирный банк или Европейский банк реконструкции и развития (ЕБРР), а также им необходимо поддерживать хорошие отношения с партнерами по акционерному капиталу. Эти банки и партнеры разработали требования к кредитованию, основанные на глобальных соглашениях и правилах, описанных выше. Это приводит к институционализации глобальных правил в конкретных практиках в местах разведки, добычи и транспортировки нефти.Компании также отвечают интересам и требованиям акционеров, разрабатывая собственные корпоративные кодексы поведения и политику корпоративной социальной ответственности.

Ученые утверждают, что роль государства в управлении нефтегазовой отраслью меняется из-за глобализации и трансграничных цепочек поставок нефтедобычи [37]. В хорошо развитой сети GGN компании выходят за рамки законодательных требований данного государства к работе, вместо того чтобы поддерживать часто более строгие или более широкие стандарты, установленные глобальными узлами проектирования. В совокупности эти правила и стандарты побуждают компании следовать так называемой «социальной лицензии на деятельность» (SLO), чтобы в дальнейшем избегать рисков и минимизировать конфликты [38,39]. SLO предполагает, что в дополнение к выполнению требований законодательства путем получения лицензий и разрешений компании должны получить общественное признание и одобрение общества [40,41]. SLO помогает компаниям избегать конфликтов с заинтересованными и затронутыми заинтересованными сторонами из гражданского общества. Согласованные договоренности о совместном использовании выгод, как формальные, так и неформальные, могут эффективно способствовать SLO [42,43,44].Необходимость получения SLO потенциально может усилить влияние негосударственных субъектов на правила и стандарты и может изменить роль государства в управлении нефтью. Однако неясно, в какой степени роль государственного управления была дополнена SLO и действительно ли необходимость в социальном лицензировании и распределении выгод влияет на управление нефтегазовыми компаниями на конкретных участках добычи [45,46] .

В конечном итоге, компаниям может потребоваться превышение базовых требований законодательства для обеспечения бесперебойной работы на участках добычи.Однако в то же время в России крупные нефтяные компании, такие как «Газпром» и «Роснефть», принадлежат российскому государству или находятся в совместном владении. В результате они не ищут ссуды у глобальных финансовых институтов, а вместо этого получают инвестиционные деньги от правительства России. Более того, нефть и газ являются стратегическими товарами для правительства России, стремящегося обеспечить экономическое развитие. Таким образом, в России государственное управление может оставаться более влиятельным, чем усилия транснационального управления.

4. Результаты: коренные народы и добыча нефти и газа на полуострове Ямал

Устойчивость местных сообществ в российской Арктике стала актуальной проблемой в условиях интенсивного промышленного развития, глобального изменения климата и более широких социальных преобразований. Глобальное потепление повлияло на маршруты миграции и экономические стратегии оленеводов [47]. Интенсивное освоение нефти и газа в Арктике привело к загрязнению окружающей среды, сокращению популяций диких животных, изменению маршрутов миграции животных и сокращению популяций пресноводных рыб [48].Эти изменения, в свою очередь, отрицательно сказались на традиционных занятиях местных жителей, таких как охота и рыбалка. Более того, расширение нефтедобычи связано с захватом части земель, используемых местными жителями [49]. Эти проблемы присутствуют на российском полуострове Ямал, где проживают представители нескольких коренных народов. Полуостров Ямал, расположенный в российской Арктике, является частью Ямало-Ненецкого автономного округа (ЯНАО), федеральной административной единицы в Тюменской области.Большая часть территории Ямала расположена за Полярным кругом и покрыта тундрой. Нефтегазовые месторождения сосредоточены в Тазовском и Ямальском районах ЯНАО. Запасы газа Ямала составляют около 70% всех запасов газа России. В 2018 году ЯНАО добыло 433,5 млрд м 3 3 природного газа, что составляет примерно 80% всей добычи газа в России и 20% мировой добычи газа. Добычу газа осуществляют 39 предприятий на 98 месторождениях, эксплуатируемых крупными корпорациями, в том числе Газпромом, Роснефтью и Новатэком.Газпром добывает 75,9%, а Новатэк 14,5% всего газа в ЯНАО. Запасы нефти ЯНАО составляют около 14,5% всех запасов нефти России. В 2018 году в округе было добыто 23,9 млн тонн нефти, что составляет примерно 9% всей добычи нефти в России. Добычу нефти в ЯНАО осуществляют 25 предприятий на 72 месторождениях. Основными нефтедобывающими предприятиями округа являются Газпром нефть (62%), Роснефть (15,5%) и Новатэк (15%) [50]. Правительство Ямальской области сильно зависит от доходов бюджета от нефти и газа.Добыча природных ресурсов составляет примерно 50% регионального ВВП, не считая связанных с ними строительства и транспорта, в то время как сельское хозяйство, охота и лесное хозяйство составляют всего 0,1–0,2% ВВП [51]. В последние годы региональная экономика ЯНАО росла намного быстрее, чем в среднем по России [52,53]. Кроме того, нефтегазовые компании также обеспечивают инфраструктуру региона. Например, Обская-Бованенково-Карская линия, железнодорожная ветка, пересекающая полуостров, была построена «Газпромом» и используется для транспортировки нефти.Нефтегазовые компании наблюдали за значительным развитием региона, часто с финансированием из-за рубежа. Новатэк, добывший 9% всего природного газа в России в 2018 году, работает на 56 месторождениях и лицензионных участках в России, в том числе на Ямале. В 2018 году Новатэк продал 66 миллиардов кубометров природного газа внутри России и 6 миллиардов за границу [54]. На Ямале «Новатэк» руководит проектом по добыче газа «Ямал СПГ», который включает строительство морского порта недалеко от поселка Сабетта.Порт, расположенный на арктическом Северном морском пути, будет использоваться для отгрузки сжиженного природного газа, первоначально с экспортом в основном в Европу, но с планами по увеличению экспорта в Китай. Новатэк получил иностранные инвестиции в проект «Ямал СПГ». Французской компании Total и китайской корпорации CNPC принадлежит по 20% акций «Ямал СПГ», а Фонду «Шелковый путь» - 9,9%; Новатэк сохраняет 50,1% акций (Novatek 2018). В марте 2018 г. Total согласилась инвестировать в проект СПГ-2, который будет построен на полуострове Гидан [54].Однако это не единственные международные источники финансирования, к которым обращается «Новатэк». В 2016 году Японский банк международного сотрудничества (JBIC) согласился предоставить кредит «Новатэку» [55]. Российскому правительству принадлежит чуть более 50% акций «Газпрома» и «Роснефти», поэтому они несколько меньше зависят от иностранных инвестиций. Помимо добычи нефти на Ямале проживают три группы коренного населения - ненцы, селькупцы и ханты. Ненцы составляют большинство коренного населения Ямала.В настоящее время в области проживает более 29 000 ненцев, что составляет почти 6% от общей численности населения [56]. Традиционно ненцы занимаются оленеводством и рыболовством. В советский период власти пытались принудить местное население к оседлому образу жизни и работе в советских оленеводческих колхозах (колхозах). Однако из-за кочевого образа жизни оленеводов, чрезвычайно удаленных пастбищных маршрутов и трудностей доступа к этим местам советская власть не смогла существенно повлиять на традиционный образ жизни коренных жителей Ямала.В настоящее время на Ямале самое большое поголовье оленей в России, причем большая часть животных принадлежит частным животноводам, некоторые из них работают в бывших государственных хозяйствах, которые были приватизированы, а другие действуют независимо. В 2010 году на Ямале насчитывалось 600 000 оленей, но только 44% приватизированных совхозов официально арендовали землю; другие оленеводы используют землю для пастбищ и миграции без формальной аренды [24]. Права коренных жителей и их способность привлекать компании и других агентов определены в российских федеральных и региональных законах.Согласно федеральному закону, представители коренных малочисленных народов Севера и Дальнего Востока (ISPN) имеют право на правовую защиту своего традиционного образа жизни. Ряд федеральных законов (ФЗ) и законов автономного округа (ЛАО) дополнительно гарантируют эти права - например, ФЗ-82 «О гарантиях прав коренных малочисленных народов Российской Федерации» (1999 г.), ФЗ-104 «О защите прав коренных народов». Общие принципы организации коренных малочисленных народов Севера, Сибири и Дальнего Востока Российской Федерации (2000 г.), ЛАО-56 «О недропользовании в Ямало-Ненецком автономном округе», ЛАО-46 «О оленеводстве» (1998 г.) и ЛАО. -52 О территориях традиционного пропитания регионального значения в ЯНАО (2010) [57,58,59,60].
4.1. Ассоциации коренных народов и хрупкое сопротивление

В начале 1990-х годов Россию захлестнула волна социальных движений и новых общественных организаций, в том числе связанных с правами коренных народов, из-за политики Горбачева перестройки и конца советского режима. На Ямале возникли общественные движения при участии нескольких неправительственных организаций, защищающих права коренных народов. Эти группы помогли создать правовую основу для защиты прав коренных народов на региональном уровне, включая создание механизмов общественного участия и правительственных агентств, занимающихся правами коренных народов. Эти действия уменьшили конфликт между нефтяниками и коренными жителями Ямала. Однако эффективность этих законов в обеспечении прав представляется сомнительной, как мы объясняем в этом разделе.

В 1990-е годы в ЯНАО и соседнем Ненецком автономном округе (НАО) активизировалась добыча нефти и газа. Земля была конфискована для разработки ресурсов, а экологические условия ухудшились, что породило ряд конфликтов между местными жителями и компаниями, контролирующими добычу.Движение коренных народов Ямала создало организационную основу, создав в 1989 году региональную ассоциацию «Ямал - потомкам» (Ямал - Потомкам!) Для координации своей деятельности. В 1990-х годах НПО организовали публичные лекции по правам коренных народов в регионе, что заставило власти и нефтегазовые компании учитывать интересы коренных народов при реализации промышленных проектов. Ямал своим потомкам помог принять региональные законы, защищающие права коренных народов, такие как Законы автономного округа (ЛАО) о недрах и недропользовании в ЯНАО, о местном самоуправлении в ЯНАО, о регулировании прав на землю, об оленеводстве. в ЯНАО и на территориях традиционного проживания [59,60,61,62].В 2005 году в администрации ЯНАО был создан Департамент по делам коренных малочисленных народов Севера. Кроме того, была создана система представительства коренных народов, в рамках которой для представителей коренных народов в законодательном собрании ЯНАО было зарезервировано три места из 22. .

Сегодня на Ямале действуют несколько крупных общественных организаций коренных народов. Самыми крупными и наиболее важными являются «Ямал - потомкам» и «Ямал», оба из которых получают поддержку в виде государственных грантов с дополнительным финансированием от компаний, действующих в регионе.Эти организации способствуют сохранению традиционного образа жизни и культуры коренных народов и участвуют в предоставлении экологической и этнологической экспертизы, в основном, российскому государству. Они также помогают заключать соглашения между компаниями, государственными органами и местными сообществами. Хотя эти организации стремятся укрепить политику правительства ЯНАО в поддержку коренных народов, их работа не всегда позволяет обычным гражданам коренных народов участвовать в принятии решений, касающихся их окружающей среды и сохранения культурного наследия.Опрошенные выразили обеспокоенность тем, что эти НПО не поддерживают жалобы оленеводов, связанные с нефтяной инфраструктурой, например, когда пастбища отбираются для застройки, оставляя территорию для растущего поголовья оленей в условиях дефицита.

Проблема нехватки земли обостряется в связи с продолжающимся промышленным освоением Арктики и захватом земель для добычи нефти. Многие оленеводы выражают желание сохранить свою традиционную хозяйственную практику, независимую от бывших государственных оленеводческих предприятий, но им для этого требуется достаточно земли.Как отмечает один оленевод, «без совхоза [пасти оленей] легче… потому что не государство изобрело этот традиционный образ жизни». (Оленевод, Ямал, Ямальский район, 2017). Как заметил один пастух о борьбе за территорию: «Это кажется огромным пространством. Но на самом деле оленеводы есть везде. Если вас где-то высадят с самолета, через час появится оленевод и спросит, что вы здесь делаете ». (Глава оленеводческой общины, Ямал, Ямальский район, 2017).По официальным данным за 2010–2015 гг., Популяция оленей на Ямале превысила 700 000 голов, что почти вдвое превышает уровень, который считается устойчивой емкостью для существования на территории. В настоящее время администрация стремится разработать экономическую политику, которая поможет сохранить оленеводство в ЯНАО как основу средств к существованию коренных жителей, а также сократить поголовье оленей в целом из-за опасений по поводу наличия достаточного количества земли. Однако на практике это довольно сложно.Как сказал один пастух: «Олени - его кошелек [пастуха], они его банк ... Если он собирается постоянно уменьшать [стадо], как это работает?» (Представитель оленеводческого хозяйства-1, Ямальский район, Ямал, 2017 г.).

Интервью выявили глубокую двойственность среди местных коренных народов в отношении разработки нефти и газа. Некоторые местные жители считают негативные последствия экспансии нефтяной промышленности в Арктике неизбежным злом, существенным для национальной экономики и страны в целом.Представитель коренного населения, казалось, смирился с нанесенным ущербом, заявив: «Ну, я думаю, даже если он [рыболовство] вымирает из-за нефтегазового комплекса, этот газ течет по всей России. А если рыба умирает, значит, у нас не будет рыбы… А если нет газа, то, наверное, ничего »(Фишер, Ямальский район, Ямал, 2017). Однако другие местные жители обеспокоены дальнейшим ухудшением состояния окружающей среды, потерей земель и исчезновением рыбы из рек из-за будущей добычи нефти.Один из лидеров общины отмечает: «В вашем районе начнут строительство газовой вышки. Они скажут: «Нам очень жаль, но мы должны переселить вас в другой район…» [Местный житель] прожил всю свою жизнь, двигаясь вдоль реки от устья к истокам. … Он уходит, но там уже есть другие люди. Ему говорят: не ходи сюда. И он становится изгоем ». (Представитель местной администрации-2, Ямал, Ямальский район, 2017 г.).

Российские законы, защищающие права коренных народов, не всегда работают на практике.Например, российское законодательство позволяет коренным народам закрепляться за «территориями традиционного природопользования» (ТТНУ), закрепленными в Законе о традиционных территориях пропитания регионального значения в ЯНАО (2010). Однако с момента вступления закона в силу ни одно ТТНУ не зарегистрировано. Точно так же некоторые федеральные законы, защищающие права коренных народов, не были выполнены в ЯНАО. Например, федеральный закон об этнологической экспертизе, который фокусируется на дополнительной защите прав коренных народов, активно не использовался, отчасти из-за отсутствия поддерживающего регионального законодательства.Один из лидеров НПО комментирует: «Мы очень хотим, чтобы [закон об этнологической экспертизе] применялся. Но это создает большие препятствия для газовой отрасли. Мы пытались реализовать закон в Шурышкарском районе. Но не пройдет. У нас представители газовой промышленности занимают 50% [мест] в законодательном собрании. Они не допустят принятия подобных законов ». (Представитель общественной организации «Ямал для потомков», Салехард, Ямал, 2017). Кроме того, некоторые законы в помощь оленеводам не соблюдаются на практике из-за слабого государственного контроля над обширной и часто недоступной территорией Ямала.Территории пастбищ, на которых частные оленеводы отпускают своих оленей, не имеют формальных границ, и споры решаются по обычаю: «Границы определяют сами оленеводы. Эти вопросы они решают между собой. Государство не вмешивается. Слишком страшно. (Глава оленеводческой общины, Ямал, Ямальский район, 2017). В то же время оленеводы не могут воспользоваться возможностью получить компенсацию от нефтегазовых компаний за изъятие земли, поскольку права оленеводов на землю не закреплены в законодательстве.«Земля не принадлежит частным скотоводам. Они попали между ними »(Глава оленеводческой общины, Ямал, Ямальский район, 2017). Оленеводы не рассчитывают на государственную поддержку, которую считают недостаточной: «Потому что у ненцев так было всегда, рассчитывая только на себя». (Местный житель-3, Ямал, Ямальский район, 2017). Вместо этого они полагаются на себя и свои личные связи при решении проблем.

В последние годы возникли новые конфликты между нефтегазовыми компаниями и оленеводами.Например, в 2013 году оленеводы Тазовского района выступили против строительства объектов Лукойла, в том числе нефтепровода. Хотя участники публичных слушаний проголосовали против проекта, он продолжился. В 2019 году возник очередной конфликт между оленеводами и промышленностью Ямальского района. «Газпром» строил газопровод через Обскую губу, но местные жители считают, что проект угрожает экосистеме Обской губы. В феврале 2019 года интернет-сообщество Голос Ямала (Голос Ямала) опубликовало сообщение: «Нефтяные компании не владеют планетой.Я надеюсь, что вы, собираясь бурить в Арктике, подумаете о своих детях и внуках, которые будут бороться за чистую воду, страдая от голода и неурожая. Осмотреться. Мы живем там, где тает лед. Мы видим, что погодные условия меняются каждый год. Месяц не проходит без какого-либо… ущерба, нанесенного дождем, ветром или температурой. Оглянись. Мы здесь, где вода становится теплее. Люди теряют свои дома, своих друзей, свои семьи »[63]. Один из опрошенных оленеводов опубликовал обращение к секретарю ООН с требованием защиты местных жителей.«Мы написали письмо с просьбой [ООН] вмешаться в процесс строительства. Мы хотим найти другой, альтернативный путь для трубопровода. Если они этого не сделают, то наша рыба на севере, вероятно, исчезнет. Строительство трубопровода уничтожит всю [флору и фауну], которыми питается сиг »[64]. Между тем, в конфликтах между коренными народами и компаниями, местные НПО иногда не поддерживали местных субъектов, сопротивляющихся дальнейшему промышленному развитию. В марте 2019 года оленеводы Ямала провели встречу в тундре, на которой обсудили негативные последствия промышленного развития для коренных жителей.Позже этот митинг был признан несанкционированным митингом. Ассоциация коренных народов Ямала поддержала сторону отрасли в споре и подала жалобу в органы власти на организатора митинга. Оленеводу грозил штраф в размере 30 000 рублей, пока суд в конце концов не признал его виновным [65,66,67].
4.2. Распределение выгод, контролируемых государством
Хотя судебные процессы могут не защитить экологические права коренных народов, распределение доходов от промышленной деятельности может компенсировать негативные последствия добычи для местных сообществ.Совместное использование выгод - это стратегия, закрепленная в нескольких глобальных конвенциях, чтобы гарантировать, что коренные народы, в частности, получают некоторое вознаграждение от добычи на своих традиционных территориях. В России соглашения о совместном использовании выгод в северных регионах принимают различные формы, чаще всего через соглашения о социально-экономическом партнерстве между компаниями и региональными, а в некоторых случаях и муниципальными властями [68,69,70,71]. На Ямале существует ряд соглашений между компаниями, госструктурами и местными жителями, регулирующих распределение средств.Эти типы соглашений описаны ниже в порядке от наиболее формального до наименее формального. Наиболее существенное распределение выгод происходит через различные уровни государственного вмешательства, хотя оленеводы, ведущие традиционный кочевой образ жизни, получают относительно небольшую финансовую поддержку.

Социально-экономическое партнерство между региональными властями ЯНАО и нефтегазовыми компаниями, которые перечисляют средства в региональный бюджет на развитие инфраструктуры и социальные программы округа, являются наиболее значимой формой распределения выгод на Ямале.Местный лидер заявил: «Во-первых, региональный бюджет почти на 90% состоит из нефтяных денег. Компании финансируют строительство школ, больниц, школ-интернатов, а также их содержание. И в конечном итоге соглашение представляет собой сделку между двумя большими начальниками - президентом компании и главой района [ЯНАО] ». (Представитель местной администрации-3, Ямал, Ямальский район, 2017). Первоначально, в 1990-е годы, социально-экономические соглашения были трехсторонними - между региональным правительством, компанией и организациями коренных народов и были формализованы на уровне ЯНАО.Однако в настоящее время соглашения между государством и компанией в основном двусторонние. «Уровень социальных инвестиций, предоставляемых компанией, определяется в ходе переговоров с региональными властями» (Представитель Департамента по делам коренных народов, Ямал, Салехард, 2017 г.). Средства нефтяных компаний перечисляются в областной бюджет и используются для строительства и содержания жилья, школ, церквей и больниц. Эти рамочные соглашения между нефтяной компанией и региональными властями затем служат основой для дополнительных соглашений относительно конкретных социальных программ, в том числе программ поддержки коренного населения ЯНАО.Эти средства используются для оплаты обучения одаренных студентов, летних лагерей и оборудования для деревень, такого как спутниковые телефоны, снегоходы, генераторы и топливо. Некоторое финансирование распределяется на более низкие уровни правительства. Муниципальные представители могут запросить финансирование на конкретные цели у властей ЯНАО. В зависимости от количества заявок и их обоснованности средства затем перераспределяются по ЯНАО. Представитель правительства ЯНАО так описывает процесс: «Заявка поступает в департамент, и средства распределяются в зависимости от фискальной ситуации.Если денег достаточно, каждый получает какое-то финансирование. В противном случае муниципалитет должен доказать, что ему нужны эти деньги. Заявки принимаются один раз в год. … Они выделяют средства на нефтепродукты, спутниковые телефоны, мини-источники питания, брезент и аптечки ». (Представитель Управления по делам коренных народов, Салехард, Ямал, 2017 г.).

Нефтегазовые компании также могут заключать соглашения о социально-экономическом партнерстве с местными органами власти (нижестоящими районными властями и муниципалитетами) в отношении конкретных участков добычи.Местный администратор рассказывает: «Когда приходят нефтегазовые компании, они приходят к нам. Мы путаем их [с нашими требованиями]. Приезжаете сюда, занимаете наши пастбища, надо как-то компенсировать. Это выходит за рамки российского законодательства ». (Представитель местной администрации-2, Ямал, Ямальский район, 2017 г.). Как и в случае с соглашениями ЯНАО, точная форма и размер распределяемых выгод являются результатом переговоров между компанией и представителями правительства. Другой представитель местного самоуправления объясняет: «Сначала они заключают [устное] соглашение, а затем, основываясь на этих устных [соглашениях], они заключают договор.Во-первых, они обсуждают, что возможно. Если другая сторона утверждает, что это так, они соглашаются - это сделка ». (Представитель местной администрации-3, Ямал, Ямальский район, 2017). Большинство соглашений нижнего уровня являются трехсторонними - с ассоциацией коренных народов в качестве третьего партнера, наряду с представителями компаний и правительственными чиновниками. В Ямальском районе соглашения были заключены между районными властями, компанией и объединением «Ямал», а в Тазовском районе третьим партнером является общественная организация «Ямал для потомства».Согласно этим соглашениям, средства расходуются на такие нужды, как строительство инфраструктуры, получение среднего и послесреднего образования, организация праздничных торжеств и закупка оборудования. Эти соглашения более низкого уровня чаще всего заключаются на территориях, где компания активно работает, что приводит к социальной и экономической асимметрии между районами. Ямальский и Тазовский районы считаются наиболее благополучными в ЯНАО, так как они обладают основными месторождениями нефти и газа.Добывающая деятельность на их территории позволяет им получать дополнительную финансовую поддержку за счет совместного использования выгод. Между тем, другие районы, лишенные прямой связи с нефтяными компаниями, находятся в относительно невыгодном положении с точки зрения получения льгот. Муниципалитеты затем обнаруживают, что их просьбы о поддержке компаний отклоняются: «Там, где нет нефтяных компаний, вы говорите им [компании], что нам нужны деньги, например, на сохранение фестиваля медведей в Ханты. А они говорят, что мы там не работаем, нам это не интересно.»(Представитель общественной организации« Ямал », Ямальский район, Ямал, 2017).

В дополнение к договоренностям о социально-экономическом партнерстве, нефтегазовые компании также выплачивают финансовую компенсацию местным гражданам за сельскохозяйственные земли, изъятые для добычи. Размер компенсации основан на официальной процедуре, которая учитывает оценку земли. Однако только некоторые бывшие государственные оленеводческие предприятия, приватизированные в постсоветский период, имеют официальную аренду и имеют право на компенсацию на Ямале.Напротив, частные оленеводы не имеют официально закрепленных за ними земель и, таким образом, не имеют права на компенсацию за пастбища, утраченные в результате деятельности компании. В результате одни пастухи получают компенсацию, а другие нет; в любом случае уровни компенсации низкие. Частный оленевод заявляет: «[санкционированные государством] землепользователи получают компенсацию - оленеводческие сообщества. Им так повезло. Если [на их территории] начинаются строительные работы, им выплачивается компенсация за потерю сельскохозяйственных земель.Он рассчитывается [официальным] методом. Им полностью принадлежит вся земля. Но сейчас цена на землю стала минимальной ». (Представитель оленеводческого хозяйства-1, Ямальский район, Ямал, 2017 г.).

Наконец, компании могут оказывать деревням неформальную финансовую помощь в небольшом объеме для конкретных целей, таких как покупка товаров, транспорт и праздничные фестивали. Эта поддержка предоставляется местным жителям напрямую или через общественные организации. Размер помощи обычно составляет от нескольких тысяч до десятков тысяч рублей (примерно от 50 до 1000 долларов).Как правило, представители школы, библиотеки или культурного учреждения обращаются к компании за разовой помощью для конкретного мероприятия или программы. Эти просьбы могут быть совсем небольшими, например, подарки для ветеранов или для детей по случаю особого события.

Таким образом, нефтегазовые компании активно участвуют в экономическом развитии ЯНАО через распределение выгод. Правительственные чиновники играют ключевую роль в распределении выгод от «нефтяных денег» и выступают за такой централизованный подход, учитывая, что правительство лучше понимает ситуацию в регионе, чем другие участники.Правительство ЯНАО может аккумулировать средства, поступающие от различных компаний, и распределять их в соответствии с потребностями районов и муниципалитетов, например, выделяя деньги на инфраструктурные проекты. Они также могут уменьшить экономическое неравенство между районами с месторождениями нефти и районами без нефти. Некоторые эксперты считают эти социально-экономические соглашения лучшим подходом, чем перевод средств напрямую членам коренного населения: «Куда пойдут деньги этой компании [если они будут отданы непосредственно оленеводам]? Брелки? Те же безделушки, которые купили на Манхэттене? Деньги [ЯНАО] тратятся на дороги и дома, а не на снегоход для конкретных оленеводов.Поэтому я считаю, что это хорошая политика. Когда они попросят новую больницу, будет легче построить больницу прямо сейчас ». (Эксперт, Арктический центр, Салехард, 2017). Представитель НПО в целом согласился: «Мы лучше знаем, кому и что нужно. В противном случае они [компания] профинансируют поселок Солнышко возле Сабетты вместо поселка Ромашка в Шурышкарском районе. А мы знаем, что Ромашка сейчас больше нуждается, чем Солнышко ». (Представитель общественной организации «Ямал во имя процветания», Ямал, Салехард, 2017 г.).Наконец, другие эксперты выступают против прямых соглашений между нефтяными компаниями и местным населением, указывая на то, что централизованные соглашения с большей вероятностью позволят избежать зависимости оленеводов от передачи ресурсов компаниями. Член Координационного совета, созданного НОВАТЭКом для общественных консультаций, который также является местным администратором, заявил: «Если мы сейчас будем платить оленеводам напрямую, то возникнем иждивенчество, которое здесь уже процветает…». Наши оленеводы стали немного ленивыми.»(Представитель координационного совета, представитель местной администрации, Ямальский район, Ямал, 2017 г.).

Тем не менее, многие представители местных общин коренных народов отмечают, что большая часть финансирования социальной инфраструктуры и программ направлена ​​на улучшение жизни сельских жителей, в то время как коренные жители, ведущие традиционный кочевой образ жизни, получают наименьшую выгоду от проектов. Кочевые пастухи мало используют новую деревенскую инфраструктуру, за возможным исключением отправки своих детей в школы-интернаты.В то же время промышленные проекты требуют больших затрат для традиционных оленеводов, поскольку включают захват оленьих пастбищ и ухудшение состояния окружающей среды. Местный житель из села замечает: «Нефтяная промышленность, наверное, лучше для сельских жителей, потому что они [компании] строят свою инфраструктуру. У нас новое жилье, школа, спортзал, строят и новое общежитие. Тундровикам, наверное, хуже. Их земли сокращаются ». (Местный житель-1, Ямал, Ямальский район, 2017).Традиционный пастух заявляет: «Многие наши земли были захвачены для разработки нефтяных месторождений. Никакой компенсации - только соглашение компании с регионом, а также некоторые дополнительные соглашения с районами и муниципалитетами. Они не ведут прямых переговоров с оленеводами, только через власти. Они восстанавливают деревни, [и] строят школы, детские сады, спортивные залы ». (Глава оленеводческой общины, Ямал, Ямальский район, 2017). В конечном счете, традиционные кочевые оленеводы не получают особой выгоды от такой организации.

4.3. Форумы переговоров между нефтяными компаниями и коренными народами

На Ямале существует несколько форумов для облегчения общения между властями, компаниями и коренными народами. Во-первых, общественные слушания и консультации с местными жителями требуются российским законодательством перед реализацией промышленного проекта. На публичных слушаниях местные жители могут высказать свои опасения и сделать предложения компаниям. В некоторых случаях эти события позволяют местным жителям смягчить разрушительные последствия промышленной деятельности или решить определенные проблемы.Местный администратор приводит пример, заявляя: «Если жители муниципалитета не очень довольны проектом, они могут найти способ решить эти проблемы путем переговоров. Они говорят: «Включите то-то и это в бюджет, или постройте нам больницу… или отвозите наших детей в школу из тундры». И после этого они [муниципалитет и компания] заключают договор ». (Представитель местной администрации-3, Ямал, Ямальский район, 2017). Один правительственный чиновник привел еще один пример из 2010 года: «Пару лет назад был случай, когда дочка« Газпрома »или« Ямал СПГ »захотела построить искусственный остров в Обской губе.Против этого выступили жители трех районов, и было обращение к губернатору. Они [представители компании и правительства] решили, что это бесполезно. Не они сделали искусственный остров ». (Представитель Управления по делам коренных народов, Салехард, Ямал, 2017 г.). Однако общественные слушания не всегда являются эффективной формой взаимодействия. Компании не обязаны реагировать на предложения участников слушания. Кроме того, местные жители отмечают, что общественные слушания часто проходят формально, не предполагая реальных дискуссий.Например, некоторые общественные слушания проходят далеко от территории промышленного проекта. Один из оленеводов отмечает: «У оленеводов нет времени посещать общественные слушания. Они все время в тундре. Вот почему эти слушания носят формальный характер. Они собирают группу людей, вычеркивают это из списка, и все ». (Глава оленеводческой общины, Ямал, Ямальский район, 2017). Неформальные встречи с местными жителями, организуемые муниципалитетом, - еще одна распространенная форма консультаций между компаниями и общественностью на Ямале.Встречи приурочены к тому, чтобы происходить перед важными событиями и большими праздниками, чтобы обеспечить максимальное участие. Например, ежегодно перед фестивалем оленеводов проводится встреча представителей правительства и компаний с местными жителями. На этих встречах местные жители могут высказывать свои опасения или предложения.

Помимо официально организованных слушаний и встреч, каждая нефтегазовая компания вовлекает местных жителей в разработку собственных стратегий решения проблем и коммуникации. «Газпром» и «Роснефть», например, предпочитают взаимодействовать с местными жителями через государственные органы и процедуры, установленные российским законодательством, такие как общественные слушания.Новатэк, имея финансовые обязательства перед иностранными инвесторами, обязан соблюдать требования международных партнеров и международные стандарты проведения консультаций с общественностью. (Представитель координационного совета, Ямальский район, Ямал, 2017 г.). В селах, прилегающих к предприятиям «Новатэка», был сформирован Координационный совет, в который вошли представители правительства и компаний, а также местные жители. Основная цель Совета - облегчить взаимодействие компании с заинтересованными сторонами. Местный администратор описывает процесс: «Существует Координационный совет, который собирается два раза в год для решения возникающих проблем.В его состав входят представитель компании, руководитель, представитель администрации Ямальского района. Иногда мы встречаемся чаще, если нужно действовать быстро ». (Интервью с главой местной администрации, Ямальский район, Ямал, 2017 г.). Член совета заявляет: «Координационный совет - это то, что решает насущные проблемы или любые возникающие вопросы… Например, если вам нужно провести какое-то обследование или оказать помощь в доставке продуктов на торговый пост. Если Координационный совет решает, что нужна помощь… он связывается с генеральным директором.»(Представитель координационного совета, Ямальский район, Ямал, 2017 г.). Кроме того, в компании работают представители, которые регулярно собирают предложения и жалобы от коренных народов по поводу деятельности компании. В деревнях, затронутых деятельностью компании, также открыты отделения по связям с общественностью. Однако на этом уровне консультации с общественностью не проводятся другими нефтегазовыми компаниями, действующими в регионе, что также свидетельствует о том, что стандарты, принятые финансовыми учреждениями, играют важную роль.Например, консалтинговая фирма Environ была нанята для проведения оценки воздействия проекта «Ямал СПГ», который частично финансировался Total, Японским банком международного сотрудничества и Китайской национальной нефтяной корпорацией [72]. Один из районных чиновников заявляет: «Вот почему они [международные участники] инвестируют, они предлагают деньги под небольшую процентную ставку, но они внимательно следят за всем этим. Поэтому проект был просто необходим. А инвесторы сюда все время приезжают и проверяют, как продвигается, вроде, в апреле они приехали в нашу деревню, все проверяли, осматривались, задавали вопросы.»(Представитель местной администрации-1, Ямал, 2017). Международные стандарты, похоже, подтолкнули компанию к внедрению новых методов взаимодействия.

5. Обсуждение: национализация, глобализация и роль государства

Несмотря на глобализацию добычи нефти в России, государство продолжает играть наиболее значительную роль в управлении нефтегазовым сектором, особенно в том, что касается формирования отношений между нефтегазовые компании и коренные народы.Мы находим свидетельства продолжающейся активной роли государства в нескольких категориях: создание каналов для взаимодействия между различными группами субъектов, в которых государственные чиновники играют значительную роль; контроль и подавление других субъектов, которые хотят участвовать в управлении нефтью; и играть ведущую роль в организации совместного использования выгод. Мы утверждаем, что доминирование государства указывает на то, что вместо того, чтобы преследовать «социальную лицензию на деятельность», как ожидается при более глобализированном управлении, вместо этого мы видим продолжение формальной и неформальной «государственной лицензии на деятельность».

Государство продолжало отстаивать свое управление отчасти потому, что нефтегазовая отрасль является приоритетом для правительства России. Несмотря на глобализацию сетей добычи нефти, национальные государства, для которых нефть является стратегическим ресурсом, прилагают значительные усилия, чтобы сохранить свои регулирующие полномочия и противостоять глобальному управлению нефтью, учитывая, что она является источником экономического роста и глобальной политической власти. Доходы от нефти и газа составили более 45% федерального бюджета России в 2015 году [73] и составили около 15% ВВП [74].Европейцы полагаются на российский импорт 30% импортируемого газа и 35% сырой нефти [75]. Газ особенно важен внутри страны, поскольку он используется примерно для 50% отопления жилых домов и производства электроэнергии в стране [75]. Российское правительство пыталось превратить изобилие природных ресурсов в политическую силу на мировой арене и использовало поставки нефти и газа для давления на соседние постсоветские государства. Нефть и газ также служат источником национальной гордости. В 2005 году президент Путин заявил, что Россия является сверхдержавой и мировым лидером в энергетическом секторе [76].Энергетическая безопасность в российской идеологии является неотъемлемой частью национальной безопасности. Поэтому с тех пор, как Путин пришел к власти в 2000 году, он инициировал реформы, усиливающие государственный контроль над нефтедобычей, включая социальные вопросы, связанные с добычей нефти [77,78]. Доходы от нефтегазового сектора способствовали быстрому экономическому росту с 1999 по 2008 год и были средством повышения уровня жизни и инвестирования в государственную инфраструктуру и социальные программы. Можно утверждать, что богатство нефти и газа также позволило государству бóльшую автономию от налогообложения граждан и, следовательно, большую независимость действий в целом.Тем не менее, под давлением мирового рынка российские нефтегазовые компании выборочно приняли глобальные стандарты, такие как Глобальный договор, Глобальная инициатива по отчетности (GRI) и сертификация ISO. Финансовые связи с акционерами и международными финансовыми организациями, как в случае с Новатэком, по всей видимости, способствуют некоторому внедрению глобальных стандартов, таких как те, которые защищают права коренных народов. Новатэк приложил больше усилий, чем другие компании, для обеспечения форумов для переговоров для сообществ коренных народов, таких как Координационный совет, который создан для того, чтобы позволить некоторым гражданам участвовать в управлении и который может служить для ограничения нарушений прав коренных народов.В целом, однако, управление нефтегазовым сектором в России, как правило, не отличается строгой приверженностью мировым стандартам, отчасти из-за заинтересованности государства в том, чтобы оставаться ключевым лицом, принимающим решения. Это контрастирует с более активной ролью глобального управления в некоторых других секторах природных ресурсов России, таких как лесное хозяйство [33]. Опора российского правительства на нефть как на экономическую и политическую власть действует как своего рода барьер для притупления глобального влияния. Исследования, проведенные на Ямале, показывают, что российские государственные чиновники по-прежнему активно участвуют во взаимодействии между нефтегазовыми компаниями, коренными НПО и местными сообществами, в том числе в формировании механизмов совместного использования выгод.Государство допускает глобализацию сетей добычи нефти и изменения поставок, поощряет иностранные инвестиции и партнерство, а также передачу передовых технологий. Однако повседневное управление нефтегазовыми ресурсами, включая его социальные и экологические аспекты, остается под строгим государственным законодательством и контролем, поскольку государство владеет землей, сдает ее в аренду компаниям и регулирует других землепользователей.
5.1. Гражданская деятельность, контролируемая государством, и форумы для переговоров
Правила и стандарты глобального управления часто предназначены для усиления роли НПО и ассоциаций коренных народов в сети, способствующей управлению.Однако в случае с Ямалом ассоциации коренных народов работают в тесном сотрудничестве с региональным правительством и промышленностью. Эти НПО возникли сначала как организации общественных движений в период с середины 1980-х до конца 1990-х годов с целью защиты прав коренных народов. Однако, хотя эти группы по-прежнему участвуют в делах сообщества и предлагают гранты на развитие сообщества, ассоциации коренных народов теперь часто служат для легитимации государственной политики и решений. Ни одна из ассоциаций «Ямал» или «Ямал - потомкам» не участвует в транснациональных сетях коренных народов или других транснациональных сетях НПО, и они не участвовали в комитетах коренных народов ООН или других глобальных организациях.Вместо этого их основные отношения связаны с региональными и местными властями Ямала. Обе группы организуют местные форумы между правительственными чиновниками и оленеводами из числа коренного населения и участвуют в переговорах по социально-экономическим соглашениям и государственному финансированию, которое распределяется по всему региону. В нескольких заметных случаях эти ассоциации коренных народов поддерживали позицию правительства по проектам строительства нефтяных месторождений, несмотря на обеспокоенность местных жителей и попытки рядовых людей вести переговоры с представителями компаний.Например, в конфликте 2019 года между Газпромом и коренными оленеводами по поводу строительства трубопровода обе ассоциации коренных народов поддержали повестку дня нефтяных компаний и государства, а не местного сообщества коренных народов. Действительно, сопротивление оленеводов строительству трубопровода и их обращение в ООН привело к репрессиям [65,66,67]. Без поддержки региональных НПО или связей с сетью транснациональных НПО движение сопротивления демобилизовалось.

В сети, генерирующей управление, форумы переговоров между нефтяными компаниями и представителями гражданского общества могут быть организованы в разных масштабах и включать как глобальных, так и местных участников.Ассоциации коренных народов Ямала не участвуют в транснациональных форумах, таких как Арктический совет или рабочие группы ООН, вместо того, чтобы полагаться на общественные слушания, организуемые муниципальными властями. Однако большинство публичных слушаний, по-видимому, проводятся как формальность и не представляют собой средство согласования интересов нефтяных компаний и коренных народов. Координационный совет, организованный НОВАТЭКом и стимулируемый директивами иностранных инвестиционных банков, является исключением и включает в себя участие коренных жителей и представителей компаний, занимающихся связями с общественностью.

5.2. Соглашения о распределении выгод, контролируемых государством
Усилия по укреплению глобальных правил и стандартов, регулирующих добычу, подчеркнули важность получения «социальной лицензии на деятельность» от местных субъектов, включая затронутые сообщества, коренные народы и НПО. Однако на Ямале мы видим непреходящую важность «государственной лицензии на право ведения деятельности». Решения о разведке, добыче и транспортировке нефти на Ямале - независимо от их воздействия на местных жителей - принимаются с разрешения государственных субъектов или путем переговоров с ними.На практике SLO предоставляется региональными властями, а не местными заинтересованными сторонами. Аналогичное значение по умолчанию для государственных предпочтений присутствует и при совместном использовании выгод. Распределение выгод между отраслями и сообществами на участках добычи стало важным ориентиром в глобальном управлении природными ресурсами. На Ямале распределение выгод осуществляется в нескольких формах, включая социально-экономические соглашения с региональным правительством и муниципалитетами [79], и региональные и местные власти являются ключевыми участниками переговоров об уровнях финансирования и лицами, принимающими решения о том, каким должно быть это финансирование. выделено.Учитывая, что подавляющая часть налоговых поступлений от нефтегазовой отрасли поступает в федеральный бюджет, социально-экономические соглашения предоставляют региональным и местным властям возможность сохранить финансирование на местном уровне для заполнения пробелов в региональных бюджетах и ​​для поддержки государственной инфраструктуры. Финансовые трансферты, как правило, приносят пользу сельским жителям, пользующимся общественной инфраструктурой, а не оленеводам, занимающимся традиционной практикой. Оленеводческие предприятия, арендующие сельскохозяйственные земли, предназначенные для оленеводства, могут использовать разработанную на федеральном уровне методологию для требования компенсации за земли, утраченные или поврежденные в результате промышленного развития, но оленеводческие предприятия, не имеющие аренды, не имеют такой возможности.Поскольку региональное законодательство о «территориях традиционного использования природных ресурсов» до сих пор не применялось, большое количество частных оленеводов используют традиционные земли без юридического подтверждения своих прав. До сих пор государственные органы не помогали оленеводам назначать TTNU, что давало бы оленеводам право на компенсацию.

Гетерогенность и адаптация, вызванная таргетной терапией при раке легкого, выявленная с помощью продольного секвенирования одноклеточной РНК

Введение

Неоднородность является свойством многих биологических систем и заболеваний, таких как рак.Биологическая пластичность раковых клеток является одной из форм гетерогенности, которая позволяет раннюю адаптацию к лечению и ограничивает успех точных подходов к лечению рака (Yuan et al., 2019; Xue et al., 2017). В дополнение к внутренней гетерогенности раковых клеток, клетки в микроокружении опухоли (TME) дополнительно вносят вклад в гетерогенность опухоли внешним образом раковых клеток. Хотя эти опухолевые компартменты и неоднородность опухоли были охарактеризованы для многих подтипов рака (Gerlinger et al., 2012; Александров и др., 2013; Лоуренс и др., 2013; Браннон и др., 2014; Ли и др., 2014; Vignot et al., 2015; Hata et al., 2016), наше понимание того, как эти свойства развиваются и взаимодействуют в долгосрочном плане в ответ на системное лечение, остается неполным, особенно в случае метастатических опухолей.

Многие раковые образования, вызванные онкогенами, например, с онкогенными изменениями в EGFR, ALK, ROS1 и BRAF , лечат таргетной терапией против родственного онкопротеина или сигнального пути.Это привело к улучшению клинических исходов метастатического солидного рака, такого как рак легкого и меланома, а также гематологических злокачественных новообразований (Flaherty et al., 2012; Mok et al., 2009; Shaw et al., 2013). Парадигмой молекулярной терапии и изучения эволюции опухолей является рак легкого, ведущая причина смертности от рака во всем мире (Siegel et al., 2018), при этом немелкоклеточный рак легкого (NSCLC) составляет основной подтип (Swanton and Govindan, 2016). Несмотря на успех таргетной терапии при раковых заболеваниях, таких как НМРЛ, опухоли обычно не полностью реагируют в виде остаточного заболевания, которое является прелюдией к прогрессированию опухоли из-за индуцированной терапией эволюции опухоли.Массовый отбор образцов опухоли после прогрессирования опухоли при таргетной терапии выявил механизмы устойчивости и продемонстрировал, что опухоли становятся все более молекулярно гетерогенными после прогрессирования терапии (Blakely et al., 2017a; Camidge et al., 2014; McCoach et al., 2018; Rotow and Bivona, 2017).

Секвенирование одноклеточной РНК (scRNAseq) - один из признанных подходов к анализу гетерогенности сложных биологических систем (Chung et al., 2017; Darmanis et al., 2017; Tirosh et al., 2016). Сравнение одноклеточных профилей транскрипции отдельных клеток в разные моменты времени лечения может привести к более глубокому пониманию эволюции клеточных состояний как раковых клеток, так и клеток TME, происходящих во время лечения.В настоящее время мало исследований одноклеточного транскриптома, в которых используются образцы метастатических солидных злокачественных новообразований, и предшествующие исследования scR-NAseq метастатического заболевания, в основном сосредоточенные на отдельных временных точках лечения (Chung et al., 2017a; Darmanis et al., 2017; Lambrechts et al. , 2018a; Patel et al., 2014a; Tirosh et al., 2016a; Wang et al., 2019; Zhang et al., 2019a). Отчасти это связано с проблемами, связанными с получением высококачественной биопсии из метастатических опухолей вместо более крупных образцов опухоли, которые можно получить при хирургической резекции на более ранней стадии заболевания.Получение нескольких биопсий опухоли продольно в разные моменты времени во время системной терапии пациентов с метастатическими солидными опухолями индивидуально и в составе группы является дополнительной проблемой, которую необходимо преодолеть, чтобы изучить адаптацию опухоли к системной терапии.

Помимо анализа биопсий опухоли, полученных как до лечения, так и при прогрессировании опухоли, анализ образцов опухоли на поздних стадиях, отражающих состояние остаточного заболевания ( RD ) во время терапии, может выявить клинически значимые биологические события, которые делают возможным сохранение раковых клеток.Развитие более глубокого понимания эволюционирующих изменений клеточного состояния во время лечения, и особенно в состоянии РЗ, имеет важное значение для повышения долговечности и масштабов ответа на прецизионные методы лечения рака. Анализ образцов RD может помочь идентифицировать терапевтические мишени в раке и клетках TME для использования в окне возможностей во время терапии, чтобы упредить последующую эволюцию к абсолютной лекарственной устойчивости.

Мы выполнили анализ scRNAseq на биоптатах опухоли НМРЛ человека, собранных при различных состояниях лечения.Наша цель состояла в том, чтобы помочь выяснить фенотипическую пластичность раковых клеток, а также вклад и динамическую природу TME во время терапии, которые индивидуально и в совокупности способствуют развитию РЗ и последующего прогрессирующего заболевания во время таргетной терапии. Для этого мы разработали уникальный протокол клинической повторной биопсии опухоли, в котором образцы НМРЛ на поздних стадиях были получены от пациентов продольно до системной таргетной терапии ( наивных лечения, TN ), при остаточном состоянии болезни во время ответа на лечение ( остаточной болезни, RD ) и при последующем установлении приобретенной лекарственной устойчивости (прогрессирование , PD ).Мы разработали специальную структуру обработки и анализа тканей, адаптированную к относительно небольшим и сложным образцам биопсии опухоли легких на поздних стадиях, чтобы: 1) оценить выраженный мутационный ландшафт образцов опухоли, 2) охарактеризовать сигнатуры транскрипционных генов, уникальные для различных временных точек лечения, 3) исследовать свойства TME по мере их развития во время лечения и 4) описывать взаимодействие между раковыми клетками и TME во время таргетной терапии.

Результаты

Продольный анализ scRNAseq продвинутой стадии НМРЛ во время таргетной терапии

Мы использовали scRNAseq для профилирования 44 образцов (41 аденокарцинома легкого, 1 плоскоклеточная карцинома и 2 нормальные прилегающие ткани) (Рисунок 1A), что соответствует 27 отдельным пациентам .Мы использовали рабочий процесс быстрой обработки, настроенный для выделения жизнеспособных единичных клеток, прежде всего, из тонкоигольных аспиратов (FNA), биопсий стержневой иглы и образцов плевроцентеза в дополнение к стандартным хирургическим резекциям (рис. 1B). Образцы биопсии опухоли были собраны и немедленно обработаны до и во время системной таргетной терапии (рис. 1C, дополнительная таблица 1).

Таблица 1. Таблица общих и уникальных характеристик в разные сроки лечения и возможных терапевтических подходов Рис. 1. Характеристики пациентов и обзор экспериментов

Конвейер обработки тканей для scRNAseq.Образцы пациентов сначала подвергались механической и ферментативной дезагрегации, а затем отдельные клетки были отсортированы в микротитровальные планшеты с использованием FACS. Синтез кДНК выполняли с использованием протокола Smart-seq2, а библиотеки секвенировали на платформах Illumina. (B) Диаграмма консорта сбора образцов. Всего было обработано 51 биопсия. Использовали только образцы с клетками, прошедшими контроль качества (n = 42). (C) Круговой график, иллюстрирующий клинически идентифицированный онкогенный фактор (внешний круг) и момент времени лечения (внутренний круг) для каждого образца.(D) график t-SNE для всех 21 409 клеток, окрашенных в соответствии с их клеточной идентичностью, как определено из профилирования экспрессии генов (эпителиальные клетки (n = 5 109, иммунные клетки (n = 12 077), стромальные клетки (n = 4223).

Экспрессия генов). профили 21 409 клеток были сохранены после фильтрации для контроля качества (дополнительный рисунок 1A). После нормализации экспрессии генов мы выполнили анализ главных компонентов (PCA), используя набор генов с различной экспрессией во всех клетках. Мы сгруппировали клетки, используя кластеризацию на основе графиков на информативное пространство главных компонент (npcs = 20).Полученные кластеры клеток были аннотированы как иммунные клетки, стромальные клетки (фибробласты, эндотелиальные клетки и меланоциты) и эпителиальные клетки (рис. 1D) с помощью анализа генной экспрессии установленных маркерных генов (Lambrechts et al., 2018; Schiller et al., 2019; Tabula Muris Consortium et al., 2018; Treutlein et al., 2014) (дополнительная таблица 2). Эпителиальные клетки (n = 5 109) были подмножеством и повторно кластеризованы в 31 дискретный эпителиальный кластер (дополнительный рисунок 1B).

Рис. S1, связанный с рисунком 1

(A) Диаграмма рассеяния с граничными гистограммами, показывающими количество уникальных генов, нанесенных на график в зависимости от количества считываний для всех клеток, прошедших контроль качества.(B) t-SNE всех эпителиальных клеток (n = 5 · 109), числа соответствуют отдельным кластерам. (C) Предполагаемые крупномасштабные вариации числа копий (CNV) помогают идентифицировать раковые (розовый) и нераковые клетки (фиолетовый). Эпителиальные клетки и шип в контрольных клетках включены по оси абсцисс, а области хромосом - по оси ординат. Амплификации (красный) или делеции (синий) предполагали путем усреднения экспрессии по 100 участкам генов на соответствующих хромосомах. (D) Гистограмма количества клеток аннотированных эпителиальных клеток. (E) Гистограмма количества уникальных генов во всех аннотированных типах эпителиальных клеток.

Основанная на кластеризации вариация числа копий устраняет рак из нераковых эпителиальных клеток

Учитывая известную связь между раком и крупномасштабными хромосомными изменениями, мы использовали установленную аналитическую основу для вывода вариации числа копий (CNV) из экспрессии РНК для классификации эпителиальные клетки как раковые или нераковые (Patel et al., 2014; Puram et al., 2017; Tirosh et al., 2016; Venteicher et al., 2017; https://github.com/broadinstitute/inferCNV) . По сравнению с фибробластами и эндотелиальными клетками, которые использовались в качестве контроля, раковые клетки демонстрировали большие отклонения от относительной интенсивности экспрессии во многих областях генома (дополнительный рисунок 1C).После идентификации раковых и нераковых эпителиальных клеток кластеры нераковых эпителиальных клеток (n = 13) были дополнительно аннотированы как легочно-альвеолярный тип 2 (AT2), легочный альвеолярный тип 1 (AT1), гепатоциты, клубные клетки, базальные клетки. , ионоциты или стромальные клетки (дополнительный рисунок 1D).

Как отмечали другие (Zhang et al., 1997), мы обнаружили, что эти раковые клетки экспрессируют повышенное количество уникальных генов по сравнению с нераковыми клетками (дополнительный рисунок 1E). Эта разница в количестве уникально экспрессируемых генов не объяснялась глубиной секвенирования (корреляция Пирсона = 0.17).

Все раковые клетки (n = 3 620) были разделены на подмножества и повторно кластеризованы, в результате чего было получено 24 уникальных кластера в 38 полных образцах (дополнительные рисунки 2A, 2B). Для каждого кластера мы рассчитали занятость пациента, определяемую как количество клеток отдельного пациента с наибольшим вкладом по сравнению с общим количеством клеток в этом кластере как для нераковых, так и для раковых эпителиальных клеток (дополнительный рисунок 2C). Большинство кластеров раковых клеток относятся к конкретному пациенту и имеют высокие баллы занятости пациентов, аналогичные результатам, полученным в других исследованиях (Chung et al., 2017; Дарманис и др., 2017; Puram et al., 2017; Тирош и др., 2016). И наоборот, нераковые клетки демонстрируют более низкую занятость пациентов, при этом несколько пациентов вносят клетки в каждый кластер (дополнительный рисунок 2C). Таким образом, кластеризация злокачественных клеток конкретного пациента отражает уникальные молекулярные признаки опухоли отдельного пациента, а не потенциальные технические проблемы.

Рис. S2, относящийся к рис. 2 График t-SNE

(A) для 3620 раковых клеток из 38 образцов, числа обозначают отдельные кластеры.(B) Круговой график, иллюстрирующий клинически идентифицированный онкогенный фактор (внешний круг) и временные точки (внутренний круг) каждой биопсии, только для раковых клеток. C) Распределение плотности скоплений раковых (красный) и нераковых (синий) эпителиальных клеток, рассчитанное как процентное соотношение индивидуального пациента с наибольшим вкладом к общему количеству клеток для этого кластера. (D) Иллюстрация гетерогенности первичных мутировавших драйвер раковых клеток, обнаруженных в образце LTS47 (* на рисунке 2A).

Рис. 2. scRNAseq делает вывод о мутационном статусе пациента и выявляет сложный мутационный ландшафт в раковых клетках.

(A) Клинические характеристики 30 образцов NSCLC, в которых были идентифицированы онкогенные факторы и / или гены COSMIC уровня 1. Столбцы указывают время лечения (TN, RD, PD), происхождение первичного или метастатического образца, место биопсии и выполненный клинический NGS-тест. Продольные образцы от одного и того же пациента обозначены хронологическими номерами встреч (например, E1, E2) и сгруппированы стрелками.(B) Мутационный ландшафт раковых клеток для каждого образца пациента, как определено с помощью scRNAseq, представленного в виде тепловой карты. Цвет указывает количество считываний мутанта для каждой области генома и образца, деленное на общее количество считываний для этой области в этом образце. Ожидаемый онкогенный фактор, определяемый клиническим анализом NGS, отмечен знаком «X». NC-Нет покрытия для конкретного образца. (C) Мутационный ландшафт генов COSMIC tier 1. Цвет указывает количество считываний мутанта для каждой области генома и образца, деленное на общее количество считываний для этой области в этом образце.Названия генов, выделенные черным цветом, указывают на включение во все клинические анализы NGS (кроме теста на один ген UCSF), тогда как названия генов, выделенные серым цветом, включены только в избранные анализы (дополнительная таблица 2). D) График Каплана-Мейера, показывающий общую выживаемость 1269 пациентов с НМРЛ в наборе данных MSK-Impact. Пациенты были стратифицированы по высоким (> = 2) и низким (<2) мутациям из 141 мутации, которые обнаружены как в наборе данных MSK-Impact, так и в панели (C).

анализ scRNA-seq выявляет богатую сложность экспрессируемых генных изменений в раковых клетках

Дополнительные генетические изменения, обнаруженные с помощью анализа на основе объемной опухолевой ДНК, могут сосуществовать с первичным нацеленным онкогенным «драйверным» изменением (например.грамм. онкогенный EGFR, ALK, BRAF, ROS1, KRAS и MET ) и может способствовать прогрессированию опухоли и ограничивать терапевтический ответ (Blakely et al., 2017; Kim et al., 2019; Scheffler et al., 2019; Yang и др., 2019). Мы запросили транскрипты scRNAseq из каждой раковой клетки, чтобы определить соматические изменения, а именно однонуклеотидные полиморфизмы (SNP), вставки / делеции (инделения) и слияния генов (рис. 2A, 2B, 2C). Мы идентифицировали 17 из 38 образцов биопсии опухоли, которые содержали раковые клетки, несущие клинически идентифицированный онкогенный фактор (рис. 2В, дополнительная таблица 3), что согласуется с известной вероятностью выпадения результатов в анализах scR-NAseq (Харченко и др., 2014). Среди этих 17 образцов, в которых мы обнаружили по крайней мере одну клетку, несущую клинически действенную мутацию, было 7 образцов, в которых по крайней мере одна другая клетка содержала дополнительное онкогенное изменение, не обнаруженное при клиническом испытании образца опухоли от того же пациента ( т.е. оккультные генетические изменения) (Рисунок 2B). Один из таких примеров из наших данных иллюстрируется образцом LTS47. Эта опухоль, как было установлено, содержит онкогенную реаранжировку EML4-ALK с помощью общего анализа ДНК клинического уровня.Однако scRNAseq дополнительно выявил, что этот образец содержал раковые клетки, несущие скрытые мутации KRAS G13D и KRAS G12C; ни одна из популяций мутантных клеток KRAS не показала доказательств реаранжировки гена ALK (дополнительный рисунок 2D). Этот образец был получен от пациента после нескольких направлений терапии, которые, вероятно, позволили развить несколько механизмов устойчивости, включая 2 различные онкогенные формы KRAS , которые являются известными механизмами устойчивости к лечению ингибитором ALK (Doebele et al. ., 2012; Хрустанович и Бивона, 2015; Шоу и Энгельман, 2013).

Мы также запросили транскрипты scRNAseq на наличие мутаций из мутаций уровня 1 аденокарциномы легких COSMIC (Каталог соматических мутаций при раке) (дополнительная таблица 2) (Forbes et al., 2017; Shihab et al., 2015), уделяя особое внимание мутациям. которые классифицируются как «патогенные». Многие из выявленных нами мутаций ранее не сообщались в ходе клинического анализа опухоли пациента, несмотря на то, что они были включены в клиническую панель (рис. 2С, дополнительные таблицы 2 и 3).Хотя это может отражать разницу в методике биопсии или клональности опухоли во время клинического тестирования, эти результаты также демонстрируют, что массовое тестирование на основе ДНК клинического уровня может недооценивать гетерогенность опухоли. Чтобы оценить клинические исходы пациентов с множественными онкогенными изменениями и определить более широкое трансляционное влияние наших результатов, мы использовали набор данных MSK-Impact NSCLC, который содержит клинические данные и данные секвенирования для более чем 800 пациентов с продвинутой стадией NSCLC (Zehir et al. ., 2017). Пациенты с более чем 2 мутациями из мутаций COSMIC первого уровня, обнаруженными в наборе данных scRNAseq (высокая мутация), имели значительно более низкую общую выживаемость (p <0,01) по сравнению с пациентами с менее 2 мутациями (низкая мутация). более двух космических мутаций уровня 1 (рис. 2D). Таким образом, анализ scR-NAseq может дополнять текущие клинические анализы на основе объемной ДНК для обеспечения повышенной детализации геномной гетерогенности раковых клеток и дает представление о мутационном ландшафте, который экспрессируется на уровне РНК в раковых клетках поздних стадий опухолей, с клинические последствия.

Транскрипционные различия между злокачественными клетками TN и RD, обнаруженные с помощью анализа scRNAseq, выявляют биологические программы, специфичные для состояния клеток включают остаточное заболевание во время начального лечения. Мы сравнили профили транскрипции отдельных раковых клеток, полученных из образцов опухолей от TN до RD (дополнительная таблица 4), и значительно сосредоточили наше внимание на 691 (p

<0.05) активированные гены в раковых клетках RD в качестве прокси для доказательства активации пути. Мы обнаружили отдельные гены, связанные со специфическими связанными с раком путями, такими как выживаемость, рост клеток, инвазия и метастазирование (дополнительная таблица 5). В качестве контроля и в соответствии с ожиданием того, что во время целевого лечения выжившие раковые клетки и продолжающая лекарственная терапия, как правило, менее пролиферативны (Sharma et al., 2010; Zhu et al., 2001), мы обнаружили, что раковые клетки RD экспрессируют сниженные гены-маркеры пролиферации. по сравнению как с TN, так и с PD (дополнительный рисунок 3A) (Hsiao et al., 2019).

Фиг. S3, относящейся к Фиг. 3

(A) Точечный график относительной экспрессии установленных генов клеточной пролиферации (ось x) по временным точкам лечения (ось y). Шкала интенсивности цвета отражает среднюю экспрессию гена, а шкала размеров указывает количество клеток, экспрессирующих ген в течение этого периода лечения. Применение сгруппированных попарных сравнений точек времени обработки средней масштабированной экспрессии всех генов продемонстрировало значительно различающуюся экспрессию (p <0.000001) во всех сравнениях. (B) Тепловая карта, показывающая экспрессию генов в альвеолярной сигнатуре. Клетки сгруппированы по времени лечения. (C) График корреляции Спирмена раковых клеток из всех временных точек лечения и здоровых клеток AT2 с внешним эталоном здоровых клеток AT2. Неканцерогенные клетки AT2 из нашего набора данных были больше похожи на внешние здоровые клетки AT2, чем на любые из наших раковых клеток во все моменты времени (средняя корреляция Спирмена = 0,73, -0,14, 0,23, -0,19 для здоровых клеток AT2 и TN, RD, PD раковые клетки соответственно.(D) Оценка окрашивания IHC для AQP4 в TN (n = 19), RD (n = 9) и PD (n = 5) срезах опухолевой ткани. Тест хи-квадрат продемонстрировал значительную разницу (p = 0,0038) в пропорциях групп интенсивности окрашивания между временными точками лечения. (E) Оценка иммунореактивности для AQP4 по всем временным точкам из S3D. (F, G, H) Тепловые карты, показывающие экспрессию генов в каждой сигнатуре (кинуренин, активация SERPINE1 / плазминогена и щелевое соединение, соответственно), сгруппированные по временным точкам лечения. (I) Графическая сводка изменений экспрессии раковых клеток во время лечения.Особенности RD включают (1) альвеолярную сигнатуру и (2) различные инвазивные пути передачи сигналов, специфичные для RD. Характеристики PD включают: (3) сигнатуру кинуренина, (4) активацию плазминогена и сигнатуры SERPINE1, (5) белки щелевых соединений, (6) экспрессию провоспалительных хемокинов, (7) потерю генов-супрессоров опухоли и (8) различные Специфические инвазивные сигнальные пути БП.

Рис. 3. Анализ дифференциальной экспрессии генов между точками времени лечения выявляет транскрипционные сигнатуры, специфичные для стадии лечения.

(A) Коробчатые диаграммы, показывающие уровень экспрессии альвеолярной сигнатуры в разные моменты времени лечения, а также незлокачественные клетки AT2 из нашей когорты.(B) Изменение экспрессии NKX2-1 , количественно определенное с помощью RT-PCR в клетках PC9 после обработки носителем (2 дня), осимертинибом через 7 дней (RD), 19 дней (RD) и в состоянии приобретенной устойчивости к эта клеточная линия, день 70 (см. методы) (AR), *** означает p <0,001. (C) Типичные изображения IHC срезов опухолевой ткани TN, RD и PD, окрашенные на AQP4, демонстрирующие повышенную экспрессию в момент времени RD. Шкала соответствует 50 мкм. См. Дополнительный рисунок 3D, E для проверки когорты.(D) График Каплана-Мейера взаимосвязи между альвеолярной сигнатурой и ОС пациента в наборе данных TGCA. Пациенты были стратифицированы по высокой (n = 143) и низкой (n = 141) экспрессии сигнатуры. (E) Ящичковые диаграммы, показывающие уровни экспрессии сигнатуры кинуренина в разные моменты времени лечения. (F) Изменение экспрессии QPRT, как количественно определено с помощью ОТ-ПЦР, в клетках PC9 после обработки осимертинибом, как в (B) (см. Методы) (AR), * означает p <0,05. (G) График Каплана-Мейера взаимосвязи между сигнатурой кинуренина и ОС пациента в наборе данных TGCA.Пациенты были стратифицированы по высокой (n = 146) и низкой (n = 141) экспрессии сигнатуры. (H, I) Графики в виде прямоугольников, показывающие уровни экспрессии активации плазминогена, сигнатуры пути SERPINE1 в разные моменты времени лечения. (J, K) графики Каплана-Мейера взаимосвязи между сигнатурой пути активации плазминогена и SERPINE1 и ОС пациента в наборе данных TGCA, соответственно. Пациенты были стратифицированы по экспрессии с высокой и низкой сигнатурой. (L) Коробчатая диаграмма, показывающая уровни экспрессии сигнатуры щелевого соединения по временным точкам лечения.(M) Графики Каплана-Мейера взаимосвязей между сигнатурой щелевого соединения и ОС пациента в наборе данных TGCA. Пациенты были стратифицированы по экспрессии с высокой и низкой сигнатурой.

Интересно, что мы идентифицировали сигнатуру экспрессии гена альвеолярных клеток, состоящую из 17 установленных генных маркеров альвеолярных клеток (Vieira Braga et al., 2019; Wade et al., 2006), которые показали значительно (p <0,0001) повышенную экспрессию в RD по сравнению с Точки времени TN (рисунок 3A, дополнительный рисунок 3B, дополнительная таблица 2).Альвеолярные клетки делятся на подтипы альвеолярного типа 1 (AT1) и типа 2 (AT2) и образуют выстилку альвеол легких. Клетки AT2 продуцируют сурфактанты и могут действовать как стволовые клетки-предшественники (Nabhan et al., 2018), которые становятся активными и размножаются при различных типах повреждений легких. Предполагается, что клетка AT2 также является клеткой происхождения онкогенного рака легких (Desai et al., 2014; Hanna and Onaitis, 2013; Nabhan et al., 2018). Клетки AT1 являются доминирующей популяцией в альвеолах и опосредуют газообмен и, когда они повреждены или умирают, могут высвобождать сигналы пролиферации и регенерации (Desai et al., 2014). Альвеолярная сигнатура, которую мы обнаружили в раковых клетках при RD, включает повышенную экспрессию генов, связанных как с AT1, так и с AT2 (дополнительная таблица 2), включая AQP4, SFTPB / C / D, CLDN18, FOXA2, NKX2-1 и PGC. для клеток AT2 (Desai et al., 2014; Liu et al., 2003; Nabhan et al., 2018; Wade et al., 2006; Xu et al., 2016; Zhou et al., 2018) и AGER и HOPX для клеток AT1 (Nabhan et al., 2018a; Serveaux-Dancer et al., 2019) (дополнительный рисунок 3B).Дополнительный анализ показал, что состояние альвеолярных клеток, которое мы идентифицировали в раковых клетках, не было получено из неправильно аннотированных нераковых альвеолярных клеток в наших популяциях раковых клеток (дополнительный рисунок 3C).

Мы подтвердили активацию сигнатуры альвеолярных клеток в RD с использованием ортогональных подходов. Во-первых, мы использовали установленную доклиническую модель, состоящую из полученных от пациента EGFR-мутантных клеток NSCLC (PC9) (Lee et al., 1985), для разработки аналогов клинических состояний TN, RD и PD и измерили экспрессию подмножества гены состояния альвеолярных клеток (с помощью RT-PCR), обнаруженные на RD в клинических образцах опухолей.Клетки обрабатывали носителем (ДМСО) или стандартным ингибитором EGFR (осимертиниб) и отбирали образцы в контрольных условиях (день 2 в ДМСО), во время RD (дни 7 и 19) и в PD (день 70, приобретенная устойчивость). Мы обнаружили значительно повышенную экспрессию NKX2-1 , отличительного гена сигнатуры альвеолярных клеток, активизированного в клинических образцах RD, на 7 и 19 дни по сравнению с контролем и 70 днями (Рисунок 3B). Это демонстрирует, что наши результаты анализа scRNAseq могут быть воспроизведены в контролируемых условиях in vitro .Кроме того, иммуногистохимический (ИГХ) анализ показал индукцию экспрессии белка AQP4, другого маркера сигнатуры альвеолярных клеток, на плазматической мембране клинических образцов RD по сравнению с клиническими образцами TN и PD (рисунок 3C, дополнительный рисунок 3D-E). Коллективные данные подтверждают ключевые результаты scRNAseq, полученные в результате клинической биопсии опухоли.

Затем мы определили, имеет ли сигнатура альвеолярных клеток более широкое клиническое значение, исследуя, является ли она биомаркером выживаемости пациентов в массиве данных RNAseq TGCA по аденокарциноме легких, созданном исследовательской сетью TCGA (https: // www.Cancer.gov/tcga, Сеть исследований атласа генома рака и др., 2013 г.). Мы обнаружили значительную (p <0,0001) связь между высокой экспрессией нашей сигнатуры альвеолярных клеток и улучшением общей выживаемости (OS) (Рисунок 3D). Эти коллективные данные подтверждают утверждение о том, что существует отчетливая сигнатура экспрессии генов типа альвеолярных клеток, характеризующая раковые клетки RD, которая связана с улучшением выживаемости пациентов. Правдоподобная модель состоит в том, что идентифицированная нами альвеолярная сигнатура отражает сигнал клеточного повреждения и репарации, в котором механизм реакции на повреждение в злокачественных клетках AT1 / 2 активирует регенеративный сигнальный путь и переход к более примитивному клеточному состоянию.Это может помочь в восстановлении после травмы в результате гибели клеток во время лечения, чтобы поддержать устойчивость раковых клеток, в то же время создавая менее агрессивное злокачественное состояние. Это согласуется с представлением о том, что RD представляет собой «персистирующее» состояние клеток, наблюдаемое в доклинических моделях раковых клеток с медленным циклом, которые выживают без быстрой пролиферации (как на дополнительном рисунке 3A), в качестве прелюдии к началу агрессивного прогрессирования опухоли после приема абсолютного лекарства. резистентность (Hata et al., 2016).

Молекулярные детали сигнатуры восстановления альвеолярных и клеточных повреждений заслуживают внимания.В нашей когорте RD гены WNT / β-катенин-ассоциированного пути AFF3, SUSD2 и CAV1 проявляли повышенную экспрессию (дополнительная таблица 5). AFF3 и SUSD2 являются активированными нижестоящими мишенями пути WNT (Lefèvre et al., 2015; Umeda et al., 2018; Xu et al., 2018), в то время как CAV1 может способствовать ядерной локализации β-катенина ( CTNNB1 ) и транскрипционная активация пути WNT / β-catenin (Yu et al., 2014). При НМРЛ сигнальный путь WNT / β-катенин способствует онкогенезу (Juan et al., 2014; Накаяма и др., 2014; Pacheco-Pinedo et al., 2011), репарация и регенерация после повреждения клеток (Huch et al., 2013; Tammela et al., 2017). Самовосстановление и реакция на повреждение в клетках AT2 могут специфически использовать сигнальный путь WNT / β-catenin (Nabhan et al., 2018b; Stewart, 2014). Кроме того, в мутантном NSCLC EGFR путь WNT / β-катенин может ограничивать ответ ингибитора EGFR и может приводить к выживанию популяции клеток-персистеров во время терапии ингибитором EGFR in vitro (Arasada et al., 2018; Blakely et al., 2017; Casás-Selves et al., 2012; Накаяма и др., 2014). В целом состояние RD характеризуется сигналами клеточного повреждения и выживания, которые частично действуют через путь WNT / β-катенин, который может быть терапевтически нацелен (Krishnamurthy and Kurzrock, 2018).

Различия в транскрипции между злокачественными клетками TN и PD выявляют иммунную модуляцию и клеточную инвазию как ключевые особенности прогрессирования рака

При сравнении раковых клеток из образцов TN и PD мы обнаружили 958 дифференциально экспрессируемых генов с более высокой экспрессией в раковых клетках PD (дополнительная таблица 4).Внутри этих генов мы идентифицировали гены, участвующие в пути кинуренина, а также множественные гены и пути, связанные с инвазией опухоли, метастазированием, жизнеспособностью клеток и воспалением (дополнительная таблица 5). Мы наблюдали значительное (p <0,0001) увеличение экспрессии IDO1, KYNU и QPRT , каждый из которых участвует в пути кинуренина, в раковых клетках PD по сравнению с TN (Рисунок 3E, дополнительный рисунок 3F, дополнительный Таблица 2). Кинурениновый путь метаболизирует триптофан, генерируя промежуточные катаболиты, которые затем обрабатываются для пополнения клеточного NAD + и поддержки иммуномодулирующих функций (Triplett et al., 2018; Zhai et al., 2018). Экспрессия IDO1, KYNU и QPRT может приводить к иммуносупрессивному поведению (Triplett et al., 2018). Наши данные показывают, что раковые клетки в опухолях БП могут подавлять активность иммунной системы во время таргетной терапии. Идентификация этого пути как медиатора иммуносупрессии в опухолях БП имеет важные потенциальные терапевтические последствия, поскольку известно, что IDO1 активируется при многих раковых заболеваниях (Cheong and Sun, 2018; Hornyák et al., 2018; Лю и др., 2018). Множественные клинические испытания пытались заблокировать этот путь с использованием ингибиторов IDO1 в качестве монотерапии, а также в сочетании с ингибиторами иммунных контрольных точек или гормональной терапией (Ricciuti et al., 2019), хотя и с ограниченным успехом. QPRT также продемонстрировал повышенную экспрессию, специфически на 70 день лечения ингибитором EGFR (т.е. приобретенная устойчивость и аналог клинического БП) нашей модели in vitro с использованием клеток PC9 (рис. 3F), что подтверждает утверждение о том, что этот путь указывает на прогрессирование рака под избирательным давлением лечения.

Для дальнейшей демонстрации клинической значимости пути kynure-nine мы снова использовали набор данных TCGA по аденокарциноме легкого RNAseq. Повышенная экспрессия сигнатуры пути кинуре-девять была биомаркером худшего ОС (p = 0,017) (рисунок 3G). Это согласуется с представлением о том, что активация этого пути приводит к иммуносупрессии и неспособности иммунной системы эффективно контролировать и уничтожать раковые клетки.

Продольные профили scRNAseq раковых клеток изменяются от RD к PD

Мы сравнили раковые клетки из образцов пациентов с RD и PD, чтобы выяснить различия, которые возникают во время роста PD из RD, и обнаружили в общей сложности 2011 генов, которые имели значительно (p <0.001) повышенная экспрессия либо в RD, либо в PD (NRD = 874, NPD = 1,137) (дополнительная таблица 4). Среди дифференциально сверхэкспрессированных генов в RD были гены, связанные с сигнатурой альвеолярных клеток, ростом, дифференцировкой и подвижностью клеток (дополнительная таблица 5). Раковые клетки RD сверхэкспрессируют гены сурфактантов ( SFTPB / C / D и SFTA3 ), которые являются частью сигнатуры альвеолярных клеток (рисунок 3A, дополнительный рисунок 3B) (Desai et al., 2014; Treutlein et al., 2014; Wang et al., 2018). Кроме того, раковые клетки RD также сверхэкспрессируют предполагаемый опухолевый супрессор DLC1 , который является членом семейства RhoGAP негативных регуляторов Rho GTPases и может подавляться при НМРЛ (Healy et al., 2008; Yuan et al., 2004) . Высокая экспрессия DLC1 была связана с улучшенной выживаемостью при НМРЛ (Sun et al., 2019). NKX2-1 и NFIX были сверхэкспрессированы в раковых клетках RD и связаны со снижением подвижности клеток (Ge et al., 2018; Рахман и др., 2017а; Winslow et al., 2011). Низкая экспрессия NKX2-1 ведет к потере дифференцировки и повышенной способности засева опухоли (Winslow et al., 2011). Коллективные результаты, полученные в результате этого и предыдущих анализов раковых клеток RD, предполагают, что состояние восстановления повреждений и регенерации клеток может способствовать вялости раковых клеток, усилению контроля над опухолью и улучшению клинических результатов.

Напротив, раковые клетки PD дифференциально сверхэкспрессируют гены, связанные с инвазией, межклеточной коммуникацией, дифференцировкой и иммунной модуляцией (дополнительная таблица 5).Несколько генов в пути активации плазминогена были значительно сверхэкспрессированы ( ANXA2, PLAT, PLAUR, PLAU ) (фиг. 3H) вместе с ингибитором плазминогена SERPINE1 (PAI1) (p <0,0001, фиг. 3I, дополнительная фигура 3G). ANXA2 и PLAUR являются рецепторными белками в каскаде активации плазминогена и участвуют в воспалении, ангиогенезе, инвазии и метастазировании через деградацию внеклеточного матрикса (Kubala et al., 2018; Zhu et al., 2017). Сигнализация инициируется, когда ANXA2 или PLAU связывается с PLAT (uTa) или PLAU (uPa) соответственно. Затем плазминоген разлагается до плазмина под действием активности PLAT и / или PLAU , что приводит к активации металлопротеиназ и деградации фибрина. SERPINE1 демонстрирует повышенную экспрессию ряда подтипов рака и играет важную роль в клеточной адгезии, инвазии, васкуляризации опухоли, радиорезистентности и иммуносупрессии (Kubala et al., 2018; Чжу и др., 2017). Высокая экспрессия сигнатуры активации плазминогена коррелировала с худшим OS (p = 0,0029) в наборе данных TCGA аденокарциномы легкого RNAseq (рис. 3J). Точно так же в этом независимом наборе данных высокая экспрессия SERPINE1 была связана с худшей ОС (p = 0,012) (рис. 3K). Интересно, что терапия ингибитором EGFR может индуцировать экспрессию SERPINE1 и пациентов с положительной мутацией EGFR с более чем двукратной индукцией уровней SERPINE1 (PAI1) в плазме во время лечения ингибитором EGFR демонстрирует более короткую выживаемость без прогрессирования (Arasada et al., 2018). В совокупности наши продольные результаты, основанные на scRNAseq, проливают свет на клиническую значимость и потенциальную роль каскада активации плазминогена в неблагоприятных клинических исходах и устойчивости к таргетной терапии.

Кроме того, мы обнаружили несколько белков щелевых соединений, которые дифференциально сверхэкспрессируются в раковых клетках PD по сравнению с раковыми клетками RD (p <0,0001, рис. 3L, дополнительная таблица 2). Белки щелевых соединений (например, коннексины) представляют собой интегральные мембранные белки, которые обеспечивают цитозольный обмен ионами, метаболитами и вторичными мессенджерами между клетками (Aasen et al., 2016; Синюк и др., 2018). Хотя некоторые из них были идентифицированы как опухолевые супрессоры, мы обнаружили, что высокая экспрессия GJB2 / 3/4/5 (дополнительный рисунок 3H) была связана с худшей выживаемостью в наборе данных TCGA по аденокарциноме легкого RNAseq (p = 0,00083) (рисунок 3M). . Эти коллективные данные свидетельствуют о проопухолевом эффекте не только в нашей когорте, но и в более общем случае НМРЛ.

Таким образом, в раковых клетках мы выявили широкий спектр клинически значимых экспрессированных мутаций, которые могут влиять на терапевтический ответ.Кроме того, оценка профилей транскрипции отдельных опухолевых клеток в продольном направлении в разные моменты времени выявила несколько клинически значимых изменений состояния клеток (дополнительный рисунок 3I). Вызванные терапией адаптации раковых клеток, выделенные в нашем исследовании, предлагают новые потенциальные биомаркеры и терапевтические стратегии для пациентов с поздней стадией НМРЛ.

Продольный анализ scRNAseq опухоли отдельного пациента во время лечения

Получение последовательных клинических биопсий опухоли у отдельных пациентов с запущенной стадией рака легкого до и во время лечения является сложной задачей.Тем не менее, мы получили образцы из одного и того же участка первичной опухоли в 3 временных точках лечения от пациента (Th326), опухоль которого содержала стандартную онкогенную мутацию с делецией экзона 19 EGFR и лечилась ингибитором EGFR осимертинибом (дополнительная фигура 4A-C). Во всех трех биопсиях мы идентифицировали по экспрессии scRNAseq РНК драйверную мутацию EGFR экзона 19 в раковых клетках и несколько других представляющих интерес мутаций (дополнительный рисунок 4D).

Рис. S4, относящийся к Рис. 3

(A, B, C) Продольная шкала времени лечения пациента (A) КТ грудной клетки в каждую временную точку клинической оценки (B) Временная точка биопсии с процедурной компьютерной томографией (C) HE из точек наивного лечения и точек прогрессирования демонстрируя аденокарциному и плоскоклеточный рак, соответственно, масштабная линейка показывает 50 мкм (D) тепловая карта состояния мутации в мутированных генах уровня 1 COSMIC, где цвет представляет мутированные чтения / все чтения за время лечения.Мутировавшие гены, идентифицированные клиническим NGS, обозначены прямоугольными диаграммами «X» (E-I) изменения сигнатуры пути (альвеолярный, активация плазминогена, SERPINE1, щелевое соединение и плоскоклеточная гистология, соответственно) в разные моменты времени лечения.

Рис. 4. Изменения в составе микроокружения опухоли внутри каждой опухоли. График

(A) t-SNE для всех иммунных клеток, окрашенных в соответствии с типом иммунных клеток. Количество ячеек для каждого типа ячеек указано в легенде рисунка. (B) Занятость пациента для каждого типа иммунных клеток.(C) Частичные изменения для каждого типа иммунных клеток в трех состояниях лечения. Планки погрешностей указывают 95% доверительный интервал для вычисленных относительных частот. (D) Репрезентативные иммунофлуоресцентные изображения in situ изменений от TN к RD и TN к PD в срезах опухолевой ткани из двух отдельных образцов в два разных момента времени; AZ003 (TN и RD), Th381 (TN и PD). Шкала соответствует 50 мкм. (E и F) Количественная оценка фракционных изменений макрофагов и Т-клеток, соответственно, по временным точкам лечения по изображениям на D и дополнительном рисунке 5F.

Рис. S5, относящийся к Фигуре 4

(A) Парные корреляции Пирсона между составами иммунных клеток каждой группы лечения, что соответствует доле численности каждого типа иммунных клеток в общей популяции иммунных клеток (B) Всего иммунных клеток для каждой биопсии пациента Th366 . (C) Всего иммунных клеток для каждой биопсии пациента Th326. (D) Фракция каждого подтипа иммунных клеток для двух биоптатов пациента Th366. Планки погрешностей указывают 95% доверительный интервал для вычисленных относительных частот.(E) Фракция каждого подтипа иммунных клеток для трех биоптатов пациента Th326. Планки погрешностей указывают 95% доверительный интервал для вычисленных относительных частот. (F) Репрезентативные изображения иммунофлуоресценции in situ от двух пациентов с подобранными образцами в разные моменты времени лечения, демонстрирующие фракционные изменения в иммунных популяциях макрофагов и Т-клеток. Масштабные полосы соответствуют графику Каплана-Мейера 50 мкм (G) деконволюции данных аденокарциномы легкого TCGA, показывающего взаимосвязь между OS и фракцией макрофагов для каждого пациента.Пациенты были стратифицированы по высокой и низкой фракции макрофагов.

При сравнении Th326 с остальной частью набора данных scRNAseq мы обнаружили перекрывающиеся дифференциально экспрессируемые гены и сигнатуры (дополнительная таблица 4, дополнительный рисунок 4E-H). Интересно, что мы также обнаружили многочисленные гены, связанные с дифференцировкой плоских клеток ( KRT16, KRT14, KRT6A, KRT5, CLCA2, PKP1, ANXA8, DSG3 ), сверхэкспрессируемые на PD по сравнению с временными точками TN и RD (p <0,0001, дополнительный рисунок 4I, дополнительный Таблицы 4-5) (Ben-Hamo et al., 2013; Чао и др., 2006; Goodwin et al., 2017). Это особенно интересно, учитывая, что биопсия опухоли легкого пациента на PD продемонстрировала гистологический сдвиг в плоскоклеточный рак по сравнению с предыдущими биопсиями, которые показали гистологию чистой аденокарциномы (дополнительный рисунок 4C). Гистологическая трансформация в плоскоклеточный рак является механизмом устойчивости к ингибитору EGFR при НМРЛ с мутантным EGFR (Izumi et al., 2018; Jukna et al., 2016). Таким образом, scRNAseq может обеспечить высокое разрешение, представление на уровне генов и путей биологической и гистологической пластичности, возникающей во время лекарственного лечения рака.

Продольная инверсия миелоидной и лимфоидной инфильтрации внутри TME при прогрессирующем заболевании по сравнению с остаточным заболеванием

Далее мы рассмотрели эволюцию TME во время целевого лечения. Иммунные клетки (n = 12 077) были отдельно сгруппированы и аннотированы как первичные типы иммунных клеток (рис. 4A, дополнительная таблица 4). В отличие от кластеров раковых клеток, которые сгруппировались в основном из одного образца пациента (дополнительный рисунок 2C), каждый кластер иммунных клеток состоял из клеток, полученных от нескольких разных пациентов и биопсий (рисунок 4B).Это согласуется с ожиданием обнаружения общих фенотипов иммунных клеток у пациентов и образцов. Мы сравнили состав иммунных клеток по всем трем временным точкам, выраженный как корреляция между векторами фракционного обилия иммунных клеток. Иммунный состав внутри RD был наиболее отличен от двух других состояний лечения (r = 0,63 по сравнению с образцами TN, r = 0,7 по сравнению с образцами PD, коэффициент корреляции Пирсона) (дополнительный рисунок 5A). Во всех временных точках лечения Т-клетки и макрофаги были доминирующими клеточными популяциями и демонстрировали инверсию в относительной численности во время ответа опухоли и устойчивости к лечению, открытие, которое мы исследовали дополнительно, как описано ниже (рис. 4С).Т-клетки составляли большую долю всех иммунных клеток в TME при RD по сравнению с образцами TN или PD (25% T-клеток TN, 46% RD, 32% PD). Инфильтрация макрофагов происходила по обратной схеме с уменьшением макрофагов на RD по сравнению с TN и PD (34% макрофагов TN, 15% RD, 37% PD).

Рис. 5. Субпопуляции иммунных клеток демонстрируют уникальные профили транскрипции в каждой временной точке лечения

(A) Фракция клеток, принадлежащих к каждой стадии лечения для каждого кластера макрофагов легкого на дополнительном рисунке 6.Планки погрешностей указывают 95% доверительный интервал для вычисленных относительных частот. (B) Графики на скрипке, показывающие распределение уровней экспрессии заметных отдельных генов (C) Доля клеток, принадлежащих к каждой стадии лечения для каждого кластера T-клеток легкого на дополнительном рисунке 6. Столбики ошибок показывают 95% доверительный интервал для рассчитанного относительные частоты. (D) Графики скрипки, показывающие распределение уровней экспрессии известных отдельных генов. (E) Графическая сводка изменений иммунной микросреды в моменты лечения.

Фиг. S6, относящаяся к Фигуре 5

(A) t-SNE-график всех полученных из легких макрофагальных клеток. Кластер клеток, обогащенных PD (MF1), выделен (B) Тепловая карта, показывающая уровень экспрессии 10 лучших дифференциально экспрессируемых генов для каждого графика кластера макрофагов t-SNE всех полученных из легких Т-клеток. Кластеры клеток, обогащенные PD (TC4 и TC5), выделены (D) Тепловая карта, показывающая уровень экспрессии 10 лучших дифференциально экспрессируемых генов для каждого кластера Т-клеток.

У 2 пациентов мы исследовали иммунные клетки из сопоставленных биопсий опухоли, полученных в разные моменты времени лечения (Th326 и Th366, дополнительные рисунки 5B и C, соответственно).В двух биопсиях опухоли, доступных для пациента Th366, макрофаги и Т-клетки показали идентичные модели, наблюдаемые во всей когорте: уменьшение доли макрофагов и увеличение доли Т-клеток от TN до RD (дополнительная информация Рисунок 5D). Th326 показал аналогичную картину с долей макрофагов, уменьшающейся на RD после начала лечения и снова увеличивающейся при PD (дополнительная фигура 5E). В ортогональном наборе данных мы выполнили иммунофлуоресцентный анализ с использованием маркеров, специфичных для макрофагов и Т-клеток (см. Методы, рисунок 4D, дополнительный рисунок 5F).Эти анализы подтвердили наши результаты scRNAseq и продемонстрировали последовательные изменения популяций макрофагов и Т-клеток во время лечения (рис. 4E-F). Кроме того, мы деконволютировали данные объемного транскриптома TCGA для NSCLC на фракции типов иммунных клеток (см. Методы) и обнаружили, что образцы TCGA с высокими фракциями макрофагов имели значительно худшую ОС (p <0,01) (дополнительный рисунок 5G). Это предполагает дополнительную клиническую значимость наших наблюдений.

Эти результаты особенно интересны, учитывая их сходство с опухолями меланомы, леченными ингибитором PD-1 (Riaz et al., 2017), хотя здесь в отдельном контексте онкобелковой терапии при раке легких. В частности, увеличение количества CD8 + Т-клеток и NK-клеток и уменьшение макрофагов M1 наблюдались при меланоме во время ингибирования PD-1. Могут быть общие ответы в NK / T-клетках и макрофагах во время лечения в зависимости от гистологии опухоли и лечения. Следовательно, могут существовать консервативные подходы к нацеливанию RD на разные подтипы рака и терапевтические методы, что является областью для будущих исследований.

Популяция макрофагов, экспрессирующих

IDO1 , обогащена PD .

Макрофаги из биопсий опухоли легкого (n = 1034) были подмножеством и сгруппированы в 5 отдельных групп (дополнительная фигура 6A). Затем мы оценили дифференциальную экспрессию генов в каждом результирующем кластере (дополнительный рисунок 6B, дополнительная таблица 4). Мы рассчитали долю клеток, происходящих из каждой из трех групп обработки в каждом из 5 кластеров макрофагов (рис. 5А).

Рис. 6. Профили scRNAseq демонстрируют особенности клинического состояния опухолевой клеточной экосистемы.

Особенности прогрессирования рака и выживаемости.Общие признаки, обнаруживаемые во все моменты лечения, показаны в верхнем левом квадранте и включают наличие нескольких онкогенных факторов (1). Общие черты РД и БП показаны в верхнем правом квадранте и включают различные инвазивные пути передачи сигналов (2). Особенности, уникальные для RD, показанные в правом нижнем квадранте, включают альвеолярную сигнатуру (3) и увеличенную фракцию Т-клеток (4). Особенности, уникальные для PD, показанные в нижнем левом квадранте, включают активацию пути активации плазминогена (5), экспрессию белков щелевого соединения (6), потерю генов-супрессоров опухоли (7), экспрессию провоспалительных хемокинов (8). , увеличение популяции Treg (9) и увеличение экспрессии сигнатуры кинуренина (10).

Кластер MF0, одинаково обнаруженный во всех трех временных точках лечения, был обогащен THBS1 и PTX3 (Рисунок 5B, дополнительный рисунок 6B), которые связаны с разрешением воспаления, заживлением ран и с ингибированием IL. -1β (Bouhlel et al., 2007; Faz-López et al., 2016; Martinez, Gordon, 2014; Puig-Kröger et al., 2009; Shiraki et al., 2016; Stein et al., 2016). Кластеры макрофагов MF3 и MF4 были относительно обогащены TN-клетками. Оба кластера характеризовались экспрессией различных генов, связанных с иммуносупрессивным фенотипом ( FOLR2, MARCO, RETN, PPARG, CCL13 ) (фиг.6B, дополнительная фигура 6B, дополнительная таблица 4).Макрофаги на PD чрезмерно представлены в группе MF1 (рисунок 5A) и экспрессируют провоспалительные цитокины CXCL9, CXCL10 и CXCL11 (рисунок 5B, дополнительный рисунок 6B), которые способствуют привлечению лимфоцитов в TME (Nagarsheth et al. , 2017). Лучшие дифференциально экспрессируемые гены в этой популяции также включали белки семейства гуанилатсвязывающих GBP1 и GBP5 , которые индуцируются в макрофагах, активируемых IFN-γ и способствуют передаче воспалительных сигналов внутри врожденной иммунной системы посредством сборки воспаления-сома (Shenoy et al. al., 2012). (Рисунок 5B, дополнительный рисунок 6B).

Несмотря на экспрессию провоспалительных генов в макрофагах MF1, главным дифференциально экспрессируемым геном в этой группе PD-специфичных макрофагов был IDO1 (фиг. 5B). IDO1 индуцируется воспалением внутри TME и способствует формированию толерогенной среды посредством иммуносупрессивных популяций миелоидных клеток, дифференцировки регуляторных Т-клеток (Treg) и иммуносупрессивной цитокиновой среды (Munn and Mellor, 2016).

Иммуносупрессивный Т-клеточный фенотип преобладает в TME на PD

Т-клетки и NK-клетки (n = 1,725) были проанализированы таким же образом, что и макрофаги, и привели к 7 различным популяциям T / NK-клеток (Рисунок 5C) . Они включали одну популяцию (TC2), обогащенную образцами TN, и 3 популяции (TC4, TC5 и TC6), обогащенные PD (рисунок 5C-D, дополнительный рисунок 6D). В опухолях RD была высокая доля Т-клеток (рис. 4C), и не было единственного кластера Т-клеток, который демонстрировал бы избыток Т-клеток в опухолях RD (рис. 5C).

И TN, и PD Т-клетки продемонстрировали относительное снижение инфильтрации Т-клеток (рис. 4C). Кластерные клетки TC2, обогащенные TN, экспрессировали маркеры, соответствующие фенотипу NKT-клеток, включая маркеры T-клеток ( CD3, CD8 ) и маркеры NK-клеток ( KIR2DL3, FCGR3A ), которые были менее представлены в образцах RD и PD. (Рисунок 5D, дополнительный рисунок 6D). В то время как общий инфильтрат Т-клеток оставался ограниченным при БП (рис. 4С), наблюдалось относительное обогащение фенотипов Т-клеток с иммуносупрессивными характеристиками, включая кластеры Т-клеток ТС4, ТС5 и ТС6 (рис. 5С).TC4 был идентифицирован как кластер CD4 + Т-клеток с истощенным фенотипом, характеризующийся экспрессией ингибирующих рецепторов PDCD1 и CTLA4 (Wherry and Kurachi, 2015) (рис. 5D). Т-клетки в этом кластере также экспрессировали CXCL13 , что свидетельствует о том, что эти клетки могут иметь особенности Т-фолликулярных хелперных клеток, экспрессирующих PD-1 (Tfh). Клетки Tfh функционируют во взаимодействии с гуморальной иммунной системой, способствуя активации B-клеток и иммунологической памяти (Crotty, 2014).TC5 состоял из пролиферирующих Treg-клеток (экспрессирующих FOXP3, IL2RA, Ki67, TOP2A ). Наконец, TC6 состоит из NK-клеток ( KIR2DL4, GNLY ), большинство из которых не экспрессируют в высокой степени CD3 или FCGR3A (CD16) (рис. 5D). Это предполагает ограниченную цитотоксическую функцию и согласуется с сообщениями об инфильтрации слабо цитотоксическими NK-клетками в пределах НМРЛ в целом (Carrega et al., 2008), хотя и без предварительной связи с прогрессированием опухолей при таргетной терапии.

Биопсия опухоли, полученная в RD, выявила наличие более провоспалительного, «горячего» TME, который отсутствовал в образцах биопсии TN или PD, что проявлялось в увеличении общей доли Т-клеток и обогащении фенотипов эффекторных Т-клеток ( Рисунок 5E).Большинство RD T-клеток содержалось в TC0 и TC1. Кластер TC0 состоял из цитотоксических CD8 + Т-клеток ( CD8, IFNG, GZMK ), тогда как кластер TC1 состоял из CD4 + Т-клеток, отрицательных по экспрессии коингибиторного рецептора ( CD4, CCR7, IL7R ) (рис. 5D, дополнительный рисунок 6D), в отличие от PDCD1 / CTLA4 , экспрессирующих CD4 + Т-клетки, наблюдаемые в образцах PD.

Таким образом, как TN, так и PD TME характеризовались относительным преобладанием инфильтрации макрофагами над инфильтрацией Т-клеток; однако фенотипические характеристики этих проникающих иммунных клеток различаются между двумя группами.При БП наблюдалась инфильтрация популяцией макрофагов IDO1 +, пролиферирующих регуляторных Т-клеток и истощенных CD4 + Т-клеток, которые минимально присутствовали на более ранних этапах лечения. Напротив, состояние TN характеризовалось преобладанием более классически иммуносупрессивных M2-подобных макрофагов (Sica et al., 2008). В отличие от RD, наблюдалась повышенная инфильтрация популяций эффекторных Т-клеток с признаками активности и сниженная инфильтрация иммуносупрессивных макрофагов (рис. 5E).

Обсуждение

Несмотря на появление, остается неполный каталог данных транскрипции отдельных клеток, чтобы понять состояния клеток и вызванную терапией эволюцию биологической гетерогенности основных заболеваний, таких как рак. Методы прецизионной медицины, такие как таргетная терапия с использованием малых молекул и иммунотерапия, улучшили выживаемость больных раком. Однако опухоли постоянно развиваются, и сопротивление этим методам лечения почти неизбежно. Гетерогенность опухоли влияет на ответ на лечение и устойчивость и относится к раковым клеткам, а также к иммунным и стромальным компонентам TME (Andor et al., 2016; Моррис и др., 2016; Рыбински и Юн, 2016; Swanton, 2012). Клеточная пластичность, как фактор гетерогенности, недостаточно изучена в продольных клинических биопсиях опухолей на поздних стадиях солидных злокачественных новообразований и, вероятно, будет ключевым фактором устойчивости опухоли к системной терапии и развития резистентности к лечению. Данные одноклеточной транскрипции неоценимы в нашей попытке понять состояния клеток и вызванную терапией эволюцию биологической гетерогенности при раке, особенно при метастатическом заболевании.

Наши анализы scRNAseq биопсий НМРЛ на поздних стадиях, полученных продольно от отдельных пациентов и клинической когорты в целом, проливают свет на богатое мутационное и транскрипционное разнообразие в отдельных образцах опухолей и динамические изменения профилей транскрипции раковых клеток и состава TME во время лечение. Эти особенности клинически значимы при НМРЛ, поскольку мы связываем их с отдельными временными точками лечения и клиническими состояниями, а также с различными исходами выживаемости в независимых клинических когортах, таких как наборы данных MSK-IMPACT и TCGA.Наши результаты представляют собой дорожную карту, которая выделяет лежащую в основе клеточную экосистему и механизмы для дальнейшего изучения, чтобы улучшить реакцию на лечение.

Важным первым шагом была разработка и оптимизация клинического процесса для взятия образцов биопсии опухоли на этапе лечения, который редко улавливается при солидных злокачественных новообразованиях, а именно на этапе RD во время начального молекулярного лечения. Наше исследование предлагает редкое представление о клинически значимых биологических процессах, которые характеризуют эту плохо изученную фазу эволюции солидных злокачественных новообразований на поздних стадиях (в данном случае рака легких), и создает ресурсы как для целей открытия, так и для подтверждения доклинических исследований. (Блейкли и др., 2015; Рамирес и др., 2016; Шарма и др., 2010; Spitzer et al., 2017). Мы демонстрируем успешное использование этих образцов опухолей в сочетании с scRNAseq на основе планшетов в образцах метастатического НМРЛ. Это очень важно, поскольку пациенты с метастатическим поражением обычно не получают хирургическую резекцию в рамках лечения. Таким образом, методы профилирования отдельных клеток, которые требуют большего количества ткани, не подходят для исследования образцов ткани от метастатического заболевания (Lambrechts et al., 2018; Schelker et al., 2017).

Наши данные scRNAseq были использованы для запроса на наличие относящихся к раку мутаций в экспрессируемых областях генома. Это выявило широко распространенную внутриопухолевую гетерогенность онкогенных изменений, которые экспрессируются в раковых клетках.

Данные scRNAseq дополняют и расширяют текущие клинические анализы, которые обычно: (1) профилируют ограниченное подмножество генов, (2) дают представление об изменениях ДНК без подтверждения экспрессии генов и (3) выполняются в массовом клеточном масштабе ( Фигура 2).Наши данные свидетельствуют о том, что отдельные популяции раковых клеток могут демонстрировать экспрессию предполагаемого онкогенного драйвера и множественные дополнительные мутации в генах с известной онкогенной важностью (рис. 6, №1). Это актуально, поскольку дает возможное объяснение того, почему полные ответы на лечение редки. Раковые клетки и их скрытые генетические субпопуляции, выявленные с помощью scRNAseq с высоким разрешением, в человеческих опухолях уже обладают соответствующей генетической структурой и эволюционным планом действий для развития устойчивости.Эти «жестко запрограммированные» свойства, которые могут оставаться незамеченными при текущем массовом анализе выборки, дополнительно подкрепляются индуцированной терапией транскрипционной пластичностью, которую мы продемонстрировали с помощью продольного профилирования scRNAseq.

Мы обнаружили сигнатуры транскрипции, характерные для различных временных точек лечения и клинических состояний (рис. 3, рис. 6 № 3, № 5, № 6, № 7). Большинство этих сигнатур (кинурениновый путь, путь активации плазминогена, SERPINE1 и гены щелевых соединений) были биомаркерами значительно худшей общей выживаемости в образцах аденокарциномы легкого TCGA и были наиболее выражены при PD.Напротив, мы обнаружили, что сигнатура альвеолярных клеток была увеличена при RD и была связана с улучшением выживаемости. Наши данные подчеркивают связь сигнатуры альвеолярных клеток с путем WNT / β-catenin как механизм регенерации реакции на повреждение. Хотя путь WNT / β-катенин потенциально терапевтически нацелен (Krishnamurthy and Kurzrock, 2018), критически важно определить, как лучше всего модулировать этот путь, чтобы повлиять на выживаемость остаточных раковых клеток. Общий принцип, который подчеркивают наши данные, заключается в том, что, используя целевые методы лечения, которые используют преимущества определенных состояний клеток, мы можем сконструировать судьбы раковых клеток для улучшения терапевтических ответов при метастатических солидных злокачественных новообразованиях, расширяя эту концепцию на практике при остром промиелоцитарном лейкозе. (Chomienne et al., 1990). При своевременном применении методы лечения, которые нацелены на нарушения определенного состояния клеток или предотвращают дальнейшую адаптацию, могут помочь улучшить выживаемость пациентов, сдерживая дальнейшую эволюцию опухоли в направлении полной лекарственной устойчивости. Возможно, что ингибирование факторов, управляющих переходом примитивного клеточного состояния в RD, могло бы удалить это защитное биологическое состояние и уничтожить раковые клетки RD. Остается неясным, является ли состояние (я) клеток, присутствующее в RD, уникальным для раковых клеток, получающих таргетную терапию, или также относится к химиотерапии и иммунотерапии, области для будущих исследований.Мы выдвинули на первый план текущие усилия, направленные на сигнатуры, которые мы обнаружили в таблице 1, которые можно было бы изучить для улучшения целевого терапевтического ответа.

Помимо внутренних сигнатур раковых клеток, мы также исследовали изменения TME во время лечения. Мы обнаружили относительно низкую инфильтрацию Т-лимфоцитов в TME пациентов с TN и PD (рис. 5C-D), что согласуется с предыдущими сообщениями о низкой цитотоксической инфильтрации Т-лимфоцитов у не получавших лечения мутантных НМРЛ с EGFR (Gainor et al., 2016). ). Наши результаты выявили индукцию более воспалительного фенотипа во время RD на таргетной терапии, отличительной чертой которого является инфильтрация цитотоксических Т-клеток (рис. 6, № 4) и снижение инфильтрации иммуносупрессивных макрофагов (рис. 5E).Это воспалительное состояние может представлять собой дополнение к альвеолярной клетке, состояние восстановления повреждений и регенерации, присутствующее в компартменте раковых клеток (описано выше), с возможностью перекрестного взаимодействия между раковыми клетками и TME. Эти изменения TME были временными, так как при PD наблюдалось обогащение IDO1-экспрессирующими макрофагами, регуляторными Т-клетками и другими популяциями иммуносупрессивных Т-клеток. Все это особенности среды, враждебной установлению эффективного иммунологического ответа (рис. 6, № 9, № 10).Индукция более иммуностимулирующего фенотипа во время таргетной терапии (например, при РЗ) может предложить окно возможностей для внедрения новых комбинированных терапий на основе ТМЕ-мишеней примерно во время РД в контексте более благоприятного TME для увеличения начального ответа и консолидировать лечение в мультимодальном подходе.

Передача сигналов раковых клеток и TME связаны, и могут существовать стратегии лечения, которые нацелены на оба компартмента одновременно. Мы выделили два таких примера: кинурениновый путь и SERPINE1 .В кинурениновом пути мы выявили повышенную активацию пути в раковых и миелоидных клетках при БП (рис. 6, №5). IDO1 , как фермент, ограничивающий скорость в пути кинуренина, может влиять на различные компоненты TME, включая популяции Т-клеток и миелоидных клеток, а также на ангиогенез в пользу иммуносупрессии (Munn and Mellor, 2016). Использование ингибиторов IDO1 в рамках стратегии комбинированной иммунотерапии с ингибиторами контрольных точек PD1 / PDL1 показало многообещающие результаты в исследованиях на ранней стадии (Siefker-Radtke et al., 2018), но в конечном итоге не смогли продемонстрировать улучшенных результатов при меланоме на поздней стадии (Long et al., 2018). Мы продемонстрировали отчетливые развивающиеся состояния TME, предполагая, что может существовать окно возможностей, когда ингибиторы кинуренинового пути могут быть более эффективными (Рисунок 6, Таблица 1). Точно так же SERPINE1 отличается своей активностью как в раковых клетках, как мы определили, так и в иммунной системе (Placencio and DeClerck, 2015). Использование методов лечения, основанных на перекрестных помехах между несколькими клетками, может улучшить результаты лечения пациентов.

Таким образом, представленный здесь набор данных scRNAseq демонстрирует возможность выполнения scRNAseq на биоптатах опухоли, полученных продольно в клинически значимые моменты времени во время активного целевого лечения пациентов с солидными злокачественными новообразованиями на поздней стадии. Понимание каждой из особенностей, которые мы обнаружили и выделили (рис. 6) в отдельных клетках, выявленных с помощью scRNAseq, имеет решающее значение для деконволюции биологической гетерогенности и эволюции опухоли во время системной терапии. Эти данные обеспечивают более детальную биологическую основу для разработки стратегий устранения или нейтрализации RD, чтобы вызвать более длительные ответы у пациентов с поздней стадией НМРЛ и, возможно, другими солидными злокачественными новообразованиями при различных терапевтических модальностях.

Вклад авторов

Концептуализация, T.G.B., C.M.B., R.C.D., J.W. S.D. C.E.M., A.M .; Методология, T.G.B, C.M.B., R.C.D., S.D. C.E.M., A.M., J.K.R .; Программное обеспечение, A.M., L.H. S.D., Wei.W .; Проверка, F.H., D.L.K., C.E.M, A.M., P.G., E.L.S., E.A.Y., J.K.R .; Формальный анализ, A.M., L.H. S.D., A.Z., W.T., M.T., R.S., K.A.Y., C.E.M., W.W, J.K.R, E.A.Y, D.L.K, F.H ,; Ресурсы, C.E.M. C.M.B, J.K.R., A.M., S.D., N.N., T.L., A.U., K.J, P.K.K., E.S., Y.G., D.M.N., N.J.T., A.G., M.Go, H.D., L.T, M.G., T.J. J.R.K., D.J., E.L.S., E.A.Y .; Управление курированием данных, A.M, C.E.M.,; S.D .; Оригинальный вариант письма C.E.M., A.M., J.K.R., S.D .; Письмо - редактирование и редактирование, все авторы; Визуализация, A.M., C.E.M., J.K.R. S.D., C.M.B., T.G.B.; Надзор, S.D., C.M.B., T.G.B.; J.W .; R.C.D., R.G., N.N .; Администрация проекта, S.D., C.M.B., T.G.B. Приобретение финансирования, S.D., C.M.B., T.G.B, C.E.M.

Материалы и методы

Популяция пациентов

Все пациенты дали информированное согласие на сбор клинических коррелятов, сбор тканей, исследовательское тестирование в соответствии с протоколами, утвержденными институциональным наблюдательным советом (IRB) (CC13-6512 и CC17-658, NCT03433469).Фиксированные в формалине парафиновые залитые (FFPE), замороженные и свежие образцы тканей были получены в соответствии со стандартами безопасности интервенционного радиолога, пульмонолога или хирурга. Демографический и клинический анамнез каждого пациента был получен из обзора диаграммы. Количество дней до прогрессирования определяли на основании исследований изображений, которые продемонстрировали окончательный рост известного участка опухоли или новые метастатические отложения вне ЦНС. Остаточное состояние болезни определяли с помощью серийных изображений, демонстрирующих продолжающееся уменьшение или стабильность опухоли без признаков прогрессирования.Исследования пациентов проводились в соответствии с Хельсинкской декларацией, отчетом Бельмонта и Общими правилами США.

Подготовка образцов керна и образцов для резекции

Образец ткани сначала разрезали на мелкие кусочки и помещали в пробирку объемом 1,5 мл (или несколько пробирок, если необходимо). 1,5 мл коллагеназного буфера (10 мл DMEM (GE Life Sciences, Sh40081.01), 0,20 г коллагеназы типа 2 (Worthington Biochemical, LS004176)) добавляли в пробирку и образец расщепляли в течение 30 минут при 37 ° C, встряхивая в термомиксер 800-1000 об / мин.Образец вручную перемешивали пипетированием вверх и вниз 15 раз, затем возвращали в термомиксер на 25 минут. После инкубации образец вынимали из термомиксера, снова перемешивали, пипетируя образец вверх и вниз 15 раз перед пропусканием образца через 100-микронный фильтр (Fisherbrand, 22363548) в новую пробирку Falcon на 15 мл. Фильтр промывали 1-2 мл коллагеназного буфера перед тем, как образец вращали в центрифуге при 500 × g в течение 10 минут. Если полученный осадок клеток был красным, 0.5 мл буфера для лизиса эритроцитов (Thermo Fisher Scientific, A1049201) добавляли в пробирки с образцами и оставляли при комнатной температуре на 3 минуты перед гашением 1,0 мл DMEM (GE Life Sciences, Sh40081.01) + 6% FBS (Omega Scientific, Inc, FB-11) и вращали в центрифуге при 500xg в течение 5 минут. Оставшиеся клетки окрашивали 10 мкл CD45-FITC (Miltenyi Biotec, 130-080-202) и 1 мкл красителя Hoechst (Thermo Fisher Scientific, h4570). Образцы инкубируют на льду в темноте в течение 20 минут. Затем к окрашенным клеткам добавляли один мл буфера FACS и центрифугировали при 500 × g в течение 10 минут перед отсасыванием супернатанта.Клетки ресуспендировали в 0,5 мл буфера FACS. PI (Life Technologies, P3566) был добавлен непосредственно перед сортировкой (protocol.io: dx.doi.org/10.17504/protocols.io.65rhg56).

Подготовка образцов плевроцентеза

образцов Клетки фильтровали через сетчатый фильтр 100 мкм (Fisherbrand 22363548), осаждали (500 × g, 5 мин, 4 ° C) и ресуспендировали в буфере для FACS. Затем клетки окрашивали CD45-FITC (Miltenyi Biotec, 130-080-202) в течение 20 минут при 4 ° C в темноте. Затем клетки осаждали (500 мкг, 5 мин, 4 ° C) и ресуспендировали в буфере для FACS перед переносом в пробирку для FACS (Falcon 14-956-3C).Окрашивание мертвых клеток Sytox Blue (Thermo Fisher Scientific, S34867) добавляли непосредственно перед сортировкой.

Подготовка планшетов для лизиса

Планшеты для лизиса были созданы путем дозирования 0,4 мкл лизирующего буфера (0,5 ед. Ингибитора рекомбинантной РНКазы (Takara Bio, 2313B), 0,0625% TritonTM X-100 (Sigma, -100 мл), 3,125 мМ смеси dNTP (Thermo Fisher, R0193), 3,125 мкМ Oligo-dT30VN (IDT, 5'AAGCAGTGGTATCAACGCAGAGTACT30VN-3 ') и смесь 1: 600 000 РНК ERCC для всплеска (Thermo Fisher, 4456740)) в 384-луночные планшеты для ПЦР390 с твердой оболочкой (Biorad HSP390) с помощью обработчика жидкости Tempest (Formulatrix).Затем все планшеты вращали в течение 1 минуты при 3220 × g и мгновенно замораживали на сухом льду. Планшеты хранили при -80 ° C до использования для сортировки.

Сортировка FACS

Клетки сортировали в 384-луночные планшеты с использованием сортировщика SH800S (Sony). Клетки сортировали, используя настройку «Сверхчистота» на сортировщике. Для типичного сорта пробирка, содержащая 0,3-1 мл предварительно окрашенной клеточной суспензии, осторожно встряхивалась и загружалась в машину FACS. Небольшое количество клеток пропускали при низком давлении, чтобы проверить концентрацию клеток и количество мусора.Затем давление было отрегулировано, поток был приостановлен, первая пластина назначения была распечатана и загружена. Сортировка отдельных клеток была проведена, при этом половина планшета была отсортирована на CD45 + / PI- / Hoechst +, а вторая половина была отсортирована на CD45- / PI- / Hoechst +. Сразу после сортировки планшеты закрывали предварительно маркированным алюминиевым уплотнением, центрифугировали и мгновенно замораживали на сухом льду.

Синтез кДНК

и подготовка библиотеки

Синтез кДНК

выполняли с использованием протокола Smart-seq2 (Picelli et al., 2013, 2014). Вкратце, 384-луночные планшеты, содержащие лизаты одиночных клеток, оттаивали на льду с последующим синтезом первой цепи. 0,6 мкл реакционной смеси (16,7 ед. / Мкл обратной транскриптазы SMARTScribe (Takara Bio, 639538), 1,67 ед. / Мкл ингибитора рекомбинантной РНКазы (Takara Bio, 2313B), 1,67-кратный буфер первой цепи (Takara Bio, 639538), 1,67 мкМ TSO (Exiqon, 5'-AAGCAGTGGTATCAACGCAGACTACATrGrG + G-3 '), было добавлено 8,33 мМ DTT (Bioworld, 40420001-1), 1,67 M бетаина (Sigma, B0300-5VL) и 10 мМ MgCl2 (Sigma, M1028-10X1ML). в каждую лунку с помощью устройства для обработки жидкостей Tempest или Mosquito (TTP Labtech).Обратную транскрипцию проводили путем инкубации лунок на термоциклере ProFlex 2 × 384 (Thermo Fisher) при 42 ° C в течение 90 минут и останавливали нагреванием при 70 ° C в течение 5 минут.

Впоследствии 1,5 мкл смеси для ПЦР (1,67X KAPA HiFi HotStart ReadyMix (Kapa Biosystems, KK2602), 0,17 мкМ IS праймер для ПЦР (IDT, 5'-AAGCAGTGGTATCAACGCAGAGT-3 ') и 0,038da U / мкл L-нуклеаза M0262L)) добавляли в каждую лунку с помощью устройства для обработки жидкости Mantis (Formulatrix) или Mosquito, а синтез второй цепи выполняли на термоциклере ProFlex 2 × 384 с использованием следующей программы: 1.37 ° C в течение 30 минут, 2. 95 ° C в течение 3 минут, 3. 23 цикла 98 ° C в течение 20 секунд, 67 ° C в течение 15 секунд, 72 ° C в течение 4 минут и 4. 72 ° C в течение 5 минут.

Амплифицированный продукт разбавляли соотношением 1 часть кДНК к 10 частям 10 мМ трис-HCl (Thermo Fisher, 15568025). 0,6 мкл разбавленного продукта переносили в новый 384-луночный планшет с помощью канальной пипетки Viaflow 384 (Integra). Библиотеки секвенирования Illumina были подготовлены, как описано в (Darmanis et al., 2015). Вкратце, мечение проводили на двухцепочечной кДНК с использованием набора для подготовки образцов библиотеки Nextera XT (Illumina, FC-131-1096).Каждую лунку смешивали с 0,8 мкл буфера для ДНК-метки Nextera (Illumina) и 0,4 мкл фермента Tn5 (Illumina), затем инкубировали при 55 ° C в течение 10 мин. Реакцию останавливали добавлением 0,4 мкл «буфера для нейтрализации меток» (Illumina) и вращением при комнатной температуре в центрифуге при 3220g в течение 5 минут. Реакции индексирующей ПЦР проводили путем добавления 0,4 мкл 5 мкМ индексирующего праймера i5, 0,4 мкл 5 мкМ индексирующего праймера i7 и 1,2 мкл смеси Nextera NPM (Illumina). Все реагенты разливались с помощью манипуляторов для жидкости Mantis или Mosquito.ПЦР-амплификацию проводили на термоциклере ProFlex 2 × 384 по следующей программе: 1. 72 ° C в течение 3 минут, 2. 95 ° C в течение 30 секунд, 3. 12 циклов 95 ° C в течение 10 секунд, 55 ° C. C в течение 30 секунд, 72 ° C в течение 1 минуты и 4. 72 ° C в течение 5 минут.

Объединение библиотек, контроль качества и секвенирование

После подготовки библиотеки лунки каждого планшета с библиотекой были объединены с использованием манипулятора для жидкости Mosquito. За объединением следовали две очистки с использованием гранул 0,7x AMPure (Fisher, A63881).Качество библиотеки оценивали с помощью капиллярного электрофореза на анализаторе фрагментов (Agilent) или Tapestation (Agilent), а библиотеки количественно оценивали с помощью qPCR (Kapa Biosystems, KK4923) на системе обнаружения ПЦР в реальном времени CFX96 Touch (Biorad). Пулы планшетов были нормализованы до 2 нМ и равные объемы из планшетов с библиотекой были смешаны вместе для получения пула образцов для секвенирования.

Библиотеки секвенирования из 384-луночных планшетов.

Библиотеки секвенировали в системе секвенирования NextSeq или NovaSeq 6000 (Illumina) с использованием считываний парных концов 2 х 100 п.о. и считываний индекса 2 х 8 п.н. или 2 х 12 п.о.В прогонах NextSeq использовались комплекты с высокой производительностью, тогда как в прогонах NovaSeq использовались комплекты на 200 или 300 циклов (Illumina, 20012860). Библиотека управления PhiX была увеличена на 1%.

Выравнивание и подсчет генов

Последовательности из секвенирования Illumina были демультиплексированы с использованием bcl2fastq версии 2.19.0.316. Считывания были выровнены с использованием генома hg38 с использованием STAR версии 2.5.2b с параметрами TK. Подсчет генов производился с использованием HTSEQ версии 0.6.1p1 с параметрами по умолчанию, за исключением того, что для stranded было установлено значение false, а для режима было установлено значение пересечение-непустое.

Общая кластеризация

Стандартные процедуры фильтрации, выбора переменных генов, уменьшения размерности и кластеризации были выполнены с использованием пакета Seurat (Satija et al., 2019) (версия 2.3.4) в R (R Core Team (2013). R: язык и среда для статистических вычислений. Фонд R Foundation for Statistical Computing, Вена, Австрия. Http://www.R-project.org/), где были исключены клетки с менее чем 500 генами и 50 000 считываний. Образцы, содержащие менее 10 ячеек, были отфильтрованы из анализа.Подсчеты были нормализованы по логарифмической шкале, а затем масштабированы линейной регрессией по количеству считываний. Вариабельные гены (Ngenes = 6 112) были отобраны с использованием порога дисперсии с z-баллами, нормализованными по уровню экспрессии. Вариабельные гены были спроецированы на подпространство низкой размерности с использованием анализа главных компонентов. Количество основных компонентов (Npcs) было выбрано на основе анализа объясненного графика дисперсии (Npcs = 20). Граф общих ближайших соседей был построен на основе метрики Евклидова расстояния в подпространстве малой размерности.Клетки визуализировали с помощью двумерного tSNE на той же метрике расстояния (Res = 0,5, Kparam = 30, сценарий 03). Типы клеток были присвоены каждому кластеру клеток с использованием множества известных маркерных генов (дополнительная таблица 2, сценарий S01-03 и сценарий NI01).

Кластеризация подмножества эпителия, идентификация опухолевых клеток и аннотация неопухолевых эпителиальных клеток

Клетки, ранее аннотированные как эпителиальные (n = 5 109), были подгруппированы и повторно кластеризованы с использованием методов, описанных выше, и следующих параметров: Ngenes = (6 919 ), Npcs = 20, Res = 0.9, Kparam = 10 (скрипт NI02). Злокачественные эпителиальные клетки идентифицировали с помощью inferCNV (Tickle T, Tirosh I, Georgescu C, Brown M, Haas B (2019). InferCNV проекта Trinity CTAT Project. Обсерватория клеток Клармана, Институт Броада Массачусетского технологического института и Гарвард, Кембридж, Массачусетс, США. https://github.com/broadinstitute/inferCNV.). inferCNV, который работает, находя клетки с большими вариациями числа копий, что определяется путем сортировки экспрессируемых генов по их хромосомному положению и применения скользящего среднего, скользящего окна из 100 генов в каждой хромосоме, к относительным значениям экспрессии (Patel et al., 2014; Puram et al., 2017; Тирош и др., 2016). Все эпителиальные клетки, а также 300 фибробластов и 300 эндотелиальных клеток были использованы в качестве входных данных (сценарий NI03). Дополнительные 500 фибробластов и 500 эндотелиальных клеток использовали в качестве контрольных образцов. Мы оценили каждую клетку по степени сигнала CNV и нанесли клетки на дендрограмму, которую затем разрезали в наивысшей точке, в которой все клетки эндотелия и фибробластов с добавками принадлежали одному кластеру (k = 3). Все клетки, которые сгруппировались вместе с добавками в контроле, были помечены как «неопухолевые», тогда как оставшиеся два кластера были помечены как «опухоли».

Незлокачественные эпителиальные клетки (n = 1489), определяемые как клетки, лишенные больших хромосомных аберраций по данным анализа InferCNV, были подгруппированы и повторно кластеризованы с использованием следующих параметров: Ngenes = (7213), Npcs = 20, Res = 0,3, Kparam = 30 (скрипт NI05). Типы клеток были присвоены каждому кластеру клеток с использованием изобилия известных маркерных генов (дополнительная таблица 2) и дифференциально экспрессируемых генов, найденных с помощью функции Сера FindAllMarkers с использованием теста суммы рангов Вилкоксона по умолчанию (использованные аргументы: только.pos = TRUE, min.pct = 0,25, thresh.use = 0,25).

Кластеризация подмножеств опухолевых клеток и дифференциальная экспрессия генов

Злокачественные эпителиальные клетки (n = 3620), как определено, поскольку клетки, несущие большие хромосомные аберрации по анализу InferCNV, были подгруппированы и повторно кластеризованы с использованием следующих параметров: Ngenes = 6797, Npcs = 15, Res = 0.9, Kparam = 30 (скрипт NI04). Мы обнаружили различия в экспрессии генов между тремя группами ответа на лечение (TN, RD и PD), используя функцию Сера FindMarkers , используя стандартный тест суммы рангов Вилкоксона.Были использованы три отдельных теста, чтобы установить различия между: 1) TN и RD, 2) TN и PD и 3) RD и PD (дополнительные таблицы 5). Затем полученные списки дифференциальных генов были отфильтрованы, чтобы ограничить специфические эффекты для пациента. Это достигается путем установки порога для ненулевой экспрессии клеток на пациента (RD = 3, 37% пациентов с RD и PD = 6, 33% пациентов с PD) и удаления дифференциально экспрессируемых генов, объясняемых меньшими пороговыми значениями, чем установленный порог. 100 лучших генов из каждого сравнения были вручную отобраны для оценки активации пути.Снижение экспрессии может указывать на отсутствие обнаружения из-за стохастичности scRNAseq, и поэтому для анализа активированных путей мы сосредоточились на активированных генах. Сигнатуры генов (дополнительная таблица 2) были составлены с использованием дифференциально экспрессируемых, а также известных генов-маркеров клеток. В частности, альвеолярная сигнатура (дополнительный рисунок 3B) состоит из дифференциально экспрессируемых генов AT1 / AT2 среди сравнений временных точек раковых клеток, а также имеет дополнительные известные гены AT1 / AT2 (Vieira Braga et al., 2019; Wade et al., 2006). Остальные сигнатуры были идентифицированы непосредственно из основных дифференциально экспрессируемых генов.

Чтобы убедиться, что мы не ошибочно классифицируем здоровые клетки AT2 как раковые, мы сравнили уровни экспрессии нашей комбинированной сигнатуры альвеолярного гена между тремя временными точками (TN, RD, PD) и нераковыми клетками AT2 из нашего набора данных, а также дополнительные нераковые клетки AT2 из внешнего набора данных (Vieira Braga et al., 2019). Нераковые клетки AT2 из нашего набора данных были более похожи на внешние клетки AT2, чем любые из наших раковых клеток во все моменты времени (ρ = 0.73, -0,14, 0,23, -0,19, для нераковых клеток AT2 и раковых клеток TN, RD, PD соответственно) (дополнительный рисунок 3C).

Продольный анализ одного пациента был выполнен путем разделения всех клеток, происходящих от пациента Th326. Как указано выше, различия в экспрессии генов между тремя группами ответа на лечение (TN, RD и PD) были обнаружены путем применения функции Сёра FindMarkers с использованием стандартного критерия суммы рангов Вилкоксона. Для выявления различий между: 1) TN и RD, 2) TN и PD и 3) RD и PD (сценарий NI07-08, дополнительная таблица 5)

Анализ выживаемости с использованием сигнатур генов раковых клеток в пределах TCGA.

Данные TCGA LUAD были загружены из xenabrowser.net / datapages /. Метаданные были загружены из интегрированного ресурса TCGA по пан-онкологическим клиническим данным (Liu et al., 2018a). Среднее значение экспрессии каждой сигнатуры экспрессии раковых клеток (альвеолярный, кинуренин, активирующий плазминоген, SER-PINE1 и щелевое соединение) рассчитывали на образец TCGA. Затем образцы TCGA были разделены на квартильные группы. Только квартиль 4 (высокая экспрессия) и квартиль 1 (низкая экспрессия) были нанесены на график с использованием выживаемости пакетов библиотек (Therneau T. (2015). Пакет для анализа выживаемости в S.версия 2.38, https://CRAN.R-project.org/package=survival.) и выживший (Алдукадель Кассамбара, Марчин Косински и Пшемилслав Бецек (2019). Survminer: построение кривых выживания с использованием 'ggplot2'. Версия пакета R 0.4.5. Http://CRAN.R-project.org/package=surviminer) в R (скрипт NI10).

Иммуногистохимия

Все образцы были получены от лиц с НМРЛ, как указано выше. Срезы тканей человека толщиной 4 микрона, фиксированные формалином и залитые парафином (FFPE), обрабатывали с использованием ранее опубликованного метода (Haderk et al., 2019) и рекомендации производителя по поиску антигена. Окрашивание проводили в течение ночи кроличьими моноклональными антителами AQP4 (№ 59678, Cell Signaling Technology, разведение 1: 100). Окрашенные слайды оцифровывали с помощью сканера слайдов Aperio ScanScope XT (Leica Biosystems) с объективом 20X или 40X. Популяции опухолей аннотировали, затем оценивали в слепом рандомизированном анализе патологом на процент положительности опухоли и интенсивность субклеточного окрашивания в мембранном, цитозольном и ядерном компартментах.Интенсивность окрашивания оценивали как отрицательную, слабую, среднюю или сильную и получали баллы 0, 1, 2 или 3 соответственно. Процентный коэффициент положительности опухоли был оценен как 0, отрицательный; 1, менее 10% иммунопозитивных; 2, между 10-50% иммунопозитивными; 3, между 51-80% иммунопозитивными; 4, более 80% иммунопозитивных. Расчет показателей иммунореактивности выполняли путем умножения оценки интенсивности окрашивания (0–3) на процент положительного коэффициента опухоли (0–4), чтобы получить значение от 0 до 12 (Fedchenko and Reifenrath, 2014).

Обнаружение мутаций из scRNAseq

Пучки выравнивания для всех неиммунных клеток (стромы и эпителия) были переданы в GATK HaplotypeCaller, который запускался из последнего доступного контейнера Docker (broadinstitute / gatk: 4.0.11.0) с использованием следующих параметров:

  • – отключение-чтение-фильтр MappingQualityReadFilter

  • – отключение-чтение-фильтр GoodCigarReadFilter

  • – отключение-чтение-фильтр 45000 NotSecondaryAlignment

    –диспользование-чтение-фильтр45000 NotSecondaryAlignment 9649

  • –disable-read-filter MappingQualityAvailableReadFilter

  • –disable-read-filter NonZeroReferenceLengthAlignmentReadFilter

  • Duplicter

    -display_filter

  • -display_filter

  • -disfile filter PassesVendorQualityCheckReadFilter

  • –disable-read-filter WellformedReadFilter

Отключение этих конкретных фильтров чтения оказалось необходимым для scRNAseq, поскольку присущее низкое покрытие заставляет подавляющее большинство считываний помечать для удаления в противном случае.Полный набор человеческих вариантов (dbSNP) был загружен из NCBI (https://www.ncbi.nlm.nih.gov/variation/docs/human_variation_vcf/), и каждый вызов варианта оценивался на предмет его присутствия / отсутствия в человеческом варианте. база данных. dbSNP - это общедоступный, живой каталог 674 миллионов человеческих соматических SNP и инделей, о которых сообщалось в рецензируемых публикациях.

Распараллеливание заданий HaplotypeCaller на основе облака было достигнуто с помощью Reflow, механизма рабочих процессов для распределенной инкрементной обработки данных в облаке (https: // github.com / grailbio / reflow). HaplotypeCaller выводит отдельный вариант файла формата вызова (VCF) для каждой ячейки, которые были обработаны с помощью пакета cerebra python (https://github.com/czbiohub/cerebra). Варианты, обнаруженные в dbSNP, были удалены и не подлежат дальнейшему анализу. Мы пришли к выводу, что, удалив «общие» варианты на уровне популяции, мы сможем лучше уточнить вариации, связанные с конкретным заболеванием.

Помимо считываний scRNAseq, мы получили массовые чтения ДНК из периферической крови для большинства наших пациентов (за исключением трех).Эти считывания РВМС были запущены через HaplotypeCaller, чтобы установить профили мутаций «зародышевой линии» для каждого из наших пациентов. Затем мутации зародышевой линии вычитали из каждого одноклеточного VCF этого пациента. Этот этап фильтрации был пропущен для трех пациентов, у которых мы не получали периферическую кровь, однако эти одноклеточные VCF все еще проходили через наш фильтр dbSNP.

Мы также применили фильтр фатмм ко всем ячейкам (Shihab et al., 2015). fathmm использует подход машинного обучения для прогнозирования вероятности того, что данный SNP является патогенным, интегрируя аннотации ENCODE для таких вещей, как сайты связывания факторов транскрипции, модификации гистонов, межвидовое выравнивание последовательностей и оценки сохранения и т. Д.В наш анализ были включены только варианты, считающиеся патогенными с помощью вычислений, то есть варианты с оценкой fathmm > 0,7.

Затем оставшиеся варианты были отфильтрованы через базу данных полных мутаций - геномных скринингов COSMIC (Каталог соматических мутаций при раке) (https://cancer.sanger.ac.uk/cosmic/download). Были сохранены только SNP / индели, связанные с «Lung» в соответствии с их аннотацией COSMIC. Варианты вызовов были сопоставлены с соответствующими генами, и были установлены мутационные профили для каждого пациента / образца.Мы использовали ERCC, добавленные в каждый образец клеток, в качестве отрицательного контроля для ложноположительных мутаций, которые могут возникнуть из-за технических артефактов, таких как ошибки ПЦР. Мы обнаружили, что средняя частота ложноположительных мутаций составляет 0,000256% на основание (Enge et al., 2017).

Обнаружение слияния из scRNAseq

Транскрипты слияния были обнаружены с помощью STAR-fusion (https://github.com/STAR-Fusion/STAR-Fusion/wiki) версии 1.6.0, запускаемого из контейнера Docker (trinityctat / ctatfusion: 1.5.0). Были использованы следующие параметры:

Распределенная обработка заданий STAR-fusion была выполнена с помощью Reflow.Выходные файлы обрабатывались с помощью cerebra, затем объединялись с вызовами вариантов для создания сводных таблиц по ячейкам и по образцам.

Мутационный анализ опухолевых клеток

Информация, извлеченная из головного мозга, обобщалась по образцам. Информация о покрытии была предоставлена ​​вторичным выходом головного мозга, обобщенным по образцам и генам. Все клетки суммируются по образцам, а все отфильтрованные ROI fathmm суммируются по соответствующему гену (сценарий NI06). Графики были созданы с использованием пакета R pheatmap (Райво Колде (2019).pheatmap. Красивые тепловые карты. Пакет R версии 1.0.12. https://CRAN.R-project.org/package=pheatmap).

Анализ выживаемости с использованием количества мутаций в данных MSK-Impact Данные MSK-Impact были загружены с cBioPortal (Cerami et al., 2012; Gao et al., 2013) и подмножеством только образцов NSCLC Данные MSK-Impact были подмножеством только те мутации, которые также были обнаружены в наборе данных мутаций scRNAseq (n = 141 уникальная мутация). Мы стратифицировали образцы MSK-Impact по образцам с большим или равным 2 мутациям из мутаций COSMIC первого уровня, обнаруженных в наборе данных scRNAseq (мутации с высоким уровнем), и с менее чем двумя мутациями (с низким уровнем мутаций) (рис. 2D).Графики Каплана-Мейера были визуализированы с помощью пакета lifeelines на языке Python (Кэмерон Дэвидсон-Пилон, Йонас Калдерстам, Пол Зивич, Бен Кун, Эндрю Фьоре-Гартланд, Луис Монеда,… Андре Ф. Рендейро. (2019, 4 сентября). CamDavidsonPilon / lifelines: v0.22.4 (версия v0.22.4). Zenodo. http://doi.org/10.5281/zenodo.3386382; Python Software Foundation. Справочник по языку Python, версия 3.4. Доступно по адресу) (скрипт NI12).

Кластеризация иммунных подмножеств и дифференциальная экспрессия генов

Все клетки, аннотированные как иммунные (n = 12 077), были подмножеством и кластеризованы, как описано выше (сценарий IM01), с использованием следующих параметров (Ngenes = 1,690, Npc = 20, Res = 0.3, k.param = 10). Полученные 17 кластеров были отнесены к разным основным типам иммунных клеток с использованием списка курируемых маркеров генов (дополнительная таблица 2) и путем ручного курирования дифференциально экспрессируемых генов для каждого кластера (дополнительная таблица 5). Различные типы ячеек и количество ячеек, принадлежащих к каждому типу, описаны в основном тексте.

Для оценки изменений фракционной численности различных популяций иммунных клеток мы использовали все клетки, за исключением торакоцентеза и образцов головного мозга из-за различий в иммунном составе этих опухолевых сред, которые исказили данные.Функция freqCI из пакета R REdaS (Maier MJ (2015). Дополнительный пакет к книге R: Einfuhrung durch angewandte Statistik. Пакет R версии 0.9.3. Htt: //CRAN.R-project.org/package=RedaS) (скрипт IM02) использовался для расчета доверительных интервалов для относительных частот.

Макрофаги (n = 1034) и Т-клетки (n = 1725) из биопсий легких были подгруппированы и сгруппированы, как описано выше (сценарий IM03 и IM04 соответственно), с использованием следующих параметров для MF (Ngenes = 1,637, Npc = 10, res = 0.3, k.param = 10) и Т-клетки (Ngenes = 1,475, Npc = 10, res = 0,3, k.param = 10). Полученные кластеры обсуждаются в основном тексте, и приводятся списки дифференциально экспрессируемых генов (дополнительная таблица 5). Мы повторили этот анализ, где мы подгруппировали данные только для пациентов с множественными биопсиями и достаточным количеством клеток (Th326 и Th366) (сценарий IM05).

Мультиплексная иммунофлуоресценция

Мультиплексное иммунофлуоресцентное окрашивание проводили на последовательных 4-микронных предметных стеклах FFPE с использованием мультиплексного анализа Opal IHC (Perkin Elmer).Слайды окрашивали одной из двух панелей с 6 антителами. Панель 1 содержала первичные антитела против PD-L1 (клон E1L3N, разведение 1:50, Cell Signaling Technologies), CD68 (клон KP1, разведение 1: 500, Dako), IDO (клон D5J4E, разведение 1: 100, Cell Signaling Technologies). , HLA-DR (клон CR3 / 43, разведение 1: 250, Abcam), CD14 (клон SP192, разведение 1: 100, Abcam) и цитокератин (поликлональный Z0622, разведение 1: 250, Dako). Панель 2 состояла из первичных антител против CD3 (клон LN10, Leica), PD-1 (клон NAT105, разведение 1: 100, Abcam), CD14, CD8 (клон C8 / 144B, разведение 1: 100, Dako), FoxP3 (клон 236A / E7, разведение 1: 200, Abcam) и цитокератин.Сканы целых слайдов были получены при 10-кратном увеличении с помощью системы визуализации Vectra (Perkin Elmer, версия 3.0). От трех до шести областей с каждого слайда, содержащих опухоль и строму, были выбраны с использованием Phenochart (v1.0.8, Perkin Elmer) для мультиспектрального сбора данных с высоким разрешением на системе Vectra при 20-кратном увеличении. Спектральные библиотеки были получены из одноцветных пятен на ткани миндалин человека. Спектральное разделение, сегментация клеток и определение клеточного фенотипа, такого как опухоль, макрофаг, Т-клетка или другая клеточная популяция, выполнялись с использованием программного обеспечения для анализа изображений InForm (Perkin Elmer, версия 2.4). Фракции популяций макрофагов и Т-клеток рассчитывались как: (представляющая интерес популяция) / (популяции макрофагов + Т-клетки) и наносились на график с использованием 'ggplot2' в R (H. Wickham. Ggplot2: Elegant Graphics for Data Analysis. Springer-Verlag) Нью-Йорк, 2016) (сценарий NI15).

Анализ выживаемости с использованием фракционной иммунной популяции в пределах TCGA

Как и в случае анализа выживаемости с использованием сигнатур генов раковых клеток, мы использовали загруженный набор данных TCGA LUAD и метаданные для доступа к результатам выживаемости пациентов, поскольку они относятся к фракционным изменениям иммунных популяций. внутри данной опухоли.Мы использовали CIBER-SORT (Newman et al., 2015) для деконволюции нерасфасованных образцов TCGA на относительные фракции популяций иммунных клеток, как определено с использованием эталона LM22. Общую популяцию макрофагов определяли путем объединения фракций для моноцитов, макрофагов.M0, макрофагов.M1 и макрофагов.M2. Общая популяция Т-клеток была обнаружена путем объединения фракций T.cells.CD8, T.cells.CD4.naive, T.cells.CD4.memory.resting, T.cells.CD4.memory.activated, T.cells. follicular.helper, T.cells. регулирующий..Tregs, T.cells.gamma.delta, NK.cells.resting и NK.cells. Активированы. Затем образцы TCGA были разделены на квартильные группы. Только квартиль 4 (высокая доля населения) и квартиль 1 (низкая доля населения) были построены с использованием выживаемости пакетов библиотек (Therneau T (2015). Пакет для анализа выживаемости в S. версия 2.38, https: //CRAN.R-project. org / package = survival) и Survminer (Алдукадель Кассамбара, Марцин Косински и Пше-mylslaw Biecek (2019). Survminer: построение кривых выживания с использованием ggplot2.Пакет R версии 0.4.5. http://CRAN.R-project.org/package=surviminer) в R (скрипт NI10).

Получение in vitro устойчивых к лекарственным средствам клеток-персистеров и клеток с приобретенной устойчивостью и ОТ-ПЦР

Для проверки экспрессии гена-кандидата с помощью ПЦР-матрицы RT2 Profiler (Qiagen, CLAh44795) клетки рака легких человека PC9 (EGFR del19) обрабатывали в течение 48 часов. (день 2) с ДМСО (TN) или в течение 7 и 19 дней с 2 ​​мкМ осимертиниба (Selleck Chemicals LLC, S7297) с добавлением препарата каждые 3-4 дня (RD), соответственно.Образцы PD были получены из приобретенной устойчивой клеточной линии РС9 (Осимертниб IC50 = 89 мкМ), которая была получена путем непрерывной обработки 2 мкМ Осимертиниба с добавлением лекарственного средства каждые 3-4 дня и продемонстрировала активную пролиферацию под действием лекарственного средства, когда была вызвана резистентность. РНК экстрагировали с помощью набора RNeasy Mini Kit (Qiagen, 74104). Качество РНК было подтверждено как RIN 3 7.5 с помощью набора Bioanalyzer RNA 6000 Pico (Agilent, 5067-1514), а РНК количественно определяли с помощью набора Qubit RNA HS Assay (Thermo Fisher Scientific, Q32852).В общей сложности 400 нг РНК подвергали обратной транскрипции с использованием набора для синтеза первой цепи (Qiagen, 330401), а затем загружали в специальный 384-луночный набор профилировщиков RT2 (Qiagen, CLAh44795). Кратковременное изменение рассчитывали путем определения отношения уровней мРНК к контрольным (день 2) значениям с использованием метода дельта-порогового цикла (Ct) (DCt). Для определения значимости изменений между исходным уровнем (день 2) и временными точками лечения (дни 7, 19 и 70) на основе нормализованных значений Cts к исходному уровню (сценарий NI14) использовали t-критерий.

30 наших любимых переизданий 2019 года

Утерянные альбомы, Святой Грааль и определяющие жанры компиляции со всего мира.

Вслед за нашим переизданием синглов мы обращаем внимание на пластинки, компиляции и архивные релизы.

В то время как мир переизданий продолжал расширяться как по жанрам, так и по географическому охвату, одна из тем этого года была более внутренней. Введенные в безмолвные царства экологической музыки - будь то для домов, растений или стихов - некоторые из самых убедительных переизданий предлагали передышку и пространство для размышлений.

Ближе к концу десятилетия акцент также начал смещаться с 80-х на 90-е, поскольку 30-летний цикл поп-музыки распространялся и на переиздания.Здесь представлена ​​музыка из Бразилии, Японии, Кабо-Верде и стран Карибского бассейна, которая добавила танцевальному полу мощные драм-машины и оптимистичный синтетический блеск.

При составлении списка переизданий 2018 года мы были вынуждены спросить, почему так мало женщин было представлено в переизданиях, как за кулисами на лейблах, так и на публике, рассказывающих свои истории. Тема, рассмотренная в статье ранее в этом году, мы особенно отдавали себе отчет в том, что наш список отражает большее разнообразие, зная, что переиздания могут бросать вызов, а не просто отражать устоявшиеся повествования.

Как всегда, мы выбрали только один альбом для каждого лейбла, а также признали еще один год «потерянных» альбомов для таких, как Джон Колтрейн, Эбо Тейлор и Марвин Гэй, для которых достаточно почетных упоминаний.

Мы надеемся, что вам понравится открывать для себя эти записи или возвращаться к ним так же, как и нам.

Следите за остальными обзорами VF за 2019 год здесь:

12 наших любимых переизданий синглов 2019 года
Лучшие проигрыватели 2019 года
Лучшие колонки 2019 года
Лучшие усилители 2019 года
Лучшие наушники 2019 года


30.Разные художники

Street Soul Brasil: 1987–1995

(Привет, матрос)

Купить

Помимо напряженного года работы над замечательным издательством Selva Discos, Аугусто Оливани из Сан-Паулу также собрал - Street Soul Brasil: 1987–1995 - личную коллекцию для нью-йоркского лейбла Hello Sailor, возглавляемого бразильянкой Ренатой До Валле. Отказавшись от более известных жанров, включая MPB, Tropicalia и джаз 60-х, 70-х и 80-х годов, Оливани возвращает нас к ночному радио его юности.В этих эфирах беззаботная поп-музыка царила безраздельно, и новое поколение бразильских артистов создало свою собственную интерпретацию американского RnB. Эти десять редких треков, взятых из забытой эпохи музыкальной истории страны, создают сладчайший саундтрек к подростковым дням, когда они танцевали, мечтали и зависали возле местного винного магазина. - Патрик Райдер


29. Рупа

Дискотека Джаз

(Numero Group)

Купить

«Едва дискотека и вряд ли джаз», LP Disco Jazz Рупы Бисваса 1982 года стала святым Граалем YouTube-via-Discogs, соблазнившим как коллекционеров, так и лейблы переиздания.Из-за неудачных бутлегов, которые ходили по кругу, Numero предпринял ремастеринг оригинальных лент и запечатлел величие ведущего трека "Aaj Shanibar" во всей его красе. Записанный в Calgary’s Living Room Studios индийскими и канадскими музыкантами, LP слышит, как сарод (струнный инструмент, используемый в музыке хиндустани) выделяет замысловатые мелодии вокруг ритма дискотеки, напоминающие великолепные саундтреки болливудского буги-вуги 80-х, созданные под руководством синтезатора. Видеть, как восхищенный, ничего не подозревающий Рупа воссоединился с альбомом спустя почти сорок лет, - это такая же трогательная история переиздания, как и они сами.«Приятно иметь столько любви… После всех этих лет людям нравится моя музыка», - сказала она изданию The Guardian . «Мальчики, девочки, все так много танцуют. Вот что делает меня счастливым ». - Антон Спайс


28. Сюзанна Чиани

Цветы зла

(Хранители искателей)

Купить

Слушая тревожное, похожее на церковный колокол вступление к Flowers of Evil , можно простить, что вы сразу не подумали, что это Сюзанна Чиани, но когда арпеджио срабатывает и уносится вдаль, ее безошибочная настройка Buchla модульный синтезатор становится очевидным.Эта пластинка, составленная из ее легендарных архивов, восходит к 1969 году, взяв стихотворение Бодлера Élévation в качестве стартовой площадки для своего синтезаторного эквивалента. Ценное приобретение для всех, кто интересуется генезисом синтезатора и возможностями модульной системы Buchla, когда он находится под командованием одного из самых важных электронных композиторов двадцатого века. - Джеймс Хэммонд

Смотрите наш фильм 2019 года с Сюзанной Чиани здесь.


27.Разные художники

Djax-Re-Up, том 1 и 2 (Djax-Up-Beats)

(Декмантел)

Купить

Годы становления техно в 80-90-е годы были довольно интернациональным бродео, как с точки зрения ди-джеев и продюсеров, в которых преобладали мужчины, так и с точки зрения закулисных выступлений. Однако в Эйндховене мисс Джакс доказывала обратное, общаясь с артистами через Атлантику в Чикаго и Детройте, создавая приют для электроники со всего мира.Декмантел пересмотрел релизы издательства в двухтомной серии под названием Djax-Re-Up , охватывающей хаус, эйсид и техно. Это больше, чем просто набор клубных обогревателей, этот сборник является свидетельством того, что любой человек, независимо от того, кто вы и откуда приехали, может сформировать лицо танцевальной музыки. - Габриэла Хелфет


26. Дождевики

Плащи

(WeThRee)

Купить

В своей новой книге Revenge Of The She-Punks , опубликованной ранее в этом году, Вивьен Голдман превозносит влияние первой из феминистских постпанк-групп.Их дух дал возможность поколению женщин-музыкантов разрушить патриархальную музыкальную индустрию или прорваться сквозь нее. В их основе лежали «Дождевики», одноименный дебют которых в 1979 году на Rough Trade был столь же влиятельным, как и они сами. Издание, посвященное 40-летию, также было представлено ограниченным тиражом принтов от основателей Джины Берч и Аны Да Силва. - AS


25. Grupo Pilon

Leite Quente Funaná de Cabo Verde

(Остинато)

Купить

«Фунана работала как музыка протеста, это была музыка против угнетения», - описывают музыканты Педриньо и Тело Перес в нашем коротком документальном фильме о Кабо-Верде.Это была музыка, озвучивающая независимость Кабо-Верде от португальцев, и это связующее звено, которое связывает 70-е годы со вторым поколением музыкантов, которые в последующие десятилетия уехали из Кабо-Верде в Европу. Среди них была Grupo Pilon из Люксенбурга, которая привнесла funaná, estilo Krioulu и ColaZouk в европейские традиции синтезатора и диско. Музыканты были вдохновлены не борьбой за независимость, а падением Берлинской стены и освобождением Нельсона Манделы, и здесь они отмечаются подборкой из шести треков, взятых из трех альбомов группы.Остинато, как и прежде, красиво обработал его, поэтому стоит также взглянуть на сборник Pour Me A Grog лейбла, в котором также прослеживается история электрофунана 90-х на родине. - AS


24. Ябби Ю

Стены Иерусалима

(Звуки давления)

Купить

Первоначально выпущенный тиражом 500 копий, Walls Of Jerusalem стал последним альбомом, над которым King Tubby и Yabby You работали вместе, и он свидетельствует как о широте совместной работы дуэта, так и о процессе их записи. сочетание оригинального альбома с ранее не издававшимися отрывками и студийными миксами.С составом, в который входили Sly & Robbie и Tommy McCook, Walls of Jerusalem также имеет предысторию интриг и неправильной атрибуции, изначально выпущенную без указания авторства на Prophets, а до этого переизданную как Chant Down Babylon группой Yabba Youth в Великобритании. наконец появляется как король Табби Знакомьтесь, Вивиан Джексон (Yabby You). - AS


23. Клод Дебюсси

Ноктюрн

(Edit.Futurum)

Купить

За последние 27 лет Роттердамская мекка звукозаписи Clone, возможно, прославилась своими яростными и желанными электронными релизами.(Например, см. Elecktroids ' Kilohertz в наших любимых переизданиях сингла 2019 года.) Однако в 2019 году лейбл также погрузился в маловероятную ситуацию, поскольку он запустил новый суб-лейбл, посвященный классической музыке, под названием Edit.Futurm. В ознаменование инаугурации оттисков EF обнаружил небесное исполнение « Ноктюрнов » Клода Дебюсси, дирижер Юн Меркл в исполнении Лионского оркестра, впервые выпущенный на виниле. «Музыка - это свободное, яркое искусство, которое соответствует стихиям, ветру, небу, морю!» воскликнул Дебюсси.Переиздание Nocturnes и сам лейбл - прекрасное воплощение этого чувства, возникшего из заведения, превращение которого в классические царства освобождает в своей неожиданности. - GH


22. Разные художники

Soul Jazz Records представляет рекорды моды: Style & Fashion

(соул-джаз)

Купить

Soul Jazz Records представляет Fashion Records: Style & Fashion - это снимок культового независимого лейбла Fashion Records, чей реестр отечественных талантов помог создать уникальное звучание британского дэнсхолла.Вокруг любителей рока и даба возникло мощное культурное столкновение, которое помогло сформировать танцевальную музыку Великобритании в следующем десятилетии. На лейбле были такие, как Smiley Culture, Cutty Ranks и General Levy, которые вместе с менее известными артистами выступили в сборнике 3xLP. В 90-е годы, когда мода сыграла важную роль в соединении ямайских MC с молодыми продюсерами, чтобы сформировать то, что впоследствии стало музыкой джунглей, сборник показывает почти двадцать лет жанра, который слишком редко получает такое архивное внимание, добавляя контекст. , фотографии и эфемеры, которые выделяют лучшие сборники Soul Jazz. - AS


21. Разные художники

Пришло время мира

(Луака Боп)

Купить

Музыка госпела изменилась в 1970-х, когда новое поколение музыкантов начало включать в свое звучание влияния фанка, соула и RnB из чартов. По всем южным штатам США в церквях формировались местные хоры, семейные группы и вокальные группы, устраивали свои концерты и выпускали короткие тиражи частных пресс-релизов, в которых говорилось о любви и печали веры в светское, неравное и предвзятое общество.Последний выпуск их бесподобной серии World Spirituality, Luaka Bop собрал одни из самых красивых записей той эпохи на The Time For Peace Is Now , свидетельство человеческих усилий и просто великолепное собрание Евангелия души. Тем, кто интересуется дальнейшими исследованиями, стоит послушать сборник Евангелия Среднего Запада No Other Love на Томпкинс-сквер, выпущенный ранее в этом году. - AS


20. Зап Мама

Приключения в Афропее

(заполненные диски)

Купить

«Работа, которую я делаю с Zap Mama, объединяет две культуры.Ни один из них не доминирует, и так должно быть. Я воспринимаю то, что у меня есть как европеец, и то, что у меня есть, как африканец », - говорит Мари Доулн из Zap Mama, цитируемая в прекрасной новой книге Джонни Питтса« Afropean ». Опубликованный ранее в этом году, он опирается на межкультурное происхождение, впервые придуманное Даульн. Раннее звучание a capella Zap Mama опирается на конголезское и бельгийское наследие Даульна, включая пение пигмеев из Центральной Африки и джазовые вокальные аранжировки, а также адаптированную музыку из Сирии, Кубы, Руанды и Заира.Впервые выпущенный в 1991 году на Crammed Discs и впервые переизданный здесь на виниле, Zap Mama's Adventures In Afropea стал одновременно музыкальной и культурной вехой, дав имя опыту африканских иммигрантов в Европе, влияние которого может быть слышно в современных художниках, таких как Шарлотта Адигери. - AS


19. Фернандо Фалькао

Memória Das Águas

(Optimo Music / Selva Discos)

Купить

Партнерство Optimo с ди-джеем Аугусто Оливани из Сан-Паулу, возглавляемое постоянным потоком обязательных к употреблению Brasingles, оказалось особенно плодотворным за последние несколько лет.Тем не менее, великолепное переиздание почти полностью проигнорированного дебюта Фернандо Фалькао в 1981 году, Memória Das Águas , вполне может стать лучшим из лучших. Записанный в Париже во время 15-летнего политического изгнания (действующие бразильские авторитарные деятели смутно относились к его роли в правительственной бомбардировке), эта очаровательная пластинка занимает уникальное положение между фри-джазом, авангардом и арт-попом. Водяная атмосфера переходит в пышную классическую оркестровку, буйные духи афро и бразильский ритм вспыхивают, заряжают энергией и снова уступают место, погружаясь в волны вызывающих воспоминания звуковых скульптур Фалькао.Слава, возможно, ускользнула от него при жизни, но Memória Das Águas должна обеспечить столь необходимый посмертный блеск. - ПР


18. Майкл Стернс

Раскладывание планет

(эмоциональное спасение)

Купить

Не новичок в этом списке переизданий, изюминкой Emotional Rescue и множества предложений его дочерних лейблов был редкий эмбиентный шедевр 1981 года художника по имени Майкл Стернс под названием Planetary Unfolding .Не печатая на виниле более 30 лет, Стернс создал шесть своих композиций, используя свой модульный синтезатор Serge в Continuum Studio. Вдохновляясь ими, он черпал вдохновение в «идее о том, что вселенная состоит из звука, удерживаемого вместе посредством резонанса, где атомы, клетки, океаны, растения, животные и люди - все они являются частью сложной оркестровки - Земля как существо звука». . » Planetary Unfolding - неземная звуковая ода в эмбиентной форме, снова с любовью доведенная до более широкой аудитории.- GH


17. Ана Маццотти

Ninguem Vai Me Segurar

(удаленные записи)

Купить

Мультиинструменталистка и композитор Ана Маццотти - одна из тех артисток, которые пережили тяжелые времена в истории. Ее друг и наставник Хермето Паскоал назвал ее «супер-музыкантом». Маццотти записала всего два альбома до своей безвременной кончины в возрасте 37 лет, работая с участниками джаз-фанк-тяжеловесов Azymuth, вместе с которыми она должна была запомниться как грозная сила в мире. Бразильская музыка.Борясь с институциональным сексизмом внутри индустрии, записи Маццотти так и не достигли той аудитории, которой заслуживала их изысканность, и теперь компании Far Out Recordings выпало снова пролить свет на ее талант. Оба альбома были переизданы в этом году - ее дебютный альбом " Niguem Vai Me Segura " в 1974 году и одноименный альбом, последовавший за альбомом Ana Mazzotti тремя годами позже, который содержит в основном тот же трек-лист, что, возможно, свидетельствует о вере Маццотти в то, что ее музыку следует слышать более широко. . Какой из них вы выберете, в значительной степени зависит от вкуса - первый имеет немного более непринужденное акустическое ощущение, второй, возможно, более актуален - но вместе они представляют собой высшую точку в другом звездном году для лейбла.Чтобы узнать больше об Ане Маццотти, вы можете послушать наш подкаст об альбоме здесь. - AS


16. Аттаразат Аддахабиа и Фараджаллах

Аль-Хадауи

(Хабиби Фанк)

Купить

В истинном стиле хабиби-фанк, Attarazat Addahabia & Faradjalla Al Hadaoui неожиданно приземлился на пороге бренда. Когда «Радио Мартико» получило доступ к архиву студии Boussiphone в Марокко, оно обнаружило катушку с надписью «Фараджаллах».Внутри лежал альбом Al Hadaoui - смесь традиционных звуков gna-wa с влиянием издалека - 7 треков психоделических гитар, натянутого фанка, посыпанного кислотным тонким женским вокалом. Мартико поделился загадочной лентой с Хабиби Функом, которому затем пришлось выяснить, кто, что, когда, где и почему из его уникальных звуков. В конце концов эти аудиодетективы обнаружили Абдельакабира Фараджаллаха и группу Attarazat Addahabia, спасли пленку, оставшуюся в безвестности, и вернули ее в коллективное музыкальное сознание.Иногда переиздание является желанным и хорошо известным. В других случаях требуется такой лейбл, как Habibi Funk, чтобы вернуть залитую солнцем звуковую красоту неизвестной группы из центра Касабланки. - GH


15. Разные художники

Pacific Breeze: японский городской поп, AOR и буги 1976-1986

(Свет на чердаке)

Купить

Light In The Attic выпустили в этом году два сборника, ориентированных на Японию - Kankyo Ongaku , в котором исследуется экологическая и эмбиентная музыка, а также этот сборник City Pop и AOR той же эпохи.Отражая две стороны японского музыкального опыта, компиляции представляли собой ориентировочные жанры, в которых много внимания уделялось, и с Ютакой Хиросе, представляющим звуки окружающей среды, расположенные дальше в этом списке, мы остановились на последнем. За десятилетие стремительного технологического и экономического подъема Pacific Breeze создали такие имена, как Харуоми Хосоно и Минако Йошида, наряду с менее известными артистами, для коллекции гармоний медовой росы, странностей техно-попа и мягких джазовых звуков.LITA также привлекла артиста Хироши Нагая для создания новой залитой солнцем обложки для альбома, чьи оптимистичные американские образы украсили многие из оригинальных альбомов 80-х. - AS


14. Артур Рассел

Айова Дрим

(Аудика)

Купить

Герой андеграунда в центре города, виолончелист, композитор, музыкант и продюсер Артур Рассел добился плодотворных результатов, как благодаря своей работе, так и благодаря сотрудничеству в сфере искусства и музыки Нью-Йорка.Однако большая часть этого так и осталась невыпущенной: на момент его молодой смерти на его имя было всего три сольных студийных пластинки. С тех пор было выпущено девять сборников и альбомов его работ, в основном лейблом Audika, стремящимся исправить это, демонстрируя при этом своеобразное разнообразие его работ. Calling Out Of Context исследовал его электронные поп, фанк и диско-размышления, например, а Corn углубился в свои фолк-творчество. Последний сборник Audika, Iowa Dream , является результатом десятилетней архивной работы Стива Кнутсона из Audika Records и Тома Ли, партнера Рассела.Созданный как сборник демо, его 19 треков пересекают области лоу-фай-панка, фанка и соула его творчества, а не его вдохновленные джазом импровизации или дискотечные исследования. Как и в случае с лучшими его работами, эти необработанные записи заключают в себе душераздирающую красоту совершенных недостатков Рассела - тот слегка расстроенный голос, который заставляет вас отдышаться за наносекунду, слегка нестандартный гитарный звук, который покалывает ваши уши, электрический ритм, который так быстро сбивается с пути, - это делает его работу такой замечательной и такой человечной.- GH


13. Антуанетта Конан

Антуанетта Конан

(Потрясающие ленты из Африки)

Купить

Один из первых альбомов, в которых музыкальная сцена Бауле Кот-д’Ивуара соприкасалась с синтезаторами и драм-машинами, одноименный дебют Антуанетты Конан 1986 года соединил современность с традиционализмом. Смешение ахоко - ударного инструмента, сделанного из скорлуп от орехов, обвязанных вокруг конца ребристого деревянного стержня - с более современными ритмами и поп-чувственностью, альбом стал одним из нескольких, переизданных Awesome Tapes From Africa в 2019 году.От заразительной танцевальной мелодии Abidjan Adja до более приглушенных композиций Enfants Du Monde (Version Baoulé) и Evignen в Antoinette Konan присутствует тонкий оттенок гламура 80-х. - Лазло Ругофф


12. Джун Тайсон

Сатурнианская королева Солнца Ра Аркестра

(современная гармоника)

Купить

Одна из первых и единственных женщин в Sun Ra Arkestra, Джун Тайсон была инициатором афрофутуристических видений Ра.Прикоснувшись к скрипке, которая помогла как с хореографией группы, так и с созданием их потусторонних костюмов, огромный вклад Тайсона в творчество Сан Ра впервые был поставлен в центр внимания Modern Harmonic, которая отточила свои вокальные данные. , взятые из почти 25-летней работы с Sun Ra. Saturnian Queen of the Sun Ra Arkestra - это коллекция, которая переосмысливает музыкальную историю, как и должны быть все хорошие переиздания. - AS


11.Emerson

Если я понадоблюсь, позвоните мне

(Калита)

Купить

Хотя сумасшедший буги-вуги 7 ″ Sending All My Love Out от Эмерсона был выпущен в частном порядке в 1988 году, альбом If ​​You Need Me, Call Me так и не увидел свет. Об альбоме много говорили, но за пределами его круга никто толком не знал, существует ли он на самом деле. К счастью для всех нас, после долгих лет попыток координировать его переиздание, Kalita Records впервые воскресили пластинку во всей красе, вместе с оригинальной и демо-версиями трека, а также обширными примечаниями на обложке, основанными на интервью.Находка святого Грааля, которая является предметом копания знаний, большие аплодисменты во многом обязаны Калите за то, что она принесла эту мифическую летопись в массы. И, спустя десятилетия после его создания, If ​​You Need Me, Call Me - это альбом, который, мы надеемся, принесет Эмерсону признание, которого он по праву заслуживает. - GH


10. Разные художники

Body Beat: Soca-Dub и Электронный Калипсо (1979-98)

(Soundway Records)

Купить

Еще один винтажный год для Soundway Records завершился выпуском Body Beat , обширной тройной пластинки зажигательной сока и электронного калипсо из стран Карибского бассейна и других стран.Комп, который доказывает, что самые большие пробки иногда прямо у вас под носом, он собирает инструментальные би-сайды, дабы и правки, которые в противном случае могли бы остаться незамеченными, и в процессе этого превращается в какую-то возмутительную синтезаторную работу. Этакий компаньон к звукам драм-машины конца 80-х, исследованным в прошлогодних компиляциях Onda De Amor и Gumba Fire , Body Beat - беззастенчиво хороший комп для расслабления конечностей на танцполе. - AS


9.Арета Франклин

Удивительная благодать: все записи

(носорог)

Купить

Когда умирает культовый художник, всегда существует риск, что вновь назначенные хранители его поместья попытаются извлечь все до последнего пенни из своего творчества, выпустив поток релизов, которые никогда не предназначались для выхода в свет. К счастью, в случае королевы души Ареты Франклин этого не произошло в год после ее кончины. Скорее всего, в 2019 году были выпущены два долгожданных предмета из ее хранилищ, оба из которых были запечатлены во время тех же сессий, что и ее самый мощный альбом Amazing Grace .Записано в ходе двух выступлений в Миссионерской баптистской церкви Нью-Храма в Лос-Анджелесе в январе 1972 года. Сначала вышел документальный фильм Amazing Grace - фильм режиссера Сидни Поллака, который был заброшен из-за проблем с редактированием и текущих проблем, связанных с синхронизацией звука. с визуалами, наконец, увидел свет. Во-вторых, бокс-сет, в котором собраны все записи этих выступлений, Amazing Grace: The Complete Recordings , был скомпилирован на 4xLP. Этот релиз, дополненный архивными изображениями и обширным буклетом, является окном в один из самых поворотных моментов в ее карьере, с таким ярким звуком, передающим настроение церкви, что вы чувствуете себя так, как будто находитесь рядом с ней.- GH


8. Шиничиро Йокота

Окончательный Йокота 1991-2019

(Звуки огромных размеров)

Купить

Маэстро японского дома Шиничиро Ёкота наиболее известен своей культовой андерграундной классикой, которую он возглавлял вместе с Соичи Терада «Сделай это снова», однако его собственные постановки так и не получили заслуженного внимания. В этом году Sound of Vast налетел, чтобы изменить это, с 20-летней ретроспективой карьеры под названием Ultimate Yokota 1991-2019 , переходящей от его ранних работ до сегодняшнего дня, с новой версией с участием Terada.Звездные, звенящие горелки, вдохновленные чикагским хаусом так же, как и электронными волшебниками 80-х, такими как YMO, его вдохновляющие 12 треков были бы такими же домашними, вдохновляющими танцевальными стойками боссов в любом клубе сегодня, как и десятилетия назад. - GH


7. Патрик Коули

Механическая коробка фантазии

(Темные записи)

Купить

После того, как были выпущены три посмертных компиляции саундтреков Патрика Коули к гей-порнофильмам, раскопки подземелий Коули, проведенные Dark Entries в 2019 году, Mechanical Fantasy Box , взяли за основу его роман с синтезаторами 1973-1980 годов и поместили их в тандем. с сексуальной раскрепощенностью его гомоэротических журналов.Выпущенные вместе с этими журналами, музыкальные произведения разворачивают эксперименты с тоном и темпом, которые находят Коули более удовлетворенным, чем когда-либо прежде, чтобы раствориться в космосе. Хотя Mechanical Fantasy Box и не первый пункт вашего захода в захватывающую дискотеку его постановок Hi-NRG, он является еще одним важным документом его эмбиентных тенденций, а также его способности к экспериментам. - JH


6. Akofa Akoussah

Акофа Акусса

(г-н Бонго)

Купить

Mr Bongo начал празднование своего 30-летия в этом году с переиздания одноименной песни тоголезского певца Акофы Акуссы 1976 года, и, несмотря на множество заметных переизданий, в том числе Акира Исикава, Хозан Янамото и Селия, он остается самым особенным.Первоначально выпущенный на французском лейбле Sonafric, Akofa Akoussah основан на многих стилях - от афро-фанка вступительного трека «Tango» до психоделического шарма «La Lem» и мягкого соула «Mitso Aseye». Однако выделяется песня «Ramer Sans Rame», что примерно переводится как «грести без весла», что демонстрирует глубину и мощь голоса Акуссы в разрушительном народном шансоне. - AS


5. Fabio & Grooverider

30 лет ярости

(над платой)

Купить

От эйфорической классики до редких жемчужин - прародители британской рейв-культуры Fabio & Grooverider отдали дань уважения своей культовой клубной ночи RAGE и движению своей серией многотомных виниловых пластинок.Это включало в себя четыре тома из 19 треков, выпущенных на виниле. «RAGE был другим зверем, он определенно направил часть этой кислотной энергии, но противопоставил ее новым захватывающим звукам, исходящим из Бельгии, Амстердама, Детройта, Шеффилда, Эссекса и Хакни, и, в свою очередь, создал новый стиль, новое звуковое отношение и энергия в процессе ». Коллекция 30 Years Of Rage , охватывающая от баса и джангла до хардкорного эйсид-хауса и грува, представляет собой эйфорическую аудиокапсулу времени из безмятежной эры британской музыки.- GH


4. Элис Кларк

Элис Кларк

(WeWantsSounds)

Купить

Жемчужина короны Mainstream Records, одноименный альбом Элис Кларк 1972 года заслуживает того, чтобы его признать одним из величайших фанк- и соул-альбомов всех времен. Обрамленный джазовыми инструментами и аранжировками Боба Шэда и Эрни Уилкинса, голос Кларк взлетает с первой ноты, когда она ведет слушателя через десять треков, которые, за исключением двух более ранних синглов, составляют всю ее записанную продукцию.Хотя раньше о Кларке было мало что известно, WeWantSounds оказали услугу по записи, включив в обширный буклет несколько потрясающих оригинальных фотографий, которые обеспечивают контекст сеанса, чья безвестность отправила его в фольклор душ. Хотя сравнений с Аретой, Робертой и Дайон предостаточно, необычность голоса Кларка означает, что этот альбом следует воспринимать отдельно. Другие известные переиздания WeWantSounds включали продолжение их серии Akiko Yano ( Iroha Ni Konpeitou и Japanese Girl ) и дебют Рюичи Сакамото, Thousand Knives Of . - AS


3. Ютака Хиросе

Новая 4

(WRWTFWW)

Купить

В 2019 году WRWTFWW снова представил множество редких и малоизвестных переизданий из Японии к радости всех коллекционеров, которые не стали выкладывать сногсшибательные цифры за рекорд. Любое из этих переизданий могло бы войти в список наших фаворитов. Особо следует отметить желанный альбом Still Way (Wave Notaion 2) Сатоши Асикавы, в котором Мидори Такада играет на вибрафоне, и представляет собой такой же мечтательный альбом, как и они.Однако музыка Ютаки Хиросе для хауса (да, хауса) была фаворитом VF благодаря как звукам, содержащимся внутри, так и вдохновению, лежащему в основе альбома.

«Я не создаю музыку как таковую сознательно, а создаю скульптуру времени, сделанную со звуком в смысле общего музыкального производства, которое для меня универсально», - объяснил Хиросе. Nova 4 был создан Хиросе в 1986 году для серии Soundscape от Misawa Home Corporation, предназначенной для воспроизведения в их сборных домах.В его 11-трековом миксе полевые записи звуков природы с синтезаторами и электроникой, включая FaIrLIGht CMI, Prophet-5, Prophet-600, akaI S900, Yamaha DX7, ensonIQ Mirage, ROLAND TR-808, PCI-8801 и акустические инструменты. В общем, LP - это окно в тонкий и всеобъемлющий подход, который должна звучать в японской культуре. Все, от запахов и настроения до людей, животных, предметов и физических структур, вибрирует до собственных колебаний. Требуются такие артисты, как Hirose, и лейблы, такие как WRWTFWW, чтобы превратить их в музыку, которую может слышать каждый. - GH


2. Морт Гарсон

Плантазия Матери-Земли

(Священные кости)

Купить

«Если вы купили змеиное растение, папоротник спаржи, мирную лилию или что-то еще у Матери-Земли на Мелроуз-авеню в Лос-Анджелесе (или купили матрас Simmons у Sears), вы также забрали домой Plantasia , специально записанный альбом для растений ». Выпущенные в 1976 году изысканные электронные джемы Moog Mother Earth Plantasia были вдохновлены книгой The Secret Life Of Plants - феноменом середины 70-х годов, написанным оккультистом / бывшим агентом OSS Питером Томпкинсом и энтузиастом лозоискательства / бывшим агентом ЦРУ Кристофером Бердом. утверждали, что комнатные растения могут читать наши мысли, предсказывать стихийные бедствия и, прежде всего, получать удовольствие от прослушивания музыки.Независимо от того, что вы думаете о чувствительности растений, любой может оценить психоделический (и восхитительный) синтетический симбиоз вселенной Гарсона, наполненной растениями. - GH


1. Гиги

Аудиосистема с подсветкой

(капсула времени)

Купить

В 2001 году эфиопская вокалистка Джиджи записала свой дебютный альбом вместе с группой, в которую входили такие знаменитости джаза, как Херби Хэнкок, Фароа Сандерс и Уэйн Шортер.Ее описывали как «определяющий голос эфиопского сообщества экспатриантов», поскольку в 1998 году она переехала из Аддис-Абебы в Сан-Франциско, где начала зарекомендовать себя как голос на международной арене.

Через два года после первого релиза продюсер и басист Билл Ласвелл обработал весь альбом сказочным эмбиентным даб-дабом и выпустил его на компакт-диске через Palm Pictures Криса Блэквелла.

Парящие риффы саксофона, обрывки амхарских стихов Джиджи и тонкие синтезаторные линии придают Illuminated Audio волнообразный, органичный звук, примером которого является замедленная эфиопская песня Mengedegna.

Как и в случае с другими переизданиями Time Capsule, внимание к деталям на оби-полоске кальки и двуязычные надписи на вкладышах делают его особенно особенным, превращая оригинал только на компакт-диске в нечто полностью принадлежащее его собственному творчеству. - AS


Работа Патрика Сэвила

Новее

Джазовый трубач Ник Уолтерс представляет новый альбом

Active Imagination
Старшее

Этот новый документальный фильм исследует наследие клубной ночи Fabio & Grooverider's Rage

Текущее и будущее применение моделей на основе индуцированных плюрипотентных стволовых клеток для изучения патологических белков при нейродегенеративных расстройствах

  • 1.

    Das AS, Zou WQ. Прионы: помимо одного белка. Clin Microbiol Rev.2016; 29: 633–58.

    PubMed PubMed Central Google ученый

  • 2.

    Prusiner SB, Groth DF, Cochran SP, Masiarz FR, McKinley MP, Martinez HM. Молекулярные свойства, частичная очистка и анализ путем измерения периода инкубации агента скрепи хомяка. Biochem. 1980; 19: 4883–91.

    CAS Google ученый

  • 3.

    Айронсайд JW. Невропатологические находки при новом варианте CJD и экспериментальной передаче BSE. FEMS Immunol Med Mic. 1998. 21: 91–95.

    CAS Google ученый

  • 4.

    Ли С.К., Наяк А., Сетураман А., Белфорт Дж., Макрей Дж. Трехступенчатая кинетическая модель фибрилляции амилоида. Biophys J. 2007; 92: 3448–58.

    CAS PubMed PubMed Central Google ученый

  • 5.

    Ан ТБ, Лэнгстон Дж. У., Аачи В. Р., Диксон Д. В.. Связь соседних тканей и глиоза с патологией альфа-синуклеина при трансплантации плода при болезни Паркинсона. Am J Neurodegen Dis. 2012; 1: 49–59.

    Google ученый

  • 6.

    Чу Й, Кордовер Дж. Патология с тельцами Леви в трансплантатах плода. Ann NY Acad Sci. 2010; 1184: 55–67.

    CAS PubMed Google ученый

  • 7.

    Кордовер Дж. Х., Чу Й., Хаузер Р. А., Фриман ТБ, Оланов CW. Патология, подобная тельцам Леви, при длительной трансплантации эмбрионального ниграла при болезни Паркинсона. Nat Med. 2008. 14: 504–6.

    CAS PubMed Google ученый

  • 8.

    Li JY, Englund E, Holton JL, Soulet D, Hagell P, Lees AJ, et al. Тельца Леви в пересаженных нейронах у субъектов с болезнью Паркинсона предполагают распространение болезни от хозяина к трансплантату. Nat Med. 2008; 14: 501–3.

    CAS PubMed Google ученый

  • 9.

    Braak H, Del Tredici K, Rub U, de Vos RA, Jansen Steur EN, Braak E. Стадия патологии головного мозга, связанной со спорадической болезнью Паркинсона. Neurobiol Aging. 2003. 24: 197–211.

    PubMed Google ученый

  • 10.

    Лук К.С., Кем В.М., Чжан Б., О’Брайен П., Трояновски Дж. К., Ли В.М.. Внутрицеребральная инокуляция патологического альфа-синуклеина вызывает у мышей быстро прогрессирующую нейродегенеративную альфа-синуклеинопатию. J Exp Med. 2012; 209: 975–86.

    CAS PubMed PubMed Central Google ученый

  • 11.

    Recasens A, Dehay B, Bove J, Carballo-Carbajal I, Dovero S, Perez-Villalba A, et al. Экстракты тельцов Леви из головного мозга при болезни Паркинсона вызывают патологию альфа-синуклеина и нейродегенерацию у мышей и обезьян. Энн Нейрол. 2014; 75: 351–62.

    CAS PubMed PubMed Central Google ученый

  • 12.

    Dehay B, Bezard E. Интрастриатальная инъекция фибрилл альфа-синуклеина вызывает у макак патологию, подобную паркинсонизму. Головной мозг. 2019; 142: 3321–2.

    PubMed Google ученый

  • 13.

    Ким С., Квон С.Х., Кам Т.И., Паникер Н., Каруппагаундер С.С., Ли С. и др. Транснейрональное распространение патологического альфа-синуклеина из кишечника в мозг моделирует болезнь Паркинсона. Нейрон. 2019; 103: 627–41 e627.

    CAS PubMed PubMed Central Google ученый

  • 14.

    Челлис С., Хори А., Сэмпсон Т.Р., Ю Б.Б., Чаллис Р.С., Гамильтон А.М. и др. Засеянные кишечником фибриллы альфа-синуклеина способствуют дисфункции кишечника и патологии головного мозга, особенно у старых мышей. Nat Neurosci. 2020; 23: 327–36.

    CAS PubMed PubMed Central Google ученый

  • 15.

    Groveman BR, Orru CD, Hughson AG, Raymond LD, Zanusso G, Ghetti B, et al. Быстрое и сверхчувствительное количественное определение связанных с заболеванием семян альфа-синуклеина в головном мозге и спинномозговой жидкости с помощью alphaSyn RT-QuIC.Acta Neuropathol Commun. 2018; 6: 7.

    PubMed PubMed Central Google ученый

  • 16.

    Сингх С., ДеМарко М.Л. Конверсионные тесты in vitro для диагностики нейродегенеративных протеинопатий. JALM. 2020; 5: 142–157.

    PubMed Google ученый

  • 17.

    Браак Х., Браак Э., Бол Дж. Стадия деструкции коры, связанной с болезнью Альцгеймера. Eur Neurol. 1993; 33: 403–8.

    CAS PubMed Google ученый

  • 18.

    Meyer-Luehmann M, Coomaraswamy J, Bolmont T., Kaeser S, Schaefer C, Kilger E, et al. Экзогенная индукция церебрального бета-амилоидогенеза регулируется агентом и хозяином. Наука. 2006; 313: 1781–4.

    CAS PubMed Google ученый

  • 19.

    Gary C, Lam S, Herard AS, Koch JE, Petit F, Gipchtein P, et al. Энцефалопатия, вызванная инокуляцией мозга, вызванной болезнью Альцгеймера, у приматов, кроме человека. Acta Neuropathol Commun. 2019; 7: 126.

    PubMed PubMed Central Google ученый

  • 20.

    Clavaguera F, Akatsu H, Fraser G, Crowther RA, Frank S, Hench J и др. Гомогенаты головного мозга от таупатий человека индуцируют включения тау в мозге мышей. PNAS. 2013; 110: 9535–40.

    CAS PubMed PubMed Central Google ученый

  • 21.

    Porta S, Xu Y, Restrepo CR, Kwong LK, Zhang B, Brown HJ, et al. Полученные пациентом экстракты головного мозга с лобно-височной долевой дегенерацией вызывают образование и распространение патологии TDP-43 in vivo.Nat Commun. 2018; 9: 4220.

    PubMed PubMed Central Google ученый

  • 22.

    Lasagna-Reeves CA, Castillo-Carranza DL, Sengupta U, Clos AL, Jackson GR, Kayed R. Олигомеры Тау ухудшают память и вызывают синаптическую и митохондриальную дисфункцию у мышей дикого типа. Mol Neurodegen. 2011; 6:39.

    Google ученый

  • 23.

    Mulder CK, Dong Y, Brugghe HF, Timmermans HA, Tilstra W., Westdijk J, et al.Иммунизация небольшими конъюгатами циклопептида, полученного из бета-амилоида, снижает у мышей нейродегенерацию, вызванную бета-амилоидом. J. Alzheimer’s Dis. 2016; 52: 1111–23.

    CAS Google ученый

  • 24.

    Polinski NK, Volpicelli-Daley LA, Sortwell CE, Luk KC, Cremades N, Gottler LM, et al. Лучшие методы создания и использования предварительно сформированных фибрилл с альфа-синуклеином для моделирования болезни Паркинсона у грызунов. Дж. Паркинсона Dis. 2018; 8: 303–22.

    Google ученый

  • 25.

    Masnata M, Sciacca G, Maxan A, Bousset L, Denis HL, Lauruol F, et al. Демонстрация прионоподобных свойств мутантных фибрилл хантингтина в парадигмах как in vitro, так и in vivo. Acta Neuropathol. 2019; 137: 981–1001.

    CAS PubMed PubMed Central Google ученый

  • 26.

    Zeineddine R, Pundavela JF, Corcoran L, Stewart EM, Do-Ha D, Bax M, et al.Белковые агрегаты SOD1 стимулируют макропиноцитоз в нейронах, облегчая их размножение. Mol Neurodegen. 2015; 10: 57.

    Google ученый

  • 27.

    Блеса Дж., Прзедборски С. Болезнь Паркинсона: модели на животных и уязвимость дофаминергических клеток. Фронт нейроанат. 2014; 8: 155.

    PubMed PubMed Central Google ученый

  • 28.

    Dawson TM, Golde TE, Lagier-Tourenne C.Животные модели нейродегенеративных заболеваний. Nat Neurosci. 2018; 21: 1370–9.

    CAS PubMed PubMed Central Google ученый

  • 29.

    Холли С.М., Камджоу Т., Рейдлинг Дж. К., Фьюри Б., Колил-Бергум Д., Бауэр Г. и др. Терапевтические эффекты стволовых клеток в моделях болезни Хантингтона на грызунах: обзор и результаты электрофизиологии. CNS Neurosci Ther. 2018; 24: 329–42.

    PubMed PubMed Central Google ученый

  • 30.

    Jankowsky JL, Zheng H. Практические соображения по выбору мышиной модели болезни Альцгеймера. Mol Neurodegen. 2017; 12:89.

    Google ученый

  • 31.

    Оберхейм Н.А., Такано Т., Хан Х, Хе В., Лин Дж. Х., Ван Ф. и др. Уникальные гоминидные черты астроцитов взрослого человека. J Neurosci. 2009. 29: 3276–87.

    CAS PubMed PubMed Central Google ученый

  • 32.

    Хан X, Чен М., Ван Ф, Виндрем М., Ван С., Шанз С. и др. Приживление переднего мозга глиальными клетками-предшественниками человека увеличивает синаптическую пластичность и способность к обучению у взрослых мышей. Стволовая клетка клетки. 2013; 12: 342–53.

    CAS PubMed PubMed Central Google ученый

  • 33.

    Zhang Y, Sloan SA, Clarke LE, Caneda C, Plaza CA, Blumenthal PD, et al. Очистка и характеристика астроцитов-предшественников и зрелых человеческих астроцитов выявляют транскрипционные и функциональные различия с мышами.Нейрон. 2016; 89: 37–53.

    CAS PubMed PubMed Central Google ученый

  • 34.

    Район Т, Стаматаки Д., Перес-Карраско Р., Гарсия-Перес Л., Баррингтон С., Мельчионда М. и др. Специфическая для вида скорость развития связана с различиями в стабильности белков. Наука. 2020; 369: eaba7667.

    CAS PubMed PubMed Central Google ученый

  • 35.

    Prusiner SB. Прионы. PNAS. 1998; 95: 13363–83.

    CAS PubMed PubMed Central Google ученый

  • 36.

    Баррия М.А., Балачандран А., Морита М., Китамото Т., Бэррон Р., Мэнсон Дж. И др. Молекулярные барьеры зоонозной передачи прионов. Emerg Infect Dis. 2014; 20: 88–97.

    CAS PubMed PubMed Central Google ученый

  • 37.

    Уайзман Ф.К., Канселотти Э., Пиккардо П., Иремонгер К., Бойл А., Браун Д. и др.Статус гликозилирования PrPC является ключевым фактором в определении передачи трансмиссивной губчатой ​​энцефалопатии между видами. J Virol. 2015; 89: 4738–47.

    CAS PubMed PubMed Central Google ученый

  • 38.

    Хасегава К., Мохри С., Йокояма Т. Сравнение локальной структурной стабильности прионного белка млекопитающих (PrP) с помощью расчетов молекулярных орбиталей фрагментов. Прион. 2013; 7: 185–91.

    CAS PubMed PubMed Central Google ученый

  • 39.

    Sanchez-Garcia J, Fernandez-Funez P. D159 и S167 представляют собой защитные остатки в прионном белке собаки и лошади, двух устойчивых к прионам животных. Neurobiol Dis. 2018; 119: 1–12.

    CAS PubMed PubMed Central Google ученый

  • 40.

    Бэррон Р.М., Томсон В., Джеймисон Э., Мелтон Д.В., Айронсайд Дж., Уилл Р. и др. Замена одной аминокислоты на N-конце мышиного PrP изменяет время инкубации TSE через барьеры трех видов.EMBO J. 2001; 20: 5070–8.

    CAS PubMed PubMed Central Google ученый

  • 41.

    Korth C, Kaneko K, Groth D, Heye N, Telling G, Mastrianni J, et al. Сокращенное время инкубации человеческих прионов у мышей, экспрессирующих химерный трансген прионного белка мыши и человека. PNAS. 2003; 100: 4784–9.

    CAS PubMed PubMed Central Google ученый

  • 42.

    Hernandez F, Merchan-Rubira J, Valles-Saiz L, Rodriguez-Matellan A, Avila J.Различия между человеческим и мышиным тау на N-конце. Front Aging Neurosci. 2020; 12:11.

    CAS PubMed PubMed Central Google ученый

  • 43.

    Эрнандес Ф., Куадрос Р., Олла И., Гарсия С., Феррер И., Перри Г. и др. Различия в структуре и функциях тау-белка человека и мыши. Biochim Biophys Acta Mol Basis Dis. 2019; 1865: 2024–2030.

    CAS PubMed Google ученый

  • 44.

    Stanford PM, Shepherd CE, Halliday GM, Brooks WS, Schofield PW, Brodaty H, et al. Мутации в гене тау, которые вызывают увеличение трех повторов тау и лобно-височной деменции. Головной мозг. 2003. 126 (Pt 4): 814–26.

    PubMed Google ученый

  • 45.

    Hutton M, Lendon CL, Rizzu P, Baker M, Froelich S, Houlden H, et al. Ассоциация миссенс-мутаций и мутаций 5'-сплайс-сайтов в тау с наследственной деменцией FTDP-17. Природа. 1998; 393: 702–5.

    CAS PubMed Google ученый

  • 46.

    Metrick MA II, Ferreira NDC, Saijo E., Kraus A, Newell K, Zanusso G, et al. Единый сверхчувствительный тест для обнаружения и различения тау-агрегатов болезней Альцгеймера и Пика. Acta Neuropathol Commun. 2020; 8:22.

    CAS PubMed PubMed Central Google ученый

  • 47.

    Hu WT, Parisi JE, Knopman DS, Boeve BF, Dickson DW, Ahlskog JE, et al.Клинические особенности и выживаемость таупатий 3R и 4R, проявляющихся как поведенческий вариант лобно-височной деменции. Alzheimer Dis Assoc Disord. 2007; 21: S39–43.

    PubMed Google ученый

  • 48.

    Dinkel PD, Siddiqua A, Huynh H, Shah M, Margittai M. Вариации в конформации филаментов диктуют барьер для посева между трех- и четырехповторным тау. Биохимия. 2011; 50: 4330–6.

    CAS PubMed Google ученый

  • 49.

    Леварска Л., Зилка Н., Джадхав С., Нерадил П., Новак М. О грызунах и людях: таинственное межнейронное паломничество неправильно свернутого тау-белка при болезни Альцгеймера. J. Alzheimer’s Dis. 2013; 37: 569–77.

    Google ученый

  • 50.

    Sayas CL, Medina M, Cuadros R, Olla I, Garcia E, Perez M, et al. Роль N-концевого мотива тау-белка в секреции тау-белка концевыми связывающими белками. PLoS ONE. 2019; 14: e0210864.

    CAS PubMed PubMed Central Google ученый

  • 51.

    Ueno H, Yamaguchi T., Fukunaga S, Okada Y, Yano Y, Hoshino M и др. Сравнение агрегации амилоидных бета-белков человека и грызунов в ганглиозидных кластерах GM1. Биохимия. 2014; 53: 7523–30.

    CAS PubMed Google ученый

  • 52.

    Jankowsky JL, Younkin LH, Gonzales V, Fadale DJ, Slunt HH, Lester HA, et al. Грызун А бета модулирует растворимость и распределение отложений амилоида у трансгенных мышей.J Biol Chem. 2007; 282: 22707–20.

    CAS PubMed Google ученый

  • 53.

    Кейн М.Д., Липински В.Дж., Каллахан М.Дж., Биан Ф., Дарем Р.А., Шварц Р.Д. и др. Доказательства посева бета-амилоида путем интрацеребральной инфузии экстрактов мозга, вызванных болезнью Альцгеймера, у мышей-трансгенных бета-амилоидных белков-предшественников. J Neurosci. 2000; 20: 3606–11.

    CAS PubMed PubMed Central Google ученый

  • 54.

    Танака Г., Яманака Т., Фурукава Ю., Каджимура Н., Мицуока К., Нукина Н. Полиморфные фибриллы альфа-синуклеина, зависимые от последовательности и структуры семян. Biochim Biophys Acta Mol Basis Dis. 2019; 1865: 1410–20.

    CAS PubMed Google ученый

  • 55.

    Luk KC, Covell DJ, Kehm VM, Zhang B, Song IY, Byrne MD, et al. Молекулярная и биологическая совместимость с альфа-синуклеином хозяина влияет на патогенность фибрилл. Cell Rep. 2016; 16: 3373–87.

    CAS PubMed PubMed Central Google ученый

  • 56.

    Fares MB, Maco B, Oueslati A, Rockenstein E, Ninkina N, Buchman VL, et al. Индукция фибрилляции альфа-синуклеина de novo в нейрональной модели болезни Паркинсона. PNAS. 2016; 113: E912–921.

    CAS PubMed PubMed Central Google ученый

  • 57.

    Tartari M, Gissi C, Lo Sardo V, Zuccato C, Picardi E, Pesole G, et al.Филогенетическое сравнение гомологов хантингтина показывает появление примитивного polyQ у морского ежа. Mol Biol Evol. 2008. 25: 330–8.

    CAS PubMed Google ученый

  • 58.

    Walker FO. Болезнь Хантингтона. Ланцет. 2007; 369: 218–28.

    CAS PubMed Google ученый

  • 59.

    Menalled LB, Sison JD, Dragatsis I, Zeitlin S, Chesselet MF. Динамика ранних моторных и невропатологических аномалий в модели болезни Хантингтона у мышей с 140 CAG-повторами.J Comp Neurol. 2003; 465: 11–26.

    CAS PubMed Google ученый

  • 60.

    Heng MY, Detloff PJ, Albin RL. Генетические модели грызунов болезни Хантингтона. Neurobiol Dis. 2008; 32: 1–9.

    CAS PubMed Google ученый

  • 61.

    Ситараман С.В., Тейлор А.Б., Холлоуэй С., Харт П.Дж. Структуры химер SOD1 мыши и SOD1 человека / мыши. Arch Biochem Biophys. 2010; 503: 183–90.

    CAS PubMed PubMed Central Google ученый

  • 62.

    Карч CM, Borchelt DR. Элементы, модулирующие агрегацию в мутантной супероксиддисмутазе человека 1. Arch Biochem Biophys. 2010; 503: 175–82.

    CAS PubMed PubMed Central Google ученый

  • 63.

    Ван Х.Й., Ван ИФ, Бозе Дж., Шен К.К. Структурное разнообразие и функциональные последствия эукариотического семейства генов TDP.Геномика. 2004; 83: 130–9.

    CAS PubMed Google ученый

  • 64.

    Д’Альтон С., Альтшулер М., Льюис Дж. Исследования альтернативных изоформ дают представление об ауторегуляции и патогенезе TDP-43. РНК. 2015; 21: 1419–32.

    PubMed PubMed Central Google ученый

  • 65.

    Гумина В., Онесто Е., Коломбрита С., Мараски А., Силани В., Ратти А. Межвидовые различия в регуляции оси програнулин-сортилин в моделях нейродегенерации клеток TDP-43.Int J Mol Sci. 2019; 20: 5866.

    CAS PubMed Central Google ученый

  • 66.

    Colby DW, Zhang Q, Wang S, Groth D, Legname G, Riesner D, et al. Обнаружение прионов с помощью анализа посева амилоида. PNAS. 2007; 104: 20914–9.

    CAS PubMed PubMed Central Google ученый

  • 67.

    Wilham JM, Orru CD, Bessen RA, Atarashi R, Sano K, Race B, et al. Быстрое определение конечной точки посевной активности прионов с чувствительностью, сопоставимой с биоанализами.PLoS Pathog. 2010; 6: e1001217.

    PubMed PubMed Central Google ученый

  • 68.

    Saborio GP, Permanne B, Soto C. Чувствительное обнаружение патологического прионного белка путем циклической амплификации неправильного свертывания белка. Природа. 2001; 411: 810–3.

    CAS PubMed Google ученый

  • 69.

    Raymond GJ, Hope J, Kocisko DA, Priola SA, Raymond LD, Bossers A, et al.Молекулярная оценка потенциальной трансмиссивности BSE и скрепи для человека. Природа. 1997. 388: 285–8.

    CAS PubMed Google ученый

  • 70.

    Caughey B., Orru CD, Groveman BR, Hughson AG, Manca M, Raymond LD, et al. Усиленное обнаружение прионов и других амилоидов с помощью RT-QuIC в диагностике и оценке терапевтических и дезинфицирующих средств. Prog Mol Biol Transl Sci. 2017; 150: 375–88.

    CAS PubMed PubMed Central Google ученый

  • 71.

    Soto-Gamez A, Quax WJ, Demaria M. Регулирование сетей выживания в стареющих клетках: от механизмов к вмешательствам. J Mol Biol. 2019; 431: 2629–43.

    CAS PubMed Google ученый

  • 72.

    Kaur G, Dufour JM. Клеточные линии: ценные инструменты или бесполезные артефакты. Сперматогенез. 2012; 2: 1–5.

    PubMed PubMed Central Google ученый

  • 73.

    Holmes BB, DeVos SL, Kfoury N, Li M, Jacks R, Yanamandra K, et al.Гепарансульфатные протеогликаны опосредуют интернализацию и размножение определенных протеопатических семян. PNAS. 2013; 110: E3138–3147.

    CAS PubMed PubMed Central Google ученый

  • 74.

    Эванс Л.Д., Вассмер Т., Фрейзер Дж., Смит Дж., Перкинтон М., Биллинтон А. и др. Внеклеточный мономерный и агрегированный тау-белок эффективно проникает в нейроны человека через перекрывающиеся, но разные пути. Cell Rep.2018; 22: 3612–24.

    CAS PubMed PubMed Central Google ученый

  • 75.

    Jansen AH, Батенбург KL, Pecho-Vrieseling E, Reits EA. Визуализация прионоподобного переноса в моделях болезни Хантингтона. Biochim Biophys Acta Mol Basis Dis. 2017; 1863: 793–800.

    CAS PubMed Google ученый

  • 76.

    Jurgielewicz BJ, Yao Y, Stice SL. Кинетика и специфичность поглощения внеклеточных везикул HEK293T с использованием проточной цитометрии с визуализацией. Nanoscale Res Lett. 2020; 15: 170.

    CAS PubMed PubMed Central Google ученый

  • 77.

    Херави М., Даргахи Л., Парсафар С., Тайараниан Марвиан А., Алиакбари Ф., Моршеди Д. Первичные нейрональные клетки более устойчивы, чем клетки PC12, к токсичным агрегатам альфа-синуклеина. Neurosci Lett. 2019; 701: 38–47.

    CAS PubMed Google ученый

  • 78.

    Deng L, Pollmeier L, Zhou Q, Bergemann S, Bode C, Hein L, et al. Экспрессия генов в иммортализованных по сравнению с первично изолированными эндотелиальными клетками сердца. Научный доклад 2020; 10: 2241.

    CAS PubMed PubMed Central Google ученый

  • 79.

    Кан Дж. Х., Рихахоу П. Г., Ишола Т. А., Цяо Дж., Эверс Б. М., Чанг Д.Х. Молчание MYCN вызывает дифференцировку и апоптоз в клетках нейробластомы человека. Biochem Biophys Res Commun. 2006; 351: 192–7.

    CAS PubMed PubMed Central Google ученый

  • 80.

    Эванс М. Открытие плюрипотентности: 30 лет эмбриональных стволовых клеток мыши.Nat Rev Mol Cell Biol. 2011; 12: 680–6.

    CAS PubMed Google ученый

  • 81.

    Такахаши К., Яманака С. Индукция плюрипотентных стволовых клеток из культур эмбриональных и взрослых фибробластов мыши с помощью определенных факторов. Клетка. 2006; 126: 663–76.

    CAS Google ученый

  • 82.

    Park IH, Zhao R, West JA, Yabuuchi A, Huo H, Ince TA, et al. Перепрограммирование соматических клеток человека до плюрипотентности с определенными факторами.Природа. 2008; 451: 141–6.

    CAS PubMed Google ученый

  • 83.

    Ю. Дж., Водяник М. А., Смуга-Отто К., Антосевич-Бурже Дж., Френ Дж. Л., Тиан С. и др. Индуцированные линии плюрипотентных стволовых клеток, полученные из соматических клеток человека. Наука. 2007; 318: 1917–20.

    CAS PubMed PubMed Central Google ученый

  • 84.

    Суга М., Кондо Т., Иноуэ Х. Моделирование неврологических расстройств с помощью астроцитов, полученных из плюрипотентных стволовых клеток человека.Int J Mol Sci. 2019; 20: 3862.

    CAS PubMed Central Google ученый

  • 85.

    Chang CY, Ting HC, Liu CA, Su HL, Chiou TW, Lin SZ, et al. Модели нейродегенеративных заболеваний на основе индуцированных плюрипотентных стволовых клеток (ИПСК) для повторения фенотипа и скрининга лекарств. Молекулы. 2020; 25: 2000.

    CAS PubMed Central Google ученый

  • 86.

    Chanoumidou K, Mozafari S, Baron-Van Evercooren A, Kuhlmann T.Олигодендроциты, полученные из стволовых клеток, для изучения миелиновых заболеваний. Глия. 2020; 68: 705–20.

    PubMed Google ученый

  • 87.

    Хассельманн Дж., Блартон-Джонс М. Микроглия, полученная из ИПСК человека: набор инструментов для выращивания врожденных иммунных клеток мозга. Глия. 2020; 68: 721–39.

    PubMed PubMed Central Google ученый

  • 88.

    Hong W, Wang Z, Liu W., O’Malley TT, Jin M, Willem M, et al.Диффузионные, высокобиоактивные олигомеры составляют критическое меньшинство растворимого Abeta в мозге при болезни Альцгеймера. Acta Neuropathol. 2018; 136: 19–40.

    CAS PubMed PubMed Central Google ученый

  • 89.

    Рейли П., Уинстон С.Н., Барон К.Р., Трехо М., Рокенштейн Е.М., Акерс Дж.С. и др. Новая модель человеческого нейронального тау-белка, демонстрирующая нейрофибриллярные клубки и трансцеллюлярное распространение. Neurobiol Dis. 2017; 106: 222–34.

    CAS PubMed PubMed Central Google ученый

  • 90.

    Nagai M, Re DB, Nagata T, Chalazonitis A, Jessell TM, Wichterle H, et al. Астроциты, экспрессирующие связанные с БАС мутантные факторы высвобождения SOD1, избирательно токсичны для двигательных нейронов. Nat Neurosci. 2007; 10: 615–22.

    CAS PubMed PubMed Central Google ученый

  • 91.

    ди Доменико А., Карола Дж., Калатаюд С., Понс-Эспиналь М., Муньос Дж. П., Ришо-Патен И. и др. Астроциты, происходящие от пациентов с ИПСК, вносят свой вклад в неавтономную нейродегенерацию при болезни Паркинсона.Stem Cell Rep. 2019; 12: 213–29.

    Google ученый

  • 92.

    Cooper O, Seo H, Andrabi S, Guardia-Laguarta C, Graziotto J, Sundberg M, et al. Фармакологическое восстановление митохондриальных дефицитов в нервных клетках, происходящих от ИПСК, у пациентов с семейной болезнью Паркинсона. Sci Transl Med. 2012; 4: 141ra190.

    Google ученый

  • 93.

    Li L, Roh JH, Chang EH, Lee Y, Lee S, Kim M и др.ИПСК моделирование мутации пресенилина1 при болезни Альцгеймера с мозжечковой атаксией. Exp Neurobiol. 2018; 27: 350–64.

    PubMed PubMed Central Google ученый

  • 94.

    Ли Дж. К., Джин Г. К., Пак М. Х., Ким Б. Р., Ли П. Х., Накаучи Н. и др. Кислая сфингомиелиназа модулирует аутофагический процесс, контролируя биогенез лизосом при болезни Альцгеймера. J Exp Med. 2014; 211: 1551–70.

    CAS PubMed PubMed Central Google ученый

  • 95.

    Webster CP, Smith EF, Bauer CS, Moller A, Hautbergue GM, Ferraiuolo L, et al. Белок C9orf72 взаимодействует с Rab1a и комплексом ULK1, регулируя инициирование аутофагии. EMBO. 2016; 35: 1656–76.

    CAS Google ученый

  • 96.

    Scialo C, De Cecco E, Manganotti P, Legname G. Штаммы прионов и прионоподобных белков: расшифровка молекулярных основ гетерогенности в нейродегенерации. Вирусы. 2019; 11: 261.

    CAS PubMed Central Google ученый

  • 97.

    Chai X, Dage JL, Citron M. Конститутивная секреция тау-белка по нетрадиционному механизму. Neurobiol Dis. 2012; 48: 356–66.

    CAS PubMed Google ученый

  • 98.

    Брайт Дж., Хуссейн С., Данг В., Райт С., Купер Б., Бьюн Т. и др. Секретируемый человеком тау увеличивает выработку бета-амилоида. Neurobiol Aging. 2015; 36: 693–709.

    CAS PubMed Google ученый

  • 99.

    Мур С., Эванс Л.Д., Андерссон Т., Портелиус Э., Смит Дж., Диас Т. Б. и др. Метаболизм АРР регулирует протеостаз тау в нейронах коры головного мозга человека. Cell Rep. 2015; 11: 689–96.

    CAS PubMed PubMed Central Google ученый

  • 100.

    Reyes JF, Olsson TT, Lamberts JT, Devine MJ, Kunath T, Brundin P. Модель клеточной культуры для мониторинга передачи альфа-синуклеина от клетки к клетке. Neurobiol Dis. 2015; 77: 266–75.

    CAS PubMed Google ученый

  • 101.

    Pecho-Vrieseling E, Rieker C, Fuchs S, Bleckmann D, Esposito MS, Botta P, et al. Транснейрональное распространение мутантного хантингтина вносит вклад в неавтономную патологию нейронов. Nat Neurosci. 2014; 17: 1064–72.

    CAS PubMed Google ученый

  • 102.

    Канмерт Д., Кантлон А., Мураторе С.Р., Джин М., О’Мэлли Т.Т., Ли Дж. И др. Укороченные на С-конце формы тау-белка, но не полноразмерный тау-белок или его С-концевые фрагменты, высвобождаются из нейронов независимо от гибели клеток.J Neurosci. 2015; 35: 10851–65.

    CAS PubMed PubMed Central Google ученый

  • 103.

    Guix FX, Corbett GT, Cha DJ, Mustapic M, Liu W, Mengel D, et al. Обнаружение компетентного к агрегации тау-белка во внеклеточных везикулах, происходящих от нейронов. Int J Mol Sci. 2018; 19: 663.

    PubMed Central Google ученый

  • 104.

    Усенович М., Нируманд С., Дроле Р.Э., Яо Л., Гаспар Р.С., Хэтчер Н.Г. и др.Интернализованные олигомеры тау-белка вызывают нейродегенерацию, индуцируя накопление патогенного тау-белка в нейронах человека, полученных из индуцированных плюрипотентных стволовых клеток. J Neurosci. 2015; 35: 14234–50.

    CAS PubMed PubMed Central Google ученый

  • 105.

    Верхейен А., Дильс А., Дийкманс Дж., Ойэлами Т., Менегелло Дж., Мертенс Л. и др. Использование нейронов, полученных из ИПСК человека, для моделирования агрегации TAU. PLoS ONE. 2015; 10: e0146127.

    PubMed PubMed Central Google ученый

  • 106.

    Prots I, Grosch J, Brazdis RM, Simmnacher K, Veber V, Havlicek S и др. Олигомеры альфа-синуклеина вызывают раннюю аксональную дисфункцию в моделях синуклеинопатий, основанных на ИПСК человека. PNAS. 2018; 115: 7813–8.

    CAS PubMed PubMed Central Google ученый

  • 107.

    Silva MC, Cheng C, Mair W., Almeida S, Fong H, Biswas MHU и др. Нейрональная модель тау-A152T лобно-височной деменции, полученная из ИПСК человека, выявляет тау-опосредованные механизмы нейрональной уязвимости.Stem Cell Rep. 2016; 7: 325–40.

    CAS Google ученый

  • 108.

    Matamoros-Angles A, Gayosso LM, Richaud-Patin Y, di Domenico A, Vergara C, Hervera A, et al. Культуры iPS-клеток от пациента Герстманна-Штраусслера-Шейнкера с мутацией Y218N PRNP повторяют патологию тау-белка. Mol Neurobiol. 2018; 55: 3033–48.

    CAS PubMed Google ученый

  • 109.

    Jarosz-Griffiths HH, Corbett NJ, Rowland HA, Fisher K, Jones AC, Baron J, et al.Протеолитическое выделение прионного белка посредством активации металлопептидазы ADAM10 снижает клеточное связывание и токсичность олигомеров бета-амилоида. J Biol Chem. 2019; 294: 7085–97.

    CAS PubMed PubMed Central Google ученый

  • 110.

    Gribaudo S, Tixador P, Bousset L, Fenyi A, Lino P, Melki R, et al. Распространение штаммов альфа-синуклеина в реконструированной нейронной сети человека. Stem Cell Rep. 2019; 12: 230–44.

    CAS Google ученый

  • 111.

    Corbett GT, Wang Z, Hong W, Colom-Cadena M, Rose J, Liao M, et al. PrP играет центральную роль в токсичности, опосредованной растворимыми агрегатами белков, вызывающих нейродегенерацию. Acta Neuropathol. 2020; 139: 503–26.

    CAS PubMed Google ученый

  • 112.

    Lee HJ, Suk JE, Patrick C, Bae EJ, Cho JH, Rho S, et al. Прямой перенос альфа-синуклеина от нейрона к астроглии вызывает воспалительные реакции при синуклеинопатиях.J Biol Chem. 2010; 285: 9262–72.

    CAS PubMed PubMed Central Google ученый

  • 113.

    Линдстром В., Густафссон Г., Сандерс Л. Х., Хоулетт Е. Х., Сигвардсон Дж., Касраян А. и др. Обширное поглощение олигомеров альфа-синуклеина астроцитами приводит к устойчивым внутриклеточным отложениям и повреждению митохондрий. Mol Cell Neuro. 2017; 82: 143–56.

    Google ученый

  • 114.

    Braidy N, Gai WP, Xu YH, Sachdev P, Guillemin GJ, Jiang XM и др. Поглощение и митохондриальная дисфункция альфа-синуклеина в человеческих астроцитах, корковых нейронах и фибробластах. Transl Neuro. 2013; 2: 20.

    Google ученый

  • 115.

    Кавальере Ф, Серф Л., Дехай Б., Рамос-Гонсалес П., Де Джорджи Ф., Бурденкс М. и др. Нейротоксичность альфа-синуклеина in vitro и распространение среди нейронов и астроцитов с использованием экстрактов тельцов Леви из головного мозга при болезни Паркинсона.Neurobiol Dis. 2017; 103: 101–12.

    CAS PubMed Google ученый

  • 116.

    Hopp SC, Lin Y, Oakley D, Roe AD, DeVos SL, Hanlon D, et al. Роль микроглии в переработке и распространении биоактивных семян тау при болезни Альцгеймера. J Neuroinflam. 2018; 15: 269.

    Google ученый

  • 117.

    Луо В., Лю В., Ху Х, Ханна М., Каравака А., Пол С.М. Микроглиальная интернализация и деградация патологического тау-белка усиливаются моноклональными антителами против тау-белка.Научный доклад 2015; 5: 11161.

    PubMed PubMed Central Google ученый

  • 118.

    Martini-Stoica H, Cole AL, Swartzlander DB, Chen F, Wan YW, Bajaj L, et al. TFEB увеличивает поглощение астроглией внеклеточных видов тау и снижает распространение тау. J Exp Med. 2018; 215: 2355–77.

    CAS PubMed PubMed Central Google ученый

  • 119.

    Wyss-Coray T, Loike JD, Brionne TC, Lu E, Anankov R, Yan F, et al.Астроциты взрослых мышей разлагают бета-амилоид in vitro и in situ. Nat Med. 2003; 9: 453–7.

    CAS PubMed Google ученый

  • 120.

    Paresce DM, Ghosh RN, Maxfield FR. Клетки микроглии усваивают агрегаты бета-белка амилоида болезни Альцгеймера через рецептор-скавенджер. Нейрон. 1996; 17: 553–65.

    CAS PubMed Google ученый

  • 121.

    Pearce MMP, Spartz EJ, Hong W, Luo L, Kopito RR.Прионоподобная передача агрегатов нейронального хантинтина к фагоцитарной глии в головном мозге дрозофилы. Nat Commun. 2015; 6: 6768.

    CAS PubMed Google ученый

  • 122.

    Lin YT, Seo J, Gao F, Feldman HM, Wen HL, Penney J, et al. APOE4 вызывает широко распространенные молекулярные и клеточные изменения, связанные с фенотипами болезни Альцгеймера, в типах клеток мозга человека, происходящих от ИПСК. Нейрон. 2018; 98: 1141–54 e1147.

    CAS PubMed PubMed Central Google ученый

  • 123.

    Оксанен М., Петерсен А.Дж., Науменко Н., Путтонен К., Лехтонен С., Губерт Олив М. и др. Модель, полученная из ИПСК мутанта PSEN1, выявляет тяжелую патологию астроцитов при болезни Альцгеймера. Stem Cell Rep. 2017; 9: 1885–97.

    CAS Google ученый

  • 124.

    Фонг Л.К., Ян М.М., дос Сантос Чавес Р., Рейна С.М., Лангнесс В.Ф., Вудрафф Г. и др. Белок-предшественник амилоида полной длины регулирует метаболизм липопротеинов и клиренс бета-амилоида в астроцитах человека.J Biol Chem. 2018; 293: 11341–57.

    CAS PubMed PubMed Central Google ученый

  • 125.

    Лоренцини И., Олсоп Е., Леви Дж., Гиттингс Л.М., Рабичоу Б.Е., Лалл Д. и др. Активированная ИПСК-микроглия пациентов с БАС / ЛТД C9orf72 демонстрирует эндосомно-лизосомную дисфункцию. bioRxiv. 2020: 277459.

  • 126.

    Ростами Дж., Холмквист С., Линдстром В., Сигвардсон Дж., Вестермарк Г. Т., Ингельссон М. и др. Человеческие астроциты переносят агрегированный альфа-синуклеин через туннельные нанотрубки.J Neurosci. 2017; 37: 11835–53.

    CAS PubMed PubMed Central Google ученый

  • 127.

    Krejciova Z, Alibhai J, Zhao C, Krencik R, Rzechorzek NM, Ullian EM, et al. Астроциты, полученные из стволовых клеток человека, реплицируют человеческие прионы в зависимости от генотипа PRNP. J Exp Med. 2017; 214: 3481–95.

    CAS PubMed PubMed Central Google ученый

  • 128.

    Israel MA, Yuan SH, Bardy C, Reyna SM, Mu Y, Herrera C, et al. Исследование спорадической и семейной болезни Альцгеймера с использованием индуцированных плюрипотентных стволовых клеток. Природа. 2012; 482: 216–20.

    CAS PubMed PubMed Central Google ученый

  • 129.

    Очалек А., Михалик Б., Авчи НХ, Чандрасекаран А., Тегласи А., Бок И. и др. Нейроны, полученные из спорадических ИПСК болезни Альцгеймера, обнаруживают повышенное гиперфосфорилирование TAU, повышенные уровни амилоида и активацию GSK3B.Alzheimer’s Res Ther. 2017; 9: 90.

    Google ученый

  • 130.

    Фудзимори К., Исикава М., Отомо А., Ацута Н., Накамура Р., Акияма Т. и др. Моделирование спорадического БАС в двигательных нейронах, происходящих от ИПСК, позволяет определить потенциальный терапевтический агент. Nat Med. 2018; 24: 1579–89.

    CAS PubMed Google ученый

  • 131.

    Miguel L, Rovelet-Lecrux A, Feyeux M, Frebourg T., Nassoy P, Campion D, et al.Обнаружение всех взрослых изоформ тау-белка в трехмерной культуральной модели нейронов, полученных из ИПСК. Stem Cell Res. 2019; 40: 101541.

    CAS PubMed Google ученый

  • 132.

    Studer L, Vera E, Cornacchia D. Программирование и перепрограммирование клеточного возраста в эпоху индуцированной плюрипотентности. Стволовая клетка клетки. 2015; 16: 591–600.

    CAS PubMed PubMed Central Google ученый

  • 133.

    Вегманн С., Беннетт Р.Э., Делорм Л., Роббинс А.Б., Ху М., Маккензи Д. и др. Экспериментальные доказательства возрастной зависимости распространения тау-белка в головном мозге. Sci Adv. 2019; 5: eaaw6404.

    CAS PubMed PubMed Central Google ученый

  • 134.

    Некрасов Е.Д., Вигонт В.А., Клюшников С.А., Лебедева О.С., Васина Е.М., Богомазова А.Н. и др. Проявление патологии болезни Хантингтона в нейронах, полученных из плюрипотентных стволовых клеток, индуцированных человеком.Mol Neurodegen. 2016; 11:27.

    Google ученый

  • 135.

    Миллер Дж. Д., Ганат Ю. М., Кишиневский С., Боуман Р. Л., Лю Б., Ту Е. Ю. и др. Моделирование позднего начала заболевания на основе ИПСК человека через старение, индуцированное прогерином. Стволовая клетка клетки. 2013; 13: 691–705.

    CAS PubMed PubMed Central Google ученый

  • 136.

    Vierbuchen T, Ostermeier A, Pang ZP, Kokubu Y, Sudhof TC, Wernig M.Прямое преобразование фибробластов в функциональные нейроны определенными факторами. Природа. 2010; 463: 1035–41.

    CAS PubMed PubMed Central Google ученый

  • 137.

    Пфистерер Ю., Киркеби А., Торпер О, Вуд Дж., Неландер Дж., Дюфур А. и др. Прямое преобразование человеческих фибробластов в дофаминергические нейроны. PNAS. 2011; 108: 10343–8.

    CAS PubMed PubMed Central Google ученый

  • 138.

    Caiazzo M, Dell’Anno MT, Dvoretskova E, Lazarevic D, Taverna S, Leo D, et al. Прямая генерация функциональных дофаминергических нейронов из фибробластов мыши и человека. Природа. 2011; 476: 224–7.

    CAS Google ученый

  • 139.

    Абернати Д.Г., Ким В.К., Маккой М.Дж., Лейк А.М., Оувенга Р., Ли С.В. и др. МикроРНК индуцируют пермиссивную среду хроматина, которая позволяет нейрональному подтипу репрограммировать фибробласты взрослого человека.Стволовая клетка клетки. 2017; 21: 332–48 e339.

    CAS PubMed PubMed Central Google ученый

  • 140.

    Виктор М.Б., Ричнер М., Олсен Х.Э., Ли С.В., Монтейс А.М., Ма С. и др. Стриарные нейроны, непосредственно преобразованные из фибробластов пациентов с болезнью Хантингтона, воспроизводят возрастные фенотипы заболевания. Nat Neurosci. 2018; 21: 341–52.

    CAS PubMed PubMed Central Google ученый

  • 141.

    Буркхардт М.Ф., Мартинес Ф.Дж., Райт С., Рамос С., Вольфсон Д., Мейсон М. и др. Клеточная модель спорадического БАС с использованием индуцированных пациентами плюрипотентных стволовых клеток. Mol Cell Neurosci. 2013; 56: 355–64.

    CAS PubMed PubMed Central Google ученый

  • 142.

    Арбер С., Лавджой С., Рэй С. Модели стволовых клеток болезни Альцгеймера: прогресс и проблемы. Alzheimer’s Res Ther. 2017; 9: 42.

    Google ученый

  • 143.

    Wu JW, Hussaini SA, Bastille IM, Rodriguez GA, Mrejeru A, Rilett K, et al. Активность нейронов усиливает распространение тау-белка и патологию тау-белка in vivo. Nat Neurosci. 2016; 19: 1085–92.

    CAS PubMed PubMed Central Google ученый

  • 144.

    Ямада К., Холт Дж. К., Ляо Ф., Стюарт Ф. Р., Махан Т. Е., Цзян Х. и др. Активность нейронов регулирует внеклеточный тау in vivo. J Exp Med. 2014; 211: 387–93.

    CAS PubMed PubMed Central Google ученый

  • 145.

    Пигнатаро А., Миддей С. Транссинаптическое распространение бета-амилоида при болезни Альцгеймера: пути к бета-амилоидозу. Neural Plast. 2017; 2017: 5281829.

    PubMed PubMed Central Google ученый

  • 146.

    Фортин Д.Л., Немани В.М., Фоглмайер С.М., Энтони М.Д., Райан Т.А., Эдвардс Р.Х. Нервная активность контролирует синаптическое накопление альфа-синуклеина. J Neurosci. 2005; 25: 10913–21.

    CAS PubMed PubMed Central Google ученый

  • 147.

    Paillusson S, Clairembault T., Biraud M, Neunlist M, Derkinderen P. Зависимая от активности секреция альфа-синуклеина кишечными нейронами. J Neurochem. 2013; 125: 512–7.

    CAS PubMed Google ученый

  • 148.

    Пулер AM, Phillips EC, Lau DH, Noble W, Hanger DP. Физиологическое высвобождение эндогенного тау стимулируется нейрональной активностью. EMBO Rep. 2013; 14: 389–94.

    CAS PubMed PubMed Central Google ученый

  • 149.

    Calafate S, Buist A, Miskiewicz K, Vijayan V, Daneels G, de Strooper B и др. Синаптические контакты усиливают распространение патологии тау-белка от клетки к клетке. Cell Rep. 2015; 11: 1176–83.

    CAS PubMed Google ученый

  • 150.

    Пруунсилд П., Бенгтсон С.П., Бадинг Х. Сети культивированных нейронов, полученных из ИПСК, раскрывают человеческую программу адаптивных генов, регулируемую синаптической активностью. Cell Rep. 2017; 18: 122–35.

    CAS PubMed PubMed Central Google ученый

  • 151.

    Amin H, Maccione A, Marinaro F, Zordan S, Nieus T., Berdondini L. Электрические реакции и спонтанная активность нейронных сетей, полученных из iPS человека, охарактеризованных для 3-месячного культивирования с помощью массивов из 4096 электродов. Front Neurosci. 2016; 10: 121.

    CAS PubMed PubMed Central Google ученый

  • 152.

    Zhang Y, Pak C, Han Y, Ahlenius H, Zhang Z, Chanda S, et al. Быстрая одностадийная индукция функциональных нейронов из плюрипотентных стволовых клеток человека.Нейрон. 2013; 78: 785–98.

    CAS PubMed PubMed Central Google ученый

  • 153.

    Nehme R, Zuccaro E, Ghosh SD, Li C, Sherwood JL, Pietilainen O, et al. Комбинирование программирования NGN2 с формированием паттерна развития генерирует возбуждающие нейроны человека с синаптической передачей, опосредованной NMDAR. Cell Rep.2018; 23: 2509–23.

    CAS PubMed PubMed Central Google ученый

  • 154.

    Koppensteiner P, Boehm S, Arancio O. Электрофизиологические профили индуцированных нейронов, преобразованных непосредственно из фибробластов взрослого человека, указывают на неполное преобразование нейронов. Перепрограммирование клеток. 2014; 16: 439–46.

    CAS PubMed PubMed Central Google ученый

  • 155.

    Drouin-Ouellet J, Lau S, Brattas PL, Rylander Ottosson D, Pircs K, Grassi DA, et al. Подавление REST опосредует нейронную конверсию фибробластов взрослого человека через микроРНК-зависимые и независимые пути.EMBO Mol Med. 2017; 9: 1117–31.

    CAS PubMed PubMed Central Google ученый

  • 156.

    Сюэ Y, Qian H, Hu J, Zhou B, Zhou Y, Hu X и ​​др. Последовательные регуляторные петли как ключевые привратники для перепрограммирования нейронов в клетках человека. Nat Neurosci. 2016; 19: 807–15.

    CAS PubMed PubMed Central Google ученый

  • 157.

    de Rus Jacquet A, Tancredi JL, Lemire AL, DeSantis MC, Li W-P, O’Shea EK.Мутация LRRK2 G2019S изменяет связь астроцита с нейроном через внеклеточные везикулы и вызывает атрофию нейронов в модели болезни Паркинсона, полученной из ИПСК человека. bioRxiv. 2020: 178574.

  • 158.

    Биргер А., Бен-Дор И., Оттоленги М., Турецкий Т., Гил Ю., Свитат С. и др. Астроциты, полученные из ИПСК человека от пациентов с БАС с мутированным C9ORF72, демонстрируют повышенный окислительный стресс и нейротоксичность. EBioMedicine. 2019; 50: 274–89.

    PubMed PubMed Central Google ученый

  • 159.

    Чандрасекаран А., Авчи Х., Лейст М., Коболак Дж., Диннес А. Дифференциация астроцитов плюрипотентных стволовых клеток человека: новые инструменты для исследования неврологических расстройств. Front Cell Neurosci. 2016; 10: 215.

    PubMed PubMed Central Google ученый

  • 160.

    de Rus Jacquet A. Получение и совместное культивирование дофаминергических нейронов и астроцитов, полученных из ipsc. Curr Protoc Cell Biol. 2019; 85: e98.

    PubMed Google ученый

  • 161.

    Tcw J, Wang M, Pimenova AA, Bowles KR, Hartley BJ, Lacin E, et al. Эффективная платформа для дифференциации астроцитов из индуцированных человеком плюрипотентных стволовых клеток. Stem Cell Rep. 2017; 9: 600–14.

    CAS Google ученый

  • 162.

    Li X, Tao Y, Bradley R, Du Z, Tao Y, Kong L, et al. Быстрая генерация функциональных астроцитов подтипа из плюрипотентных стволовых клеток человека. Stem Cell Rep. 2018; 11: 998–1008.

    CAS Google ученый

  • 163.

    Хедегаард А, Монзон-Сандовал Дж, Ньюи С.Е., Уайтли Е.С., Уэббер С., Акерман С.Дж. Эффекты созревания корковых астроцитов, полученных из ИПСК человека, на корковые нейроны, полученные из ИПСК. Stem Cell Rep. 2020; 15: 38–51.

    CAS Google ученый

  • 164.

    Вольпато В., Уэббер С. Устранение изменчивости в моделях болезней человека, полученных с помощью ИПСК: руководящие принципы для повышения воспроизводимости. Dis Model Mech. 2020; 13: dmm042317.

    CAS PubMed PubMed Central Google ученый

  • 165.

    Шварцентрубер Дж., Фосколоу С., Килпинен Х., Родригес Дж., Аласоо К., Найтс А.Дж. и др. Молекулярные и функциональные вариации сенсорных нейронов, производных ИПСК. Нат Жене. 2018; 50: 54–61.

    CAS PubMed Google ученый

  • 166.

    Баррос С.С., Франко С.Дж., Мюллер У. Внеклеточный матрикс: функции в нервной системе. Cold Spring Harb Perspect Biol. 2011; 3: a005108.

    PubMed PubMed Central Google ученый

  • 167.

    Spampinato SF, Bortolotto V, Canonico PL, Sortino MA, Grilli M. Паракринные сигналы, полученные из астроцитов: актуальность для регуляции нейрогенных ниш и целостности гематоэнцефалического барьера. Front Pharm. 2019; 10: 1346.

    CAS Google ученый

  • 168.

    Корнберг Т.Б., Рой С. Общение с помощью сенсорных нейронов не только. Trends Cell Biol. 2014; 24: 370–6.

    PubMed PubMed Central Google ученый

  • 169.

    Луо К., Ланкастер Массачусетс, Кастанон Р., Нери Дж. Р., Кноблих Дж. А., Эккер Дж. Церебральные органоиды воспроизводят эпигеномные сигнатуры головного мозга человека. Cell Rep. 2016; 17: 3369–84.

    CAS PubMed PubMed Central Google ученый

  • 170.

    Pievani M, Filippini N, van den Heuvel MP, Cappa SF, Frisoni GB. Связность мозга при нейродегенеративных заболеваниях - от фенотипа до протеинопатии. Nat Rev Neurol. 2014; 10: 620–33.

    PubMed Google ученый

  • 171.

    Vargas-Valderrama A, Messina A, Mitjavila-Garcia MT, Guenou H. Эндотелий, ключевой участник в развитии органов и васкуляризации органоидов, производных hPSC. J Biomed Sci. 2020; 27: 67.

    PubMed PubMed Central Google ученый

  • 172.

    Pham MT, Pollock KM, Rose MD, Cary WA, Stewart HR, Zhou P, et al. Генерация васкуляризированных органоидов головного мозга человека. Нейроотчет. 2018; 29: 588–93.

    PubMed PubMed Central Google ученый

  • 173.

    Cakir B, Xiang Y, Tanaka Y, Kural MH, Parent M, Kang YJ, et al. Конструирование органоидов головного мозга человека с функциональной сосудистой системой. Нат методы. 2019; 16: 1169–75.

    CAS PubMed PubMed Central Google ученый

  • 174.

    Worsdorfer P, Dalda N, Kern A, Kruger S, Wagner N, Kwok CK, et al. Создание сложных моделей органоидов человека, включая сосудистые сети, путем включения мезодермальных клеток-предшественников.Научный доклад 2019; 9: 15663.

    PubMed PubMed Central Google ученый

  • 175.

    Гребенюк С., Ранга А. Инженерная васкуляризация органоидов. Фронт Bioeng Biotechnol. 2019; 7:39.

    PubMed PubMed Central Google ученый

  • 176.

    Монцель А.С., Смитс Л.М., Хеммер К., Хачи С., Морено Е.Л., ван Вуэллен Т. и др. Получение органоидов среднего мозга человека из нейроэпителиальных стволовых клеток.Stem Cell Rep. 2017; 8: 1144–54.

    CAS Google ученый

  • 177.

    Кэмп Дж. Г., Бадша Ф., Флорио М., Кантон С., Гербер Т., Вильш-Браунингер М. и др. Органоиды головного мозга человека повторяют программы экспрессии генов развития неокортекса плода. PNAS. 2015; 112: 15672–7.

    CAS PubMed PubMed Central Google ученый

  • 178.

    Lancaster MA, Renner M, Martin CA, Wenzel D, Bicknell LS, Hurles ME, et al.Церебральные органоиды моделируют развитие человеческого мозга и микроцефалию. Природа. 2013; 501: 373–9.

    CAS PubMed PubMed Central Google ученый

  • 179.

    Pasca AM, Sloan SA, Clarke LE, Tian Y, Makinson CD, Huber N, et al. Функциональные нейроны коры и астроциты из плюрипотентных стволовых клеток человека в 3D-культуре. Нат методы. 2015; 12: 671–8.

    CAS PubMed PubMed Central Google ученый

  • 180.

    Marton RM, Miura Y, Sloan SA, Li Q, Revah O, Levy RJ и др. Дифференциация и созревание олигодендроцитов в трехмерных нейронных культурах человека. Nat Neurosci. 2019; 22: 484–91.

    CAS PubMed PubMed Central Google ученый

  • 181.

    Цянь X, Сун Х, Мин ГЛ. Органоиды мозга: достижения, приложения и проблемы. Разработка. 2019; 146: dev166074.

    CAS PubMed PubMed Central Google ученый

  • 182.

    Ormel PR, Vieira de Sa R, van Bodegraven EJ, Karst H, Harschnitz O, Sneeboer MAM, et al. Микроглия врожденно развивается внутри церебральных органоидов. Nat Commun. 2018; 9: 4167.

    PubMed PubMed Central Google ученый

  • 183.

    Groveman BR, Foliaki ST, Orru CD, Zanusso G, Carroll JA, Race B, et al. Спорадическая прионная инфекция церебральных органоидов человека при болезни Крейтцфельдта-Якоба. Acta Neuropathol Commun. 2019; 7: 90.

    PubMed Google ученый

  • 184.

    Xiang Y, Tanaka Y, Patterson B., Kang YJ, Govindaiah G, Roselaar N, et al. Слияние органоидов, происходящих из локально определенных hPSC, моделирует развитие человеческого мозга и миграцию интернейронов. Стволовая клетка клетки. 2017; 21: 383–98 e387.

    CAS PubMed PubMed Central Google ученый

  • 185.

    Бэгли Дж. А., Рейман Д., Биан С., Леви-Стросс Дж., Кноблих Дж. А.. Слитые церебральные органоиды моделируют взаимодействия между областями мозга. Нат методы.2017; 14: 743–51.

    CAS PubMed PubMed Central Google ученый

  • 186.

    Bolhaqueiro ACF, van Jaarsveld RH, Ponsioen B, Overmeer RM, Snippert HJ, Kops G. Живое изображение деления клеток в трехмерных культурах органоидов стволовых клеток. Методы Cell Biol. 2018; 145: 91–106.

    CAS PubMed Google ученый

  • 187.

    Берштейн М., Новаковски Т.Дж., Пыльца А.А., Ди Лулло Э., Нене А., Виншоу-Борис А. и др.Церебральные органоиды, полученные из ИПСК человека, моделируют клеточные особенности лиссэнцефалии и выявляют длительный митоз наружной радиальной глии. Стволовая клетка клетки. 2017; 20: 435–49 e434.

    CAS PubMed PubMed Central Google ученый

  • 188.

    Браун А.В., Арнезано К., Арутюнян Н., Хуу Т., Мартинес Дж. К., Поллак Н.А. и др. Структурная и функциональная характеристика органоидов сетчатки, полученных из стволовых клеток человека, с помощью визуализации в реальном времени. Инвестируйте Ophthalmol Vis Sci.2017; 58: 3311–8.

    CAS PubMed PubMed Central Google ученый

  • 189.

    Held M, Santeramo I, Wilm B, Murray P., Levy R. Отслеживание живых клеток ex vivo в органоидах почек с использованием световой флуоресцентной микроскопии. PLoS ONE. 2018; 13: e0199918.

    PubMed PubMed Central Google ученый

  • 190.

    Andilla J, Jorand R, Olarte OE, Dufour AC, Cazales M, Montagner YL, et al.Имитация тканей с помощью световой микроскопии: сравнительные рекомендации. Научный доклад 2017; 7: 44939.

    CAS PubMed PubMed Central Google ученый

  • 191.

    Деккерс Дж. Ф., Алиева М., Велленс Л. М., Ариезе HCR, Джеймисон П. Р., Вонк А. М. и др. Трехмерное изображение фиксированных и очищенных органоидов в высоком разрешении. Nat Protoc. 2019; 14: 1756–71.

    CAS PubMed PubMed Central Google ученый

  • 192.

    Вольпичелли-Дейли Л.А., Лук К.С., Патель Т.П., Таник С.А., Риддл Д.М., Стибер А. и др. Экзогенные фибриллы альфа-синуклеина вызывают патологию с тельцами Леви, ведущую к синаптической дисфункции и гибели нейронов. Нейрон. 2011; 72: 57–71.

    CAS PubMed PubMed Central Google ученый

  • 193.

    Нобухара С.К., ДеВос С.Л., Комминс С., Вегманн С., Мур Б.Д., Роу А.Д. и др. Тау-антитела, нацеленные на патологические виды, блокируют нейрональное поглощение и интернейронное распространение тау-белка in vitro.Am J Pathol. 2017; 187: 1399–412.

    CAS PubMed PubMed Central Google ученый

  • 194.

    Tran HT, Chung CH, Iba M, Zhang B, Trojanowski JQ, Luk KC, et al. Иммунотерапия альфа-синуклеином блокирует поглощение и шаблонное распространение неправильно свернутого альфа-синуклеина и нейродегенерацию. Cell Rep. 2014; 7: 2054–65.

    CAS PubMed PubMed Central Google ученый

  • 195.

    Чеонг Р., Паливал С., Левченко А. Скрининг высокого содержания в микрофлюидных устройствах. Экспертное мнение о наркотиках Discov. 2010; 5: 715–20.

    CAS PubMed PubMed Central Google ученый

  • 196.

    Freundt EC, Maynard N, Clancy EK, Roy S, Bousset L, Sourigues Y, et al. Передача фибрилл альфа-синуклеина от нейрона к нейрону через аксональный транспорт. Энн Нейрол. 2012; 72: 517–24.

    CAS PubMed PubMed Central Google ученый

  • 197.

    Takeda S, Wegmann S, Cho H, DeVos SL, Commins C, Roe AD, et al. Поглощение нейронами и размножение редкого фосфорилированного высокомолекулярного тау-белка, полученного из головного мозга при болезни Альцгеймера. Nat Commun. 2015; 6: 8490.

    CAS PubMed Google ученый

  • 198.

    Dujardin S, Lecolle K, Caillierez R, Begard S, Zommer N, Lachaud C, et al. Перенос тау-белка дикого типа от нейрона к нейрону через транс-синаптический механизм: актуальность для спорадических таупатий.Acta Neuropathol Commun. 2014; 2: 14.

    PubMed PubMed Central Google ученый

  • 199.

    Pal A, Glass H, Naumann M, Kreiter N, Japtok J, Sczech R, et al. Оборот органелл с высоким содержанием позволяет профилировать болезненное состояние как мощный инструмент для моделирования заболеваний. Научные данные. 2018; 5: 180241.

    CAS PubMed PubMed Central Google ученый

  • 200.

    Левандовска М.К., Радивоевич М., Джекель Д., Мюллер Дж., Хирлеманн А.Р.Корковые аксоны, изолированные в каналах, демонстрируют зависимую от активности модуляцию сигнала в результате направленной стимуляции. Front Neurosci. 2016; 10: 83.

    PubMed PubMed Central Google ученый

  • 201.

    Бухари Х., Мюллер Т. Эндогенное флуоресцентное мечение с помощью CRISPR. Trends Cell Biol. 2019; 29: 912–28.

    CAS PubMed Google ученый

  • 202.

    Pickar-Oliver A, Gersbach CA.Новое поколение технологий и приложений CRISPR-Cas. Nat Rev Mol Cell Biol. 2019; 20: 490–507.

    CAS PubMed PubMed Central Google ученый

  • 203.

    Адли М. Набор инструментов CRISPR для редактирования генома и не только. Nat Commun. 2018; 9: 1911.

    PubMed PubMed Central Google ученый

  • 204.

    Kaczmarczyk L, Mende Y, Zevnik B, Jackson WS.Управление последовательностью гена прионного белка и уровнями экспрессии с помощью CRISPR / Cas9. PLoS ONE. 2016; 11: e0154604.

    PubMed PubMed Central Google ученый

  • 205.

    Chen JJ, Nathaniel DL, Raghavan P, Nelson M, Tian R, Tse E, et al. Нарушение функции пути ESCRT способствует эндолизосомному ускользанию семян тау и распространению агрегации тау. J Biol Chem. 2019; 294: 18952–66.

    CAS PubMed PubMed Central Google ученый

  • 206.

    Rice AM, McLysaght A. Гены, чувствительные к дозировке, в эволюции и болезни. BMC Biol. 2017; 15:78.

    PubMed PubMed Central Google ученый

  • 207.

    Бэ Э.Дж., Ян Нью-Йорк, Сонг М., Ли С.С., Ли Дж.С., Юнг BC и др. Истощение запасов глюкоцереброзидазы усиливает передачу альфа-синуклеина от клетки к клетке. Nat Commun. 2014; 5: 4755.

    CAS PubMed Google ученый

  • 208.

    Кампманн М. Скрининг CRISPRi и CRISPRa в клетках млекопитающих для точной биологии и медицины. ACS Chem Biol. 2018; 13: 406–16.

    CAS PubMed Google ученый

  • 209.

    Stanek LM, Sardi SP, Mastis B, Richards AR, Treleaven CM, Taksir T, et al. Подавление мутантного хантингтина за счет РНК-интерференции, опосредованной аденоассоциированным вирусом, улучшает проявления болезни в модели болезни Хантингтона на мышах YAC128. Hum Gene Ther.2014; 25: 461–74.

    CAS PubMed PubMed Central Google ученый

  • 210.

    Xu X, Tay Y, Sim B, Yoon SI, Huang Y, Ooi J, et al. Обращение фенотипических аномалий с помощью CRISPR / Cas9-опосредованной генной коррекции в плюрипотентных стволовых клетках, индуцированных пациентом при болезни Хантингтона. Stem Cell Rep. 2017; 8: 619–33.

    CAS Google ученый

  • 211.

    Чен Ю., Долт К.С., Крик М., Бейкер Т., Дауни П., Драммонд Н.Дж. и др.Конструирование устойчивых к синуклеинопатии дофаминергических нейронов человека путем CRISPR-опосредованной делеции гена SNCA. Eur J Neurosci. 2019; 49: 510–24.

    PubMed Google ученый

  • 212.

    Халльманн А.Л., Араузо-Браво М.Дж., Мавромматис Л., Эрлих М., Ропке А., Брокхаус Дж. И др. Патология астроцитов в модели лобно-височной деменции человека нервными стволовыми клетками, вызванная мутантным белком TAU. Научный доклад 2017; 7: 42991.

    PubMed PubMed Central Google ученый

  • 213.

    Heman-Ackah SM, Manzano R, Hoozemans JJM, Scheper W, Flynn R, Haerty W. и др. Альфа-синуклеин индуцирует ответ развернутого белка в нейронах, происходящих от ИПСК, при трипликации SNCA при болезни Паркинсона. Hum Mol Genet. 2017; 26: 4441–50.

    CAS PubMed PubMed Central Google ученый

  • 214.

    Soldner F, Laganiere J, Cheng AW, Hockemeyer D, Gao Q, Alagappan R, et al. Генерация изогенных плюрипотентных стволовых клеток, различающихся исключительно двумя ранними точечными мутациями Паркинсона.Клетка. 2011; 146: 318–31.

    CAS PubMed PubMed Central Google ученый

  • 215.

    Рейнхардт П., Шмид Б., Бурбулла Л.Ф., Шондорф Д.К., Вагнер Л., Глатца М. и др. Генетическая коррекция мутации LRRK2 в ИПСК человека связывает паркинсоническую нейродегенерацию с ERK-зависимыми изменениями экспрессии генов. Стволовая клетка клетки. 2013; 12: 354–67.

    CAS PubMed Google ученый

  • 216.

    Jackow J, Guo Z, Hansen C, Abaci HE, Doucet YS, Shin JU и др. Целевое редактирование генома на основе CRISPR / Cas9 для коррекции рецессивного дистрофического буллезного эпидермолиза с использованием iPS-клеток. PNAS. 2019; 116: 26846–52.

    CAS PubMed Central Google ученый

  • 217.

    Li XL, Li GH, Fu J, Fu YW, Zhang L, Chen W. и др. Высокоэффективное редактирование генома с помощью CRISPR-Cas9 в плюрипотентных стволовых клетках человека достигается за счет временной сверхэкспрессии BCL-XL.Nucleic Acids Res. 2018; 46: 10195–215.

    CAS PubMed PubMed Central Google ученый

  • 218.

    Vakulskas CA, Dever DP, Rettig GR, Turk R, Jacobi AM, Collingwood MA, et al. Высококачественный мутант Cas9, доставляемый в виде рибонуклеопротеинового комплекса, обеспечивает эффективное редактирование генов в гемопоэтических стволовых клетках и клетках-предшественниках. Nat Med. 2018; 24: 1216–24.

    CAS PubMed PubMed Central Google ученый

  • 219.

    Prusiner SB. Молекулярная биология прионных болезней. Наука. 1991; 252: 1515–22.

    CAS PubMed Google ученый

  • 220.

    Макрину Э., Коллиндж Дж., Антониу М. Геномная характеристика локуса гена прионного белка человека (PrP). Мамм Геном. 2002; 13: 696–703.

    CAS PubMed Google ученый

  • 221.

    Schmitz M, Lullmann K, Zafar S, Ebert E, Wohlhage M, Oikonomou P, et al.Ассоциация генотипа прионного белка и типа прионного белка скрепи с профилями изоформ заряда клеточного прионного белка в спинномозговой жидкости людей со спорадическими или семейными прионными заболеваниями. Neurobiol Aging. 2014; 35: 1177–88.

    CAS PubMed Google ученый

  • 222.

    Яннопулос П.Н., Робертсон К., Йодоин Дж., Паудель Х., Бут С.А., Леблан А.С. Фосфорилирование прионного белка по серину 43 вызывает изменение конформации прионного белка.J Neurosci. 2009; 29: 8743–51.

    CAS PubMed PubMed Central Google ученый

  • 223.

    Parchi P, Chen SG, Brown P, Zou W, Capellari S, Budka H, ​​et al. Различные образцы укороченных фрагментов прионного белка коррелируют с различными фенотипами при болезни Герстмана-Штраусслера-Шейнкера P102L. PNAS. 1998. 95: 8322–7.

    CAS PubMed PubMed Central Google ученый

  • 224.

    Байарди С., Росси М., Капеллари С., Парчи П. Последние достижения в гистомолекулярной патологии прионной болезни человека. Brain Pathol. 2019; 29: 278–300.

    PubMed Google ученый

  • 225.

    Чжун К., Конгдон Е.Е., Нагараджа Х.Н., Курет Дж. Изоформный состав тау влияет на скорость и степень образования филаментов. J Biol Chem. 2012; 287: 20711–9.

    CAS PubMed PubMed Central Google ученый

  • 226.

    Хефти М.М., Фаррелл К., Ким С., Боулз К.Р., Фаукс М.Э., Радж Т. и др. Временное и региональное картирование с высоким разрешением экспрессии и сплайсинга MAPT в развитии человеческого мозга. PLoS ONE. 2018; 13: e0195771.

    PubMed PubMed Central Google ученый

  • 227.

    Lacovich V, Espindola SL, Alloatti M, Pozo Devoto V, Cromberg LE, Carna ME, et al. Дисбаланс изоформ тау нарушает аксональный транспорт белка-предшественника амилоида в нейронах человека.J Neurosci. 2017; 37: 58–69.

    CAS PubMed PubMed Central Google ученый

  • 228.

    Liu C, Gotz J. Профилирование мышиного тау-белка с помощью антител, специфичных для изоформ 0N, 1N и 2N, в головном мозге и периферических органах выявляет четкую субклеточную локализацию, при этом изоформа 1N обогащена в ядре. PLoS ONE. 2013; 8: e84849.

    PubMed PubMed Central Google ученый

  • 229.

    Neddens J, Temmel M, Flunkert S, Kerschbaumer B, Hoeller C, Loeffler T. и др. Фосфорилирование различных сайтов тау во время прогрессирования болезни Альцгеймера. Acta Neuropathol Commun. 2018; 6: 52.

    PubMed PubMed Central Google ученый

  • 230.

    Эркан-Хербст Э., Эриг Дж., Шондорф Д.К., Берендт А., Клаус Б., Гомес Рамос Б. и др. Сигнатура посттрансляционной модификации определяет изменения растворимого тау-белка, коррелирующие с олигомеризацией в головном мозге на ранней стадии болезни Альцгеймера.Acta Neuropathol Commun. 2019; 7: 192.

    CAS PubMed PubMed Central Google ученый

  • 231.

    Кацумото А., Такеучи Х., Танака Ф. Патология тау при хронической травматической энцефалопатии и болезни Альцгеймера: сходства и различия. Фронт Neurol. 2019; 10: 980.

    PubMed PubMed Central Google ученый

  • 232.

    Бартелеми Н.Р., Бейтман Р.Дж., Хиртц С., Марин П., Бехер Ф., Сато С. и др.Фосфо-тау Т217 в спинномозговой жидкости превосходит Т181 в качестве биомаркера для дифференциальной диагностики болезни Альцгеймера и идентификации пациентов с положительным амилоидом при помощи ПЭТ. Alzheimer’s Res Ther. 2020; 12:26.

    CAS Google ученый

  • 233.

    Бартелеми Н.Р., Маллипедди Н., Моисеев П., Сато С., Бейтман Р.Дж. Скорости фосфорилирования тау-белка, измеренные с помощью масс-спектрометрии, различаются в компартментах внутриклеточного мозга и внеклеточной спинномозговой жидкости, и на них по-разному влияет болезнь Альцгеймера.Front Aging Neurosci. 2019; 11: 121.

    CAS PubMed PubMed Central Google ученый

  • 234.

    Vuono R, Winder-Rhodes S, de Silva R, Cisbani G, Drouin-Ouellet J, Network RIotEHsD. и другие. Роль тау в патологическом процессе и клиническом проявлении болезни Хантингтона. Головной мозг. 2015; 138 (Pt 7): 1907–18.

    PubMed PubMed Central Google ученый

  • 235.

    Bamburg JR, Bernstein BW, Davis RC, Flynn KC, Goldsbury C, Jensen JR, et al. ADF / Cofilin-actin палочки при нейродегенеративных заболеваниях. Curr Alzheimer Res. 2010; 7: 241–50.

    CAS PubMed PubMed Central Google ученый

  • 236.

    Spillantini MG, Goedert M, Crowther RA, Murrell JR, Farlow MR, Ghetti B. Семейная множественная системная таупатия с пресенильной деменцией: заболевание с обильными нейронными и глиальными тау-филаментами.PNAS. 1997. 94: 4113–8.

    CAS PubMed PubMed Central Google ученый

  • 237.

    Феррер И., Лопес-Гонсалес И., Кармона М., Арреги Л., Дальфо Е., Торрехон-Эскрибано Б. и др. Глиальная и нейрональная тау-патология при таупатиях: характеристика фенотипов, специфичных для заболевания, и прогрессирование тау-патологии. J Neuropathol Exp Neurol. 2014; 73: 81–97.

    CAS PubMed Google ученый

  • 238.

    Strang KH, Golde TE, Giasson BI. Мутации MAPT, таупатия и механизмы нейродегенерации. Lab Invest. 2019; 99: 912–28.

    PubMed PubMed Central Google ученый

  • 239.

    Leong YQ, Ng KY, Chye SM, Ling APK, Koh RY. Механизмы действия бета-амилоида и его белка-предшественника на гибель нейрональных клеток. Metab Brain Dis. 2020; 35: 11–30.

    PubMed Google ученый

  • 240.

    Rezaei-Ghaleh N, Amininasab M, Kumar S, Walter J, Zweckstetter M. Фосфорилирование изменяет молекулярную стабильность бета-амилоидных отложений. Nat Commun. 2016; 7: 11359.

    CAS PubMed PubMed Central Google ученый

  • 241.

    Кумар С., Виртс О., Стубер К., Вундерлих П., Кох П., Тейл С. и др. Фосфорилирование амилоидного бета-пептида по Ser26 стабилизирует сборку олигомеров и увеличивает нейротоксичность. Acta Neuropathol.2016; 131: 525–37.

    CAS PubMed PubMed Central Google ученый

  • 242.

    Thal DR, Walter J, Saido TC, Fandrich M. Невропатология и биохимия Abeta и ее совокупностей при болезни Альцгеймера. Acta Neuropathol. 2015; 129: 167–82.

    CAS PubMed Google ученый

  • 243.

    Takahashi RH, Nagao T, Gouras GK. Образование бляшек и внутринейрональное накопление бета-амилоида при болезни Альцгеймера.Pathol Int. 2017; 67: 185–93.

    CAS PubMed Google ученый

  • 244.

    Bassil F, Brown HJ, Pattabhiraman S, Iwasyk JE, Maghames CM, Meymand ES, et al. Бляшки амилоид-бета (Abeta) способствуют посеву и распространению альфа-синуклеина и тау-белка на мышиной модели расстройств непристойного тела с патологией abeta. Нейрон. 2020; 105: 260–75 e266.

    CAS PubMed Google ученый

  • 245.

    Batarseh YS, Duong QV, Mousa YM, Al Rihani SB, Elfakhri K, Kaddoumi A. Бета-амилоид и астроциты взаимодействуют при нарушениях, связанных с бета-амилоидом. Int J Mol Sci. 2016; 17: 338.

    PubMed PubMed Central Google ученый

  • 246.

    Ирвин DJ, Hurtig HI. Вклад патологии тау, амилоид-бета и альфа-синуклеин в деменцию при заболеваниях тельца Леви. JADP. 2018; 8: 444.

    Google ученый

  • 247.

    Polymeropoulos MH, Lavedan C, Leroy E, Ide SE, Dehejia A, Dutra A, et al. Мутация в гене альфа-синуклеина, выявленная в семьях с болезнью Паркинсона. Наука. 1997. 276: 2045–7.

    CAS Google ученый

  • 248.

    Simon-Sanchez J, Schulte C, Bras JM, Sharma M, Gibbs JR, Berg D, et al. Полногеномное ассоциативное исследование выявляет генетический риск, лежащий в основе болезни Паркинсона. Нат Жене. 2009. 41: 1308–12.

    CAS PubMed PubMed Central Google ученый

  • 249.

    Бейер К., Ариза А. Посттрансляционная модификация альфа-синуклеина и альтернативный сплайсинг как триггер нейродегенерации. Mol Neurobiol. 2013; 47: 509–24.

    CAS PubMed Google ученый

  • 250.

    Burre J, Sharma M, Sudhof TC. Клеточная биология и патофизиология альфа-синуклеина. Cold Spring Harb Perspect Med. 2018; 8: a024091.

    PubMed PubMed Central Google ученый

  • 251.

    Villar-Pique A, Lopes da Fonseca T, Outeiro TF. Структура, функция и токсичность альфа-синуклеина: Бермудский треугольник в синуклеинопатиях. J Neurochem. 2016; 139 (Приложение 1): 240–55.

    CAS PubMed Google ученый

  • 252.

    Calo L, Wegrzynowicz M, Santivanez-Perez J, Grazia, Spillantini M. Синаптическая недостаточность и альфа-синуклеин. Mov Disord. 2016; 31: 169–77.

    CAS PubMed Google ученый

  • 253.

    Peng C, Gathagan RJ, Lee VM. Определенные штаммы альфа-синуклеина и значение для гетерогенности среди альфа-синуклеинопатий. Neurobiol Dis. 2018; 109 (Pt B): 209–18.

    CAS PubMed Google ученый

  • 254.

    Новый ген, содержащий тринуклеотидный повтор, который размножается и нестабилен на хромосомах болезни Хантингтона. Группа совместных исследований болезни Хантингтона. Клетка. 1993; 72: 971–83.

  • 255.

    Рузо А., Исмаилоглу И., Поповски М., Харемаки Т., Крофт Г.Ф., Деглинсерти А. и др. Открытие новых изоформ хантинтина выявило новый экзон, специфичный для гоминидов. PLoS ONE. 2015; 10: e0127687.

    PubMed PubMed Central Google ученый

  • 256.

    Морт М., Карлайл Ф.А., Уэйт А.Дж., Эллистон Л., Аллен Н.Д., Джонс Л. и др. Хантингтин существует в человеческом мозге в виде множественных форм сплайсинга. Дис. Дж. Хантингтона. 2015; 4: 161–71.

    CAS Google ученый

  • 257.

    Neueder A, Landles C, Ghosh R, Howland D, Myers RH, Faull RLM и др. Патогенный белок экзона 1 HTT продуцируется неполным сплайсингом у пациентов с болезнью Хантингтона. Научный доклад 2017; 7: 1307.

    PubMed PubMed Central Google ученый

  • 258.

    Romo L, Mohn ES, Aronin N. Новый взгляд на процессинг мРНК хантингтина при болезни Хантингтона. Дис. Дж. Хантингтона. 2018; 7: 101–8.

    CAS Google ученый

  • 259.

    Ehrnhoefer DE, Sutton L, Hayden MR. Небольшие изменения, большое влияние: посттрансляционные модификации и функция хантингтина при болезни Хантингтона. Невролог. 2011; 17: 475–92.

    CAS PubMed PubMed Central Google ученый

  • 260.

    Cicchetti F, Lacroix S, Cisbani G, Vallieres N, Saint-Pierre M, St-Amour I, et al. Мутантный хантингтин присутствует в нейрональных трансплантатах у пациентов с болезнью Гентингтона. Энн Нейрол. 2014; 76: 31–42.

    CAS PubMed Google ученый

  • 261.

    Hartlage-Rubsamen M, Ratz V, Zeitschel U, Finzel L, Machner L, Koppen J, et al. Эндогенный мышиный хантингтин в большом количестве присутствует в ядрах черепных нервов, коагрегируется с бляшками Abeta и индуцируется в реактивных астроцитах в модели трансгенной мыши с болезнью Альцгеймера. Acta Neuropathol Commun. 2019; 7: 79.

    PubMed PubMed Central Google ученый

  • 262.

    Розен Д.Р., Сиддик Т., Паттерсон Д., Фиглевич Д.А., Сапп П., Хентати А. и др. Мутации в гене супероксиддисмутазы Cu / Zn связаны с семейным боковым амиотрофическим склерозом. Природа. 1993; 362: 59–62.

    CAS Google ученый

  • 263.

    Гронер Ю., Лиман-Гурвиц Дж., Дафни Н., Шерман Л., Леванон Д., Бернштейн Ю. и др. Молекулярная структура и экспрессия локуса гена на хромосоме 21, кодирующего супероксиддисмутазу Cu / Zn, и его отношение к синдрому Дауна.Ann NY Acad Sci. 1985; 450: 133–56.

    CAS PubMed Google ученый

  • 264.

    Zinman L, Liu HN, Sato C., Wakutani Y, Marvelle AF, Moreno D, et al. Механизм низкой пенетрантности в семействе БАС с новой делецией SOD1. Неврология. 2009; 72: 1153–9.

    CAS PubMed PubMed Central Google ученый

  • 265.

    Fay JM, Zhu C, Proctor EA, Tao Y, Cui W, Ke H, et al.Фосфомиметическая мутация стабилизирует SOD1 и спасает жизнеспособность клеток в контексте мутации, связанной с БАС. Состав. 2016; 24: 1898–906.

    CAS PubMed PubMed Central Google ученый

  • 266.

    Цзян Х., Симидзу Х., Шига А., Танака М., Онодера О., Какита А. и др. Семейный боковой амиотрофический склероз с мутацией I104F в гене SOD1: мультисистемная дегенерация с нейрофиламентными агрегатами и включениями SOD1.Невропатология. 2017; 37: 69–77.

    CAS PubMed Google ученый

  • 267.

    Milani P, Gagliardi S, Cova E, Cereda C. Транскрипционная и посттранскрипционная регуляция SOD1 и ее потенциальные последствия при БАС. Neurol Res Int. 2011; 2011: 458427.

    PubMed PubMed Central Google ученый

  • 268.

    Prasad A, Bharathi V, Sivalingam V, Girdhar A, Patel BK.Молекулярные механизмы неправильной укладки и патологии TDP-43 при боковом амиотрофическом склерозе. Front Mol Neurosci. 2019; 12:25.

    CAS PubMed PubMed Central Google ученый

  • 269.

    Сяо С., Санелли Т., Чанг Х., Сунь Й., Чакрабартти А., Кейт Дж. И др. Низкомолекулярные виды TDP-43, образующиеся в результате аномального сплайсинга, образуют включения при боковом амиотрофическом склерозе и приводят к гибели двигательных нейронов. Acta Neuropathol. 2015; 130: 49–61.

    PubMed PubMed Central Google ученый

  • 270.

    Хасэгава М., Араи Т., Нонака Т., Каметани Ф., Йошида М., Хашизуме Ю. и др. Фосфорилированный TDP-43 при лобно-височной долевой дегенерации и боковом амиотрофическом склерозе. Энн Нейрол. 2008; 64: 60–70.

    CAS PubMed PubMed Central Google ученый

  • 271.

    Робинсон Дж. Л., Гесер Ф., Стибер А., Умо М., Квонг Л. К., Ван Дирлин В. М. и др.Мотки TDP-43 проявляют свойства амилоида в подмножестве случаев БАС. Acta Neuropathol. 2013; 125: 121–31.

    CAS PubMed Google ученый

  • 272.

    Лин В.Л., Диксон Д.В. Ультраструктурная локализация TDP-43 в нитчатых нейрональных включениях при различных нейродегенеративных заболеваниях. Acta Neuropathol. 2008. 116: 205–13.

    CAS PubMed PubMed Central Google ученый

  • Победители прошлых фондов посевных инвестиций | Мисти

    МИТОР пр.

    Высокоскоростная железная дорога Новые города в Китае: измерение и планирование городских районов

    Сотрудничество между:

    • Вибран Сици Чжэн, доцент, урбанистика и планирование
    • Карло Ратти, профессор, урбанистика и планирование
    • Фабио Дуарте, научный сотрудник, городские исследования и планирование
    • Руи Ду, научный сотрудник отдела городских исследований и планирования
    • Микеле Бонино, Туринский политехнический университет
    • Валерия Федериги, Туринский политехнический университет

    Гибридные дискретные / непрерывные модели для синтетических биологических систем

    Сотрудничество между:

    • Лука Даниэль, профессор электротехники и информатики
    • Стефано Ди Карло, Туринский политехнический университет

    Антенные системы сбора света для солнечных батарей

    Сотрудничество между:

    • Мунги Бавенди, профессор химии
    • Барбара Бонелли, Туринский политехнический университет
    • Франческа Фрейрия, Туринский политехнический университет

    Производство и городские инновации

    Сотрудничество между:

    • Эран Бен-Джозеф, профессор, урбанистика и планирование
    • Маттео Робильо, Туринский политехнический университет

    Новый взгляд на дисперсию внутренних волн в потоках жидкости

    Сотрудничество между:

    • Джильола Стаффилани, профессор математики
    • Federico Fraternale, Туринский политехнический университет
    • Daniela Tordella, Туринский политехнический университет

    Происхождение и распространение шума в клетках млекопитающих

    Сотрудничество между:

    • Салил Гарг, главный научный сотрудник Института интегративных исследований рака Коха при Массачусетском технологическом институте
    • Carla Bosia, Туринский политехнический университет

    Пассивное солнечное охлаждение с помощью инженерных оптических и испарительных явлений

    Сотрудничество между:

    • Светлана Борискина, научный сотрудник, Машиностроение
    • Ганг Чен, профессор, машиностроение
    • Маттео Фазано, Туринский политехнический университет
    • Pietro Asinari, Туринский политехнический университет
    • Элиодоро Кьяваццо, Туринский политехнический университет

    На пути к сокращению заказа масштабируемой параметризованной модели

    Сотрудничество между:

    • Лука Даниэль, профессор электротехники и информатики
    • Стефано Гривет, Туринский политехнический университет

    MIT - FVG (Friuli Venezia Giulia) Посевной фонд

    Анализ систем изоляции электрических судов

    Сотрудничество между:

    • Чатан Кук, главный научный сотрудник, электротехника и информатика
    • Криссостомос Криссостомидис, профессор, инженер-механик
    • Альфредо Контин, Университет Триеста

    Междисциплинарное проектирование корабля с использованием моделей сокращенного порядка и
    машинного обучения

    Сотрудничество между:

    • Майкл Триантафиллу, профессор, машиностроение
    • Лука Бонфлио, научный сотрудник, Машиностроение
    • Джордж Карниадакис Научный сотрудник, Машиностроение
    • Джанлуиджи Роцца, SISSA, Международная школа перспективных исследований
    • Марко Теззеле, SISSA, Международная школа перспективных исследований
    • Никола Демо, SISSA, Международная школа перспективных исследований

    Новости Оценка надежности посредством обоснования и фактических данных

    Сотрудничество между:

    • Регина Барзилай, профессор, электротехника и информатика
    • Энрико Сантус, доктор наук, электротехника и информатика
    • Джузеппе Серра, Университет Удине

    NV центры для проверки квантового равенства Ярзинского (NVQJE)
    • Паола Каппелларо, доцент, Ядерная наука и инженерия
    • Стефано Руффо, SISSA, Международная школа перспективных исследований

    • Андреа Тромбеттони, CNR-IOM DEMOCRITOS и SISSA

    • Андреа Колчелли SISSA, Международная школа перспективных исследований

    Progetto Roberto Rocca

    Жировая ткань на чипе
    • Бенедетто Марелли, главный научный сотрудник отдела гражданского строительства и охраны окружающей среды
    • Silvia Fare ', Миланский политехнический университет
    • Никола Контесси Негрини, Миланский политехнический университет

    Характеристика вмешательств в отделении интенсивной терапии
    • Роджер Марк, профессор электротехники и компьютерных наук
    • Ли-вэй Леман, научный сотрудник
    • Riccardo Barbieri, Миланский политехнический университет

    Расчетный дизайн и экспериментальная проверка TRAF6-связывающих пептидов
    • Эми Китинг, профессор биологии
    • Альфонсо Готери, Миланский политехнический университет

    Проектирование и оптимизация управления интегрированной фотоэлектрической системой Des
    • Амос Винтер, доцент кафедры машиностроения
    • Sergio Savaresi, Миланский политехнический университет

    Уменьшенные модели для нелинейных и мультифизических микросистем
    • Лука Даниэль, профессор электротехники и информатики
    • Альберто Корильяно, Миланский политехнический университет

    Кинетика и нестабильности седиментации
    • Джеймс Свон, доцент кафедры химической инженерии
    • Роберто Пьяцца, Миланский политехнический университет

    Автономное аддитивное производство - UNAM
    • Джон Харт, профессор, машиностроение
    • Джем Тасан, профессор, материаловедение и инженерия
    • Бьянка Мария Колозимо, Миланский политехнический университет

    ПРОВЕРКА: кардиоваскулярные медицинские устройства: от изображений до прикроватных
    • Элазер Эдельман, профессор, Институт медицинской инженерии и науки
    • Francesco Migliavacca, Миланский политехнический университет

    MIT-UNIPI Project

    Модель пиелонефрита in vitro

    Сотрудничество между:

    • Роджер Камм, профессор биологической инженерии
    • Yu Shrike Zhang, инструктор по медицинским наукам и технологиям
    • Джованни Воззи, Пизанский университет
    • Эмилия Геларди, Пизанский университет

    Извлечение событий для обнаружения фейковых новостей

    Сотрудничество между:

    • Регина Барзилай, профессор, электротехника и информатика
    • Энрико Сантус, постдок
    • Алессандро Ленчи, Пизанский университет
    • Франческо Марчеллони, Пизанский университет
    • Люсия Пассаро, Пизанский университет
    • Алессандро Бондиелли, Пизанский университет

    ИНТЕНСИВНЫЕ: эксперименты по физике элементарных частиц в Фермилаборатории

    Сотрудничество между:

    • Ор Хен, профессор физики
    • Симоне Донати, Пизанский университет
    • Орнелла Паламара, Национальная ускорительная лаборатория Ферми

    Микрожидкостное производство биоинженерных микросфер для ремонта тканей

    Сотрудничество между:

    • Патрик Дойл, профессор, химическая инженерия
    • Элизабетта Роселлини, Пизанский университет
    • Мария Грация Касконе, Пизанский университет

    Использование сжатия графиков для вычисления кратчайшего пути в городских условиях по запросу Mo

    Сотрудничество между:

    • Карло Ратти, профессор, урбанистика и планирование
    • Паоло Санти, научный сотрудник, городские исследования и планирование
    • Паоло Феррагина, Пизанский университет

    Волны глобализации между традициями и инновациями

    Сотрудничество между:

    • Энн МакКантс, профессор истории
    • Эллан Сперо, преподаватель, материаловедение и инженерия
    • Валерия Пинчера, Пизанский университет

    Оценка выполнения рекомендаций по устойчивым к карбапенемам Enterobacteriaceae (CRE) в медицинских центрах по делам ветеранов с использованием консолидированной системы исследований по внедрению | Внедрение Наука Коммуникации

    Участники

    Мы провели избыточную выборку учреждений, сообщающих об активном скрининге на CRE / CP-CRE (9/16), и тех, у которых больше CRE-положительных культур (квартили 1 и 2), как показано в таблице 3.Было проведено 43 интервью с персоналом микробиологической лаборатории ( N = 20), ПДК ( N = 15), медсестрами инфекционного контроля ( N = 5) и врачами ( N = 3), как показано на Таблица 4.

    Таблица 3 Характеристики помещения по инцидентам CRE (квартили) Таблица 4 Характеристики интервьюируемых

    Домены и конструкции CFIR: категоризация закодированных ответов

    На рис. широкая реализация рекомендаций CRE: (1) внутренняя настройка ( n = 429, 51%), (2) процесс реализации ( n = 186, 22.1%), (3) характеристика вмешательства ( n = 133, 15,9%), (4) характеристика индивидуумов ( n = 49, 5,8%) и (5) внешняя установка ( n = 44, 5,2%) (см. Дополнительный файл 3 для CFIR домена и определений конструкций).

    Рис. 2

    Частота ответов доменов реализации и конструкций CFIR

    Домены и конструкции CFIR: изучение ассоциаций

    В таблице 2 мы показываем результаты выбранных количественных анализов, сравнивающих конструкции CFIR и открытые коды по активности сайтов скрининг на CRE (vs.без скрининга) и любые (по сравнению с отсутствием) CRE-положительных культур. Наш анализ выявил следующие конструкции, которые в значительной степени связаны со скринингом CRE или наличием CRE: вовлеченность руководства , относительный приоритет («CRE так же важен, как и другие инфекции, приобретенные в больнице (HAI)»), доступные ресурсы (например, , ИТ-поддержка, укомплектование персоналом), групповое общение (задействовано как нарушение связи) и доступ к знаниям и информации (e.g., лабораторный / клинический персонал и учебные материалы для пациентов / семей).

    VAMC, которые активно проводили скрининг на CRE, сообщили о значительно более активном участии руководства в реализации политик CRE, чем те VAMC, которые не проходили скрининг, 100% против 68,2% ( p = 0,002). Участки скрининга CRE сообщили, что к нему относились так же серьезно, как и к другим HAI (например, с метициллин-резистентным Staphylococcus aureus (MRSA)) по сравнению с сайтами, не скринированными на CRE, 91,7% vs.55,6% ( p = 0,01). Сайты, не проверяющие CRE, значительно чаще сообщали о нехватке доступных ресурсов (по сравнению с сайтами, проверяющими CRE): 81,7% против 45,1% ( p <0,0001).

    VAMC с любыми случаями CRE (по сравнению с отсутствием CRE случаев) с меньшей вероятностью сообщали о сбоях в общении в команде, чем сайты без CRE, 100% против 80,8% ( p = 0,02). Сайты с любым CRE сообщили о лучшем доступе к знаниям и информации по сравнению с сайтами без CRE, 88.9% против 36,8% ( p = 0,02).

    Понимание многоуровневых аспектов реализации рекомендаций CRE

    Результаты качественного анализа включают результаты репрезентативных ответов, закодированных доменами и конструкциями CFIR (рис. 2), а также возникающие открытые ответы, выявленные в ходе анализа, включая ответы, классифицированные как «Передовой опыт» (определяется как новаторский подход к реализации или руководящие рекомендации).

    В пределах области характеристик вмешательства ответы, классифицированные в рамках конструкции источника вмешательства , описывают, какие руководящие принципы CRE использовали участники (например,g., VA, CDC, штат), при этом в большинстве отчетов используются рекомендации VA CRE. Мы закодировали ответы, описывающие соблюдение CDC или государственных (но не VA) рекомендаций как отрицательные. Примеры передового опыта включали в себя адаптацию или изменение текущих политик MDRO сайтами с целью включения рекомендаций из руководства VA CRE.

    Во внешнем окружении домена потребности и ресурсы пациентов Построение было определено как стратегии и / или материалы, используемые для обучения или вовлечения ветеранов и их семей.Положительные ответы были сосредоточены на адекватности и доступе к адекватным учебным материалам для информирования пациентов и их семей о CRE (включая доступность материалов на разных языках и уровни грамотности). Отрицательные ответы описывали сайты, на которых не было информации или доступа к раздаточным материалам для обучения лабораторного и / или клинического персонала, пациентов и их семей. MPC описал это так:

    Было бы неплохо иметь [больше образовательных] материалов [и время выпуска персонала для обучения, связанного с CRE] (MPC).

    В «Передовой практике» описаны стратегии, способствующие обучению персонала, развитию лабораторного / клинического персонала, а также образовательные материалы для пациентов и их семей, включая образовательные брошюры, предназначенные для людей с низким уровнем грамотности.

    В пределах характеристик людей область , собственная - эффективность была определена как уверенность участника в понимании и применении руководящих принципов CRE. Самоэффективность большинства участников была высокой, они сообщили, что чувствовали себя «очень» или «полностью» уверенными в выполнении рекомендаций.Отрицательный ответ описывает существующие проблемы в когорте пациентов с MRSA и неуверенность в том, как обращаться с пациентами с CRE. Лучшие практики включают защищенное время для специального лица для мониторинга CRE в их VAMC.

    В рамках процесса внедрения домен , официально назначенных руководителей внутреннего внедрения. Конструкция была определена как существующая структура инфекционного контроля участника (подразделения / отделы / комитет / ресурсы) и / или лабораторное тестирование других MDRO.Отрицательные ответы были сосредоточены на пробелах в существующих стратегиях отчетности о MDRO (например, чрезмерное доверие к устному или электронному общению). Лучшие практики описывают сильную структуру инфекционного контроля, основанную на хорошей коммуникации, которая позволяет сайтам легко уведомлять членов группы инфекционного контроля о CRE-положительном пациенте. Коммерчески доступное программное обеспечение (например, Theradoc®) также было описано как способствующее общению с персоналом.

    В таблице 5 описаны внутренние параметры CFIR , определения и репрезентативные положительные и отрицательные ответы, а также ответы на передовой опыт.Чуть более половины всех закодированных ответов касались конструкций внутри домена внутренней настройки (например, факторов, способствующих успешной реализации рекомендаций CRE). Поскольку эти факторы потенциально поддаются изменению и важны для решения проблемы эффективной реализации, четыре из шести верхних конструкции внутренней настройки выделены (Таблица 5): (1) доступные ресурсы ( n = 122, 28,4%), ( 2) сети и связь ( n = 67, 15.6%), (3) вовлеченность руководства ( n = 51, 11,8%) и (4) культура ( n = 30, 6,9%).

    Таблица 5 Репрезентативные положительные, отрицательные и передовые ответы для доменов внутренних настроек CFIR для реализации рекомендаций CRE

    Конструкции внутренних настроек

    Доступные ресурсы

    Успешная реализация рекомендаций начинается с восприятия заинтересованными сторонами непосредственности проблемы. Один из респондентов назвал попытку реализовать руководство как очень сложную в отсутствие каких-либо случаев CRE:

    Это все равно что ждать снегопада во Флориде.Вы проводите тренинг по подготовке, [но] люди не слушают и ... [они не] думают, что это реально. Потому что они этого не видели ... Люди не начнут приобретать навыки, пока не соприкоснутся с этим. [Сотрудники лаборатории]

    Участники на объектах с случаями CRE указали, что для успешного внедрения руководящих принципов CRE требуется доступ к различным ресурсам и / или их использование (например, укомплектование персоналом, приобретение нового лабораторного оборудования для проведения тестирования полимеразной цепной реакции [ПЦР] и / или информация технология).Один MPC описал получение необходимых ресурсов следующим образом:

    [Наш] начальник штаба ... действительно пошел к [] начальникам различных служб и сказал им, что вы должны серьезно отнестись к проверке CRE. Лидерство, безусловно, подтолкнуло всех врачей к выполнению рекомендаций. Если бы у нас ... было больше положительных CRE [случаев], я уверен, что они [руководство] возьмутся за дело. [MPC]

    На объектах, где руководящие принципы не были полностью реализованы, участники описывали неэффективные или чрезмерно сложные процессы для получения нового лабораторного оборудования и / или решения проблемы текучести кадров, недостаточного количества комнат для изоляции контактов и / или зависимости от ненадежных стратегий (например,g., из уст в уста) для передачи статуса CRE пациента.

    Лучшие практики для доступных ресурсов Конструкция включала стратегии по расширению распространения образовательных материалов CRE среди поставщиков (например, плакаты и услуги инструкторов по обучению), своевременный доступ к лабораторным отчетам для информирования при принятии клинических решений, а также более формальные стратегии для систематического сообщения результатов теста CRE пациента (положительного или отрицательного) всем соответствующим сторонам (например, шаблоны госпитализации / выписки в электронной медицинской карте [EHR]).

    Для подтверждения CP-CRE, все VAMC, у которых не было доступного оборудования, должны были приобрести новое лабораторное оборудование или определить стороннюю лабораторию с возможностями тестирования ПЦР. После выявления потенциального случая CP-CRE участники описали постоянный мониторинг результатов подтверждающих тестов CP-CRE и разработку стратегий для обеспечения достаточного пространства изоляции, чтобы держать идентифицированного человека в контакте с мерами предосторожности до тех пор, пока не будет подтвержден статус CP-CRE.

    Сети и коммуникация

    Закодированные ответы описывали положительные и отрицательные аспекты распространения рекомендаций CRE.Сайты, сообщающие о хорошей коммуникации, описывают адаптацию надежной уже существующей инфраструктуры инфекционного контроля для успешного решения проблемы CRE. Другие сайты указали на чрезмерно сложную и / или иерархическую бюрократию как на препятствие распространению, способствующее задержкам в разработке или утверждении местной политики и препятствующее выполнению рекомендаций CRE.

    Лучшие практики для этой конструкции включали использование стратегий, инструментов и нововведений для облегчения внедрения местных рекомендаций. Описана одна успешная стратегия: включение CRE в существующие политики MDRO по сравнению с разработкой политики, специфичной для CRE, которая часто задерживает внедрение руководящих принципов.

    Чаще всего участники сообщали о том, что узнали о Рекомендациях VA CRE через один или несколько национальных, региональных или местных механизмов связи, включая рассылку электронной почты для конкретных больниц и дисциплин (например, лаборатории, инфекционные заболевания, аптеки). Рекомендации также обсуждались и распространялись на местных тренингах без отрыва от производства, ориентации новых сотрудников и / или специальных тренингах (например, ежедневные обходы пациентов), а также во время заседаний местных междисциплинарных комитетов (например, собрания комитетов по контролю над антибиотиками).

    Взаимодействие с руководством

    Взаимодействие с руководством было определено с точки зрения приверженности местных лидеров выполнению рекомендаций CRE, их вовлеченности и подотчетности. Сайты успешно внедряют руководящие принципы CRE, на которые обычно ссылаются местные (VAMC, лаборатории и / или инфекционный контроль [IC]) участие руководства в содействии своевременной закупке оборудования для лабораторных исследований. В отрицательных ответах местное руководство (VAMC, лаборатория и / или IC) описывалось как «не вовлеченное» в выполнение рекомендаций и / или не желающее решать вопросы, связанные с достаточным пространством для изоляции, укомплектованием персоналом для проведения тестирования CRE, высвобождением времени для обучения персонала или финансированием для приобретения лабораторного оборудования. .Лучшие практики описывают активное участие руководства в выполнении рекомендаций и участие всего соответствующего клинического и лабораторного персонала.

    Культура

    Культура ответов были классифицированы как «положительные», когда в них описывались сильные местные методы инфекционного контроля, проактивный подход к профилактике и / или управлению CRE и / или повышенная осведомленность о инфекционном контроле и профилактике новых патогенов (например, , активный скрининг на CRE у пациентов с высоким риском или план включения активного скрининга в текущую практику, если или когда частота CRE увеличится).«Отрицательные» культурные ответы описывают местные знания о CRE как недостаточное и / или плохое соблюдение персоналом гигиены рук и / или использование средств индивидуальной защиты (СИЗ) (халаты или перчатки):

    Это очень сложно, я здесь год. Когда я делаю округление и исправления среды, например, если кто-то не [использует] СИЗ, [я получаю] много возражений. Я думаю, что [сотрудники] считают CRE серьезным, потому что я поговорю с ними лицом к лицу, если у кого-то есть такая история.Но MRSA не рассматривается так серьезно. [MPC]

    Примеры передовой практики в области культуры касаются междисциплинарного сотрудничества, образования и / или перекрестного обучения лабораторного персонала методам микробиологии / инфекционного контроля.

    Произошла ошибка при настройке пользовательского файла cookie

    Этот сайт использует файлы cookie для повышения производительности. Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


    Настройка вашего браузера для приема файлов cookie

    Существует множество причин, по которым cookie не может быть установлен правильно.Ниже приведены наиболее частые причины:

    • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки своего браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
    • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались. Чтобы принять файлы cookie с этого сайта, нажмите кнопку «Назад» и примите файлы cookie.
    • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
    • Дата на вашем компьютере в прошлом.Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы исправить это, установите правильное время и дату на своем компьютере.
    • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie. Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

    Почему этому сайту требуются файлы cookie?

    Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу.Чтобы предоставить доступ без файлов cookie потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.


    Что сохраняется в файле cookie?

    Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

    Как правило, в файлах cookie может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта.Например, сайт не может определить ваше имя электронной почты, пока вы не введете его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступа к остальной части вашего компьютера, и только сайт, который создал файл cookie, может его прочитать.

    .