Содержание

Приказ об утверждении правил внутреннего трудового распорядка. Образец

Приказ об утверждении Правил внутреннего трудового распорядка формируется после того, как Правила будут составлены, согласованы с руководством и готовы к принятию. Документ относится к локальным распорядительным бумагам компании и должен оформляться определенным образом.

ФАЙЛЫ
Скачать пустой бланк приказа об утверждении правил внутреннего трудового распорядка .docСкачать образец приказа об утверждении правил внутреннего трудового распорядка .doc

Для чего нужны Правила

Данный нормативный документ устанавливает:

  • порядок устройства на работу и увольнения сотрудников,
  • режим труда и отдыха на предприятии,
  • условия предоставления премий, льгот, материальной помощи,
  • порядок отправки работников в отпуски, командировки,
  • обязанности и права сторон и т.д.

Документ пишется исходя из потребностей и возможностей организации с учетом нормативно-правовой законодательной базы на основе статей Трудового кодекса РФ и государственных стандартов и может содержать сколько угодно пунктов.

Основная задача Правил: способствовать грамотному распределению и использованию рабочего времени, укреплять дисциплину труда, повышать эффективность производственного процесса и т.д.

Следует отметить, что не все предприятия коммерческого сектора используют Правила в своем кадровом учете, что на сегодняшний день не является нарушением закона. Важное условие лишь одно: отношения между работодателем и подчиненными должны укладываться в рамки действующего законодательства. А вот государственные бюджетные учреждения обязаны использовать в своей работе данные Правила, при этом их составление отрегулировано до мелочей.

Правила внутреннего распорядка распространяются на весь персонал организации, независимо от должности того или иного работника, поэтому каждого нужно ознакомить с ними под роспись.

К составлению Правил нужно относиться предельно внимательно, поскольку в некоторых случаях они могут стать доказательством в суде при решении трудовых конфликтов и разногласий, причем как со стороны работодателя, так и со стороны подчиненного.

Для того, чтобы ввести Правила в действие, на предприятии должен выйти приказ от лица руководителя. При этом, если в компании действует профсоюзная организация, ее представители обязательно должны быть ознакомлены с Правилами еще до их утверждения.

Непосредственный оформитель приказа

Приказ об утверждении Правил может писать любой работник организации, в чьи должностные обязанности входит данная функция или уполномоченный на формирование приказов отдельным распоряжением руководителя сотрудник. Им может быть:

  • юрисконсульт,
  • начальник или специалист отдела кадров,
  • секретарь и т.д.

После составления бланк следует отдать директору организации для визирования – без его подписи он не будет считаться действительным и его без труда можно будет оспорить через суд или трудовую инспекцию.

Приказ на утверждение Правил внутреннего трудового распорядка должен составляться как при первичном формировании документа, так и в тех случаях, когда в Правила вносились какие-либо изменения или они были полностью «переформатированы».

Обоснование и основание для создания приказа

Как любой другой распорядительный документ, этот приказ должен иметь под собой какую-то почву, т.е. обоснование и основание.

Обосновывающим моментом в данном случае выступает причина создания приказа, т.е. потребность компании, которую решает документ (например, для организации деятельности рабочего коллектива, предупреждения трудовых конфликтов и споров и т.д.).

В качестве основания можно сослаться на пункт закона РФ, который регламентирует создание Правил внутреннего трудового распорядка.

Нюансы составления документа

Приказ не имеет единого унифицированного образца, утвержденного на законодательном уровне. Так что предприятия и организации могут писать его в свободной форме или по шаблону, утвержденному внутри фирмы. При этом существует ряд сведений, которые необходимо указывать в документе в обязательном порядке:

  • номер, дата,
  • место составления,
  • полное название компании,
  • основание для формирования.

В приказе также нужно дать конкретное распоряжение, оформляемое обычно в виде отдельных пунктов. В этой части следует непременно поставить номер и дату составления утверждаемых Правил внутреннего трудового распорядка, а также дату введения их в действие. Вся прочая информация прописывается исходя из потребностей предприятия.

Необходимо отметить ответственных за его исполнение работников (данные вопросы обычно контролирует кадровик), а в качестве приложения обозначить сами правила и при необходимости другие прикладываемые документы.

На что обратить внимание при оформлении приказа

К оформлению приказа, равно как и к его содержанию, нет никаких особенных требований: его можно писать от руки (шариковой ручкой любого цвета, но не карандашом) или печатать на компьютере. Для создания документа подходит как фирменный бланк организации, так и простой чистый лист бумаги.

Только одно условие надо соблюдать обязательно: приказ должен быть подписан руководителем фирмы или его представителем и ответственными за его выполнение сотрудниками.

Удостоверять бланк с помощью печати или штампа на сегодняшний день не требуется, поскольку использование штемпельных изделий теперь не является нормой, прописанной в законе даже для юридических лиц (исключение составляют те организации, в которых обязанность по применению печатей и штампов утверждена во внутренних актах).

Как, где и сколько времени хранить приказ

Сформированный, подписанный и изданный приказ нужно подшить в папку с прочей распорядительной документацией фирмы. После окончания периода действия или утраты актуальности, его следует передать в архив фирмы на хранение. Там его следует держать период, установленный по закону или прописанный в локальных нормативно-правовых документах компании.

образец на 2020-2021 годы в новой редакции

Приказ об утверждении правил внутреннего трудового порядка необходим для регулирования:

  • обязанностей работодателя и сотрудника;
  • порядка назначения отпусков, командировок;
  • порядка увольнения;
  • порядка устройства на работу;
  • режима труда и отдыха;
  • условий начисления дополнительных выплат.

При составлении документа необходимо опираться на возможности организации и стандарты, заданные законодательной базой ТК РФ. Имея свободную форму, работодатель может внести в приказ неограниченное количество пунктов, которые должны регулировать трудовой распорядок на предприятии.

Законодательство не обязывает предпринимателей составлять правила, поэтому не каждое предприятие имеет этот приказ. При составлении правил должно учитываться важное условие – отношения должны устанавливаться в соответствии с рамками, определяемыми законодательством РФ.

Обязанность введения приказа распространяется только на бюджетные организации. Проверяющие органы будут брать во внимание, чтобы в таких организациях правила составлялись с учетом всех нюансов.

Должность работника не влияет на распространение правил внутреннего распорядка. Для соглашения с приказом каждый сотрудник должен поставить свою подпись.

Руководство предприятия должно внимательно относиться к составляемым правилам, так как все конфликтные ситуации будут решать с учетом пунктов из приказа.

Из-за этого документ может стать преимуществом не только для работодателя, но и для работника.

Содержание статьи

Кто составляет

Составлением правил может заниматься любой работник, который числится в штабе организации и в его обязанности входит формирование приказов. Среди таких работников могут быть:

  • секретарь;
  • сотрудник отдела кадров;
  • юрисконсульт и другие.

После того как правила будут сформированы, документ необходимо передать директору организации, который должен подтвердить действительность приказа своей подписью. Если же на предприятии подобный документ не имеет заверения директора, то считается, что определенного трудового распорядка в компании не существует.

Передача документа на подпись должна совершаться не только при составлении приказа, но и при внесении изменений любого масштаба.

Обоснования и основание для создания

Для составления документа понадобятся основания и обоснования.  В качестве оснований используются законодательные акты, которые напрямую определяются правила составления приказа.

В качестве обоснований используется причина, по которой был создан документ, например, потребность компании в организации трудового распорядка, предупреждения для решения споров и конфликтов и так далее.

Обоснования понадобятся и для внесения любого изменения в уже действующий регламент распорядка. На изучение документа и обоснования профсоюзу отводится 5 дней, после чего данные передаются директору предприятия.

Нюансы составления

Составление приказа проходит в свободной форме, так как законодательством не установлено единого образца документа. Но есть свод сведений, которые обязательно должны присутствовать в приказе:

  • номер;
  • дата составления;
  • наименование компании в полном виде;
  • основание и обоснование для оформления.

Основания часть приказа должна состоять из отдельных пунктов. При необходимости заносится и другая информация, которая может потребоваться предприятию для определения правил распорядка.

Одним из условий правильного составления ПВТР является полноценность правил. Если какая-то из возникших ситуаций не сможет быть решена утвержденным приказом, то это показывает наличие «пробелов» в документе.

Для того чтобы подобных ситуаций не возникло, следует обращаться за созданием правил к опытному специалисту, который учтет все нюансы, присущие организации.

В приказе должны быть отмечены сотрудники, являющиеся ответственными за его исполнение. Можно приложить дополнительные документы для обоснования некоторых правил организации.

Порядок применения

Приказ распространяется на каждого работника организации в независимости от должности. Ответственность за исполнение правил накладывается на лицо, указанное при составлении документа. Для подтверждения принятия обязанностей этот работник должен оставить подпись в ПВТР.

Порядок применения взысканий и других видов наказаний определяется пунктом «Ответственность сторон». Кроме наказаний, определяется и последовательность снятия взысканий.

Порядок и форма санкции могут изменяться в зависимости от грубости совершенного нарушения.

Для этого следует правильно составить подпункты «Ответственности сторон» так, чтобы при разбирательстве некоторые ситуации не могли попасть под несколько видов наказания.

Как правило, в ПВТР определяются следующие подпункты в «Ответственности сторон»:

  • наличие письменного объяснения от работника в установленные сроки;
  • срок взыскания, с какого момента отсчитывается;
  • правила составления приказа о применении взыскания;
  • правила обжалования приказа;
  • условия «амнистии»;
  • условия освобождения от ответственности, в том числе и материальной и так далее.

Дисциплинарные взыскания не могут быть изменены работодателем в произвольной форме, что определяется статьей 193 ТК РФ.

На что обратить внимание

При оформлении приказа стоит обратить внимание лишь на некоторые нюансы. Составлять документ можно любым способом (шариковая ручка любого цвета, печать и так далее), запрещенным является только карандаш. Оформление может быть произведено как на обычном листе, так и на специальной форме, подготовленной организацией.

Приказ без подписей ответственных лиц и директора не является действующим документом. Штампа для утверждения правил не потребуется, подобного пункта в законодательных актах РФ нет. Исключениями являются только те организации, которые имеют пункт по обязанности применения штаммов во внутренних регулирующих актах.

Срок действия правил не ограничивается законодательством. ПВТР прекратит свое действие только в следующих случаях:
  • если истек срок действия, указанный при оформлении документа;
  • если истек срок действия в соответствии с локальными нормативными актами;
  • необходимо отменить приказ для обновления или введения совершенно нового свода правил;
  • в силу вступил новый закон или нормативный акт, который является более важным, чем ПВТР.

Если приказ уже утвержден, но понадобилось ввести срок действия для него, то ПВТР придется снова подтверждать.

Как, где и сколько времени хранить

Документ, составленный в соответствии со всеми правилами и актами организации, требуется подшить в папку с другой документацией компании. Когда приказ потеряет свою юридическую силу из-за окончания срока действия или необходимости внесения изменений, он передается в архив организации на хранение.

Храниться документ должен в течение времени, определенного государством, если иного не прописано в нормативных актах самого производства.

Заполненный образец на 2020 год

Документы для скачивания (бесплатно)

Об авторе
Григорий Знайко
Журналист, предприниматель. Веду свое дело и не понаслышке знаю проблемы и сложности, с которыми стакиваются ИП и ООО.
Свежие публикации

Приказ о введении правил внутреннего трудового распорядка — LawsExp.com

Содержание статьи

Приказ об утверждении Правил внутреннего трудового распорядка формируется после того, как Правила будут составлены, согласованы с руководством и готовы к принятию. Документ относится к локальным распорядительным бумагам компании и должен оформляться определенным образом.

Для чего нужны Правила

Данный нормативный документ устанавливает:

  • порядок устройства на работу и увольнения сотрудников,
  • режим труда и отдыха на предприятии,
  • условия предоставления премий, льгот, материальной помощи,
  • порядок отправки работников в отпуски, командировки,
  • обязанности и права сторон и т.д.

Документ пишется исходя из потребностей и возможностей организации с учетом нормативно-правовой законодательной базы на основе статей Трудового кодекса РФ и государственных стандартов и может содержать сколько угодно пунктов.

Основная задача Правил: способствовать грамотному распределению и использованию рабочего времени, укреплять дисциплину труда, повышать эффективность производственного процесса и т.д.

Следует отметить, что не все предприятия коммерческого сектора используют Правила в своем кадровом учете, что на сегодняшний день не является нарушением закона. Важное условие лишь одно: отношения между работодателем и подчиненными должны укладываться в рамки действующего законодательства. А вот государственные бюджетные учреждения обязаны использовать в своей работе данные Правила, при этом их составление отрегулировано до мелочей.

Правила внутреннего распорядка распространяются на весь персонал организации, независимо от должности того или иного работника, поэтому каждого нужно ознакомить с ними под роспись.

К составлению Правил нужно относиться предельно внимательно, поскольку в некоторых случаях они могут стать доказательством в суде при решении трудовых конфликтов и разногласий, причем как со стороны работодателя, так и со стороны подчиненного.

Для того, чтобы ввести Правила в действие, на предприятии должен выйти приказ от лица руководителя. При этом, если в компании действует профсоюзная организация, ее представители обязательно должны быть ознакомлены с Правилами еще до их утверждения.

Непосредственный оформитель приказа

Приказ об утверждении Правил может писать любой работник организации, в чьи должностные обязанности входит данная функция или уполномоченный на формирование приказов отдельным распоряжением руководителя сотрудник. Им может быть:

  • юрисконсульт,
  • начальник или специалист отдела кадров,
  • секретарь и т.д.

После составления бланк следует отдать директору организации для визирования – без его подписи он не будет считаться действительным и его без труда можно будет оспорить через суд или трудовую инспекцию.

Приказ на утверждение Правил внутреннего трудового распорядка должен составляться как при первичном формировании документа, так и в тех случаях, когда в Правила вносились какие-либо изменения или они были полностью «переформатированы».

Обоснование и основание для создания приказа

Как любой другой распорядительный документ, этот приказ должен иметь под собой какую-то почву, т.е. обоснование и основание.

Обосновывающим моментом в данном случае выступает причина создания приказа, т.е. потребность компании, которую решает документ (например, для организации деятельности рабочего коллектива, предупреждения трудовых конфликтов и споров и т. д.).

В качестве основания можно сослаться на пункт закона РФ, который регламентирует создание Правил внутреннего трудового распорядка.

Нюансы составления документа

Приказ не имеет единого унифицированного образца, утвержденного на законодательном уровне. Так что предприятия и организации могут писать его в свободной форме или по шаблону, утвержденному внутри фирмы. При этом существует ряд сведений, которые необходимо указывать в документе в обязательном порядке:

  • номер, дата,
  • место составления,
  • полное название компании,
  • основание для формирования.

В приказе также нужно дать конкретное распоряжение, оформляемое обычно в виде отдельных пунктов. В этой части следует непременно поставить номер и дату составления утверждаемых Правил внутреннего трудового распорядка, а также дату введения их в действие. Вся прочая информация прописывается исходя из потребностей предприятия.

Необходимо отметить ответственных за его исполнение работников (данные вопросы обычно контролирует кадровик), а в качестве приложения обозначить сами правила и при необходимости другие прикладываемые документы.

На что обратить внимание при оформлении приказа

К оформлению приказа, равно как и к его содержанию, нет никаких особенных требований: его можно писать от руки (шариковой ручкой любого цвета, но не карандашом) или печатать на компьютере. Для создания документа подходит как фирменный бланк организации, так и простой чистый лист бумаги.

Только одно условие надо соблюдать обязательно: приказ должен быть подписан руководителем фирмы или его представителем и ответственными за его выполнение сотрудниками.

Удостоверять бланк с помощью печати или штампа на сегодняшний день не требуется, поскольку использование штемпельных изделий теперь не является нормой, прописанной в законе даже для юридических лиц (исключение составляют те организации, в которых обязанность по применению печатей и штампов утверждена во внутренних актах).

Как, где и сколько времени хранить приказ

Сформированный, подписанный и изданный приказ нужно подшить в папку с прочей распорядительной документацией фирмы. После окончания периода действия или утраты актуальности, его следует передать в архив фирмы на хранение. Там его следует держать период, установленный по закону или прописанный в локальных нормативно-правовых документах компании.

Одним из важнейших нормативных актов самого предприятия, который, согласно нормам существующего законодательства в области труда, обязательно должен быть в наличии в каждом хозяйствующем субъекте, считаются правила внутреннего распорядка. Для их утверждения и ввода в действие руководству компании необходимо оформить приказ об утверждении правил внутреннего трудового распорядка.

Порядок применения приказа

Правила внутреннего трудового распорядка (сокращенно ПВТР) закрепляют режим осуществления трудовой деятельности и отдыха персонала компании, а также еще множество других вопросов необходимых при организации и регулировании трудовых отношений.

Процесс их разработки и ввода в действие должен осуществляться только компетентными лицами предприятия, имеющими на это полномочия.

Разработанный специалистами проект ПВТР после согласования с органами профсоюза (при наличии) для придания им юридической силы и законности должны быть утверждены документом – приказ об утверждении правил внутреннего трудового распорядка.

Он подготавливается кадровой службой или отделом делопроизводства компании.

Необходимо помнить, что приказ об утверждении правил внутреннего распорядка оформляется, если они в компании являются самостоятельным документом. Когда правила идут приложением к другим локальным актам фирмы, издавать приказ для их ввода в действие нет необходимости.

После издания документ фиксируется в соответствующем журнале регистрации. Далее его подписывает руководитель хозяйствующего субъекта.

Далее его реквизиты отражаются на ПВТР, которые в установленные приказом сроки должны быть предоставлены сотрудникам компании для ознакомления.

В дальнейшем приказ об утверждении правил внутреннего трудового распорядка храниться вместе с данным локальным актом предприятия либо в подшивке с другими распоряжениями руководства по основному виду деятельности.

Первое предпочтительнее, особенно в случаях, когда в приказе устанавливается период действия ПВТР.

[vc_column][vc_btn title=”Как составить правила внутреннего трудового распорядка” style=”3d” color=”success” size=”lg” align=”center” i_align=”right” i_icon_fontawesome=”fa fa-share” css_animation=”bounceIn” add_icon=”true” link=”url:http%3A%2F%2Fkadrypro.ru%2Flna%2Fpvtr%2Fpravila-vnutrennego-rasporyadka.html||target:%20_blank|” el_ > Скачать образец приказа об утверждении правил трудового распорядка

Образец приказа об утверждении правил внутреннего трудового распорядка, Скачать Word

Как правильно составить приказ об утверждении правил внутреннего трудового распорядка

Для такого типа приказа не установлена специальная форма. Предприятия могут оформлять его произвольно, используя фирменный бланк компании.

Документ должен начинаться с указания полного названия фирмы. Дальше записывается название издаваемого распоряжения, и проставляется его порядковый номер по предприятию. Затем на одной строке на разных сторонах листа указываются место и дата оформления.

После этого посередине страницы записывается полное название приказа.

Затем следует вводная составляющая распоряжения. В ней нужно указать причину, по которой правила вводятся в действие.

Например, «С целью урегулирования вопросов организации труда и соблюдения трудовой и производственной дисциплины». Здесь также желательно сделать отсылку к статьям ТК РФ.

Далее идет слово «Приказываю».

После этого отдельными пунктами записываются распоряжения. В них необходимо:

  • Утвердить разработанные правила внутреннего распорядка и установить дату, с которой они вступают в силу;
  • Если до этого момента действовали старые нормы, признать данным распоряжением их утратившими силу;
  • Определить, что в повседневной деятельности на предприятии необходимо руководствоваться ими;
  • Установить ответственное лицо, которое познакомит всех имеющихся сотрудников с правилами. Делать это нужно под роспись;
  • Отдельным пунктом можно обозначить необходимость знакомить с правилами новых принятых работников;
  • Обозначить ответственное лицо, на которое возлагается функция по отслеживанию исполнения данного распоряжения руководства компании.

В качестве приложения к приказу об утверждении правил необходимо указать проект ПВТР, их порядковый номер, количество страниц.

Оформленное распоряжение визирует руководитель компании. Необходимо обязательно указать его должность и личные данные в подтверждение имеющихся у него полномочий.

Если в нем указаны ответственные сотрудники, необходимо отвести отдельные графы для проставления отметок об ознакомлении. Здесь также отражаются их должность и расшифровка Ф.И.О.

Если у субъекта бизнеса есть привлеченные работники, то он может разработать специальный внутренний акт — Правила внутреннего распорядка. В нем могут рассматриваться правила нахождения на работе и на отдыхе работников, а также вопросы оплаты их труда. Для того, чтобы локальные нормативные акты начали действовать, их необходимо принять. Для данного документа составляется приказ об утверждении правил внутреннего трудового распорядка.

Порядок применения приказа

Правила внутреннего распорядка — это специальный нормативный акт, разработанный субъектом бизнеса, в котором устанавливается, в какие периоды времени сотрудники должны выполнять свои обязанности, а в какие — отдыхать.

Помимо этого, в данном документе могут быть рассмотрены и любые другие особенности работы, которые появляются между работниками и администрацией в процессе ведения деятельности.

Для разработки документа могут приглашаться сотрудники разных профессий. При этом на окончательной версии они должны будут проставить свои личные данные, а также гриф «Согласовано».

После того, как документ разработан, его необходимо ввести в действие. Обычно для этих целей издается специальный приказ.

Правила внутреннего распорядка могут функционировать и как самостоятельный документ, и быть приложением к другому внутреннему нормативному акту — к примеру, к Коллективному соглашению. В такой ситуации составлять отдельный приказ для начала его использования нет необходимости.

Чаще всего обязанность оформления приказа ложиться на кадровый отдел либо отдел делопроизводства. Они должны составить проект распоряжения и передать его на подпись руководящему лицу.

Нужно помнить, что ввести Правила в действие имеет право только лица, которые наделены этим Уставом. Обычно, в его качестве выступает директор.

После утверждения на документе проставляют специальную отметку «Утверждено» и указывают реквизиты распоряжения, которым это было сделано.

Приказ, которым правила были введены в действие, может храниться вместе с ними, либо рядом с другими приказами по основной деятельности, а к правилам прикрепляется его копия.

Приказ об утверждении правил внутреннего трудового распорядка образец 2019 года

Файлы для скачивания:

Скачать образец приказа об утверждении ПВТР, word.

Как правильно составить приказ об утверждении правил внутреннего трудового распорядка

Рассмотрим пример составления приказа на утверждение правил.

Закон для него не определяет какую-либо специальную форму. Поэтому, организации могут оформлять его в произвольном виде, в том числе с применением фирменного бланка.

Обычно, составление приказа необходимо начинать с проставления полного названия субъекта бизнеса, адреса нахождения, регистрационных кодов.

Затем записывается наименование документа и его порядковый номер. Под этими данными документ необходимо будет зафиксировать в журнале регистрации приказов по предприятию.

Следующим этапом записываются место составления распоряжения и дата, когда это было сделано.

Далее на новой строке записывается название приказа. Затем идет текст приказа. Сначала необходимо обосновать причину, по которой принято решение составить и начать использование Правил.

К примеру, можно записать следующую строку: «Для целей регулирования вопросов организации условий труда, и соблюдения дисциплины в труде и на производстве». Здесь же желательно привести ссылки на статьи из ТК, которые регулируют данные действия администрации.

Далее отдельно на новой строке нужно проставить слово «Приказываю», после чего в виде списка перечислить распоряжения руководителя.

Здесь можно проставить следующее:

  • Утвердить разработанные правила и ввести их в действие с определенного числа.
  • Когда происходит замена одних правил новой версией, необходимо в приказе признать недействующим старый аналогичный локальный акт.
  • Установить, что данный документ должен использоваться в повседневной работе, регулируя режим работы сотрудников.
  • Установить ответственное лицо, которому будет поручен контроль за соблюдением правил и процедура ознакомления с данным локальным актом. При этом важно помнить, что ознакомление должно производиться под роспись руководителя.
  • Отдельно нужно доводить нормы данного акта до сведения поступающих новых сотрудников. Здесь также рекомендуется определить ответственного работника.
  • Назначить ответственного, который будет осуществлять контроль за исполнением данного распоряжения руководителя.

В приказе на утверждение можно установить период, в течение которого данные правила внутреннего распорядка будут действовать в компании. Однако, если это сделать, то по истечению данного срока нужно будет разработать и ввести в действие новые правила.

Распоряжение должно быть заверено руководителем, который проставляет свою визу, должность, а также личные данные.

Все лица, которые были обозначены в распоряжении в качестве ответственных, должны также проставить свои подписи и расшифровать свои Ф.И.О., а также указать дату ознакомления с данным документом.

Сроки хранения документа

Законодательно устанавливается, что правила внутреннего трудового распорядка должны храниться согласно Перечню типовых управленческих архивных документов, в течение одного года с момента, когда они утратили свою силу. Рекомендуется осуществлять хранение вместе с данным локальным актом и приказа на его ввод в действие.

В большинстве случаев локальный акт является приложением к приказу, которым он вводится в действие. В связи с этим приказ об утверждении правил внутреннего распорядка необходимо хранить весь период действия Правил, а также еще в течение еще одного года, если они будут признаны утратившими свое действия в результате вступления в силу новых нормативов.

adminlawsexp

голоса

Рейтинг статьи

Приказ об утверждении правил внутреннего распорядка

Порядок применения приказа

Правила внутреннего трудового распорядка (сокращенно ПВТР) закрепляют режим осуществления трудовой деятельности и отдыха персонала компании, а также еще множество других вопросов необходимых при организации и регулировании трудовых отношений.

Процесс их разработки и ввода в действие должен осуществляться только компетентными лицами предприятия, имеющими на это полномочия.

Разработанный специалистами проект ПВТР после согласования с органами профсоюза (при наличии) для придания им юридической силы и законности должны быть утверждены документом – приказ об утверждении правил внутреннего трудового распорядка.

Он подготавливается кадровой службой или отделом делопроизводства компании.

Необходимо помнить, что приказ об утверждении правил внутреннего распорядка оформляется, если они в компании являются самостоятельным документом. Когда правила идут приложением к другим локальным актам фирмы, издавать приказ для их ввода в действие нет необходимости.

После издания документ фиксируется в соответствующем журнале регистрации. Далее его подписывает руководитель хозяйствующего субъекта.

Внимание! Если утверждаемые руководителем ПВТР перед вводом проходили согласование, то в приказ об утверждении правил внутреннего трудового распорядка включаются визы специалистов, осуществлявших согласование.

Далее его реквизиты отражаются на ПВТР, которые в установленные приказом сроки должны быть предоставлены сотрудникам компании для ознакомления.

В дальнейшем приказ об утверждении правил внутреннего трудового распорядка храниться вместе с данным локальным актом предприятия либо в подшивке с другими распоряжениями руководства по основному виду деятельности.

Первое предпочтительнее, особенно в случаях, когда в приказе устанавливается период действия ПВТР.

Как правильно составить приказ об утверждении правил внутреннего трудового распорядка

Для такого типа приказа не установлена специальная форма. Предприятия могут оформлять его произвольно, используя фирменный бланк компании.

Документ должен начинаться с указания полного названия фирмы. Дальше записывается название издаваемого распоряжения, и проставляется его порядковый номер по предприятию. Затем на одной строке на разных сторонах листа указываются место и дата оформления.

После этого посередине страницы записывается полное название приказа.

Затем следует вводная составляющая распоряжения. В ней нужно указать причину, по которой правила вводятся в действие.

Например, «С целью урегулирования вопросов организации труда и соблюдения трудовой и производственной дисциплины». Здесь также желательно сделать отсылку к статьям ТК РФ.

Далее идет слово «Приказываю».

После этого отдельными пунктами записываются распоряжения. В них необходимо:

  • Утвердить разработанные правила внутреннего распорядка и установить дату, с которой они вступают в силу;
  • Если до этого момента действовали старые нормы, признать данным распоряжением их утратившими силу;
  • Определить, что в повседневной деятельности на предприятии необходимо руководствоваться ими;
  • Установить ответственное лицо, которое познакомит всех имеющихся сотрудников с правилами. Делать это нужно под роспись;
  • Отдельным пунктом можно обозначить необходимость знакомить с правилами новых принятых работников;
  • Обозначить ответственное лицо, на которое возлагается функция по отслеживанию исполнения данного распоряжения руководства компании.

Внимание! В приказе можно также предусмотреть срок, в течение которого данные ПВТР будут действовать.

В качестве приложения к приказу об утверждении правил необходимо указать проект ПВТР, их порядковый номер, количество страниц.

Оформленное распоряжение визирует руководитель компании. Необходимо обязательно указать его должность и личные данные в подтверждение имеющихся у него полномочий.

Если в нем указаны ответственные сотрудники, необходимо отвести отдельные графы для проставления отметок об ознакомлении. Здесь также отражаются их должность и расшифровка Ф.И.О.

Приказ об утверждении Правил внутреннего трудового распорядка формируется после того, как Правила будут составлены, согласованы с руководством и готовы к принятию. Документ относится к локальным распорядительным бумагам компании и должен оформляться определенным образом.

ФАЙЛЫ
Скачать пустой бланк приказа об утверждении правил внутреннего трудового распорядка .docСкачать образец приказа об утверждении правил внутреннего трудового распорядка . doc

Для чего нужны Правила

Данный нормативный документ устанавливает:

  • порядок устройства на работу и увольнения сотрудников,
  • режим труда и отдыха на предприятии,
  • условия предоставления премий, льгот, материальной помощи,
  • порядок отправки работников в отпуски, командировки,
  • обязанности и права сторон и т.д.

Документ пишется исходя из потребностей и возможностей организации с учетом нормативно-правовой законодательной базы на основе статей Трудового кодекса РФ и государственных стандартов и может содержать сколько угодно пунктов.

Основная задача Правил: способствовать грамотному распределению и использованию рабочего времени, укреплять дисциплину труда, повышать эффективность производственного процесса и т.д.

Следует отметить, что не все предприятия коммерческого сектора используют Правила в своем кадровом учете, что на сегодняшний день не является нарушением закона. Важное условие лишь одно: отношения между работодателем и подчиненными должны укладываться в рамки действующего законодательства. А вот государственные бюджетные учреждения обязаны использовать в своей работе данные Правила, при этом их составление отрегулировано до мелочей.

Правила внутреннего распорядка распространяются на весь персонал организации, независимо от должности того или иного работника, поэтому каждого нужно ознакомить с ними под роспись.

К составлению Правил нужно относиться предельно внимательно, поскольку в некоторых случаях они могут стать доказательством в суде при решении трудовых конфликтов и разногласий, причем как со стороны работодателя, так и со стороны подчиненного.

Для того, чтобы ввести Правила в действие, на предприятии должен выйти приказ от лица руководителя. При этом, если в компании действует профсоюзная организация, ее представители обязательно должны быть ознакомлены с Правилами еще до их утверждения.

Утверждение документов

Утверждение документа является особым способом введения документа в действие, санкционирующим распространение его на определенный круг организаций, должностных лиц и граждан (подп. 2.3.2.4 ГСДОУ).

В ГСДОУ указывается, что утверждение документа может производиться посредством:

  • грифа утверждения;
  • издания соответствующего распорядительного документа (подп. 2.3.2.4).

В отдельных случаях, предусмотренных законодательством, утверждение может производиться и другими документами.

В ГОСТ Р 6.30-2003 «Унифицированные системы документации. Система организационно-распорядительной документации. Требования к оформлению документов» находим подтверждение этому: документ утверждается должностным лицом (должностными лицами) или специально издаваемым документом (п. 3.16). Как видим, ГОСТ Р 6.30-2003 дает более широкую трактовку второго способа утверждения: документ может утверждаться «специально издаваемым документом», в то время как ГСДОУ говорит об издании «соответствующего распорядительного документа».

Оба способа утверждения имеют одинаковую юридическую силу, но какой из них выбрать?

Утверждение документа путем издания распорядительного документа

Такой вид утверждения используется в том случае, когда требуются дополнительные предписания и разъяснения. Например, приказом утверждается какой-либо Регламент. В любой компании потребуется время на доведение данного приказа и, соответственно, Регламента до сведения работников, а также на ознакомление с данным Регламентом. Поэтому даты подписания приказа и утверждения и введения в действие Регламента могут отличаться, что и отражается в приказе.

Также в приказе указывается перечень работников, до сведения которых должны быть доведены приказ и Регламент, и срок, в течение которого это должно быть сделано. Именно поэтому утверждение приказа путем издания распорядительного документа особенно актуально для компаний, которые имеют развитую сеть филиалов. В приказе обычно указываются Ф.И.О. работников, которые контролируют исполнение приказа. Если же такая формулировка отсутствует, то исполнение приказа контролирует тот работник, который подписал приказ.

Таким образом, издание распорядительного документа для утверждения какого-либо документа позволяет не только дать необходимые разъяснения, но и регламентировать работу, касающуюся не самого утверждаемого документа, а того, как наиболее эффективно ввести его в действие.

На практике документы могут утверждаться приказом, постановлением, решением, реже – протоколом.

Процедура утверждения документа другим документом

Сначала необходимо подготовить документ (например приказ), которым будет утверждаться другой документ (например, Регламент) (Пример 1).

ПРИМЕР 1

Приказ об утверждении Регламента

Открытое акционерное общество «ЭВЕРЕСТ»

ПРИКАЗ

Москва

Об утверждении

Регламента по работе

с дебиторской задолженностью

в ОАО «ЭВЕРЕСТ»

В целях совершенствования работы с клиентами ОАО «ЭВЕРЕСТ» (далее – Общество), а также для контроля за состоянием дебиторской задолженности

ПРИКАЗЫВАЮ:

1. Утвердить Регламент по работе с дебиторской задолженностью (Приложение) и ввести в его действие с 17 октября 2011 года.

2. Начальнику секретариата Маркиной А.П. ознакомить с настоящим приказом работников Общества в соответствии с Реестром рассылки в течение трех рабочих дней с даты подписания приказа.

3. Контроль за исполнением настоящего приказа возложить на коммерческого директора Порошина А.М.

Генеральный директор Волков Г.В. Волков

После подготовки утверждающего документа необходимо оформить на приложении к нему гриф утверждения.

Извлечение из ГОСТ Р 6.30-2003

3.16. При утверждении документа несколькими должностными лицами их подписи располагают на одном уровне.

При утверждении документа постановлением, решением, приказом, протоколом гриф утверждения состоит из слова УТВЕРЖДЕН (УТВЕРЖДЕНА, УТВЕРЖДЕНЫ или УТВЕРЖДЕНО), наименования утверждающего документа в творительном падеже, его даты, номера. Например:

УТВЕРЖДЕН

решением общего собрания

акционеров от 05.04.2003 № 14

или

УТВЕРЖДЕНО

приказом ВНИИДАД

от 05.04.2003 № 82

Гриф утверждения документа располагают в правом верхнем углу документа.

В нашем примере гриф утверждения Регламента по работе с дебиторской задолженностью будет выглядеть так:

Обратите внимание: утверждаемый документ будет являться приложением к документу, которым он утверждается. В ГОСТ Р 6.30-2003 дается лишь один вариант оформления приложения.

Извлечение из ГОСТ Р 6.30-2003

3.21. В приложении к распорядительному документу (постановления, приказы, распоряжения, правила, инструкции, положения, решения) на первом его листе в правом верхнем углу пишут «Приложение №» с указанием наименования распорядительного документа, его даты и регистрационного номера, например:

Приложение № 2

к приказу Росархива

от 05.06.2003 № 319

Допускается выражение «ПРИЛОЖЕНИЕ №» печатать прописными буквами, а также центрировать это выражение, наименование документа, его дату и регистрационный номер относительно самой длинной строки, например:

ПРИЛОЖЕНИЕ №2

к приказу Минздрава России

от 05.06.2003 № 251

В нашем примере это будет выглядеть следующим образом:

Этот вариант оформления грифа утверждения и приложения вызывал среди специалистов много вопросов.

В Методических рекомендациях по разработке инструкций по делопроизводству в федеральных органах исполнительной власти, утвержденных Рриказом Росархива от 23.12.2009 № 76, были предложены два варианта оформления грифа утверждения и приложения:

• на приложениях справочного характера к приказам, распоряжениям, правилам, инструкциям, положениям, планам, программам, договорам и другим документам отметка о приложении проставляется на первом листе приложения в правом верхнем углу. Если приложений несколько, они нумеруются (Приложение № 1, Приложение № 2). Если приложение одно, оно не нумеруется. В отметке о приложении указывается наименование вида основного документа, его дата и номер:

• если приложением к документу (например, к приказу) является утверждаемый документ (положение, правила, инструкция, регламент и др.), в верхнем правом углу проставляется отметка о приложении, ниже – гриф утверждения документа, например:

В нашем примере, учитывая, что приложение одно, оформление будет выглядеть следующим образом:

Рекомендуем использовать именно этот вариант как более рациональный, но сразу заметим: чтобы для коммерческих организаций этот вариант сделать нормативным, его необходимо закрепить в Инструкции по делопроизводству.

Утверждение документа должностным лицом (должностными лицами)

Обычно этот способ используют при утверждении должностных инструкций, положений об отделах, актов проверок и ревизий, актов приема законченных строительством объектов, оборудования, актов экспертизы, актов передачи дел, актов ликвидации организаций, учреждений, предприятий, расценок на производство работ, сметы расходов, отчетов и др., т.е. при утверждении тех документов, которые не требуют дополнительных пояснений. Оформление грифа утверждения на таком документе, как правило, не вызывает вопросов, и при его оформлении можно использовать рекомендации ГОСТ Р 6.30-2003.

Извлечение из ГОСТ Р 6.30–2003

3.16. При утверждении документа должностным лицом гриф утверждения документа должен состоять из слова УТВЕРЖДАЮ (без кавычек), наименования должности лица, утверждающего документ, его подписи, инициалов, фамилии и даты утверждения, например:

УТВЕРЖДАЮ

Президент ЗАО «Ростекстиль»

Личная подпись В.А. Степанов

Дата

Допускается в реквизите «Гриф утверждения документа» центрировать элементы относительно самой длинной строки, например:

УТВЕРЖДАЮ

Генеральный директор

АО «Электронные технологии»

Личная подпись Л.В. Кузнецов

Дата

При утверждении документа несколькими должностными лицами их подписи располагают на одном уровне.

Утверждаемый документ должен быть подписан. В соответствии с Методическими рекомендациями по внедрению ГОСТ Р 6.30-2003 приложения должны быть подписаны исполнителем или руководителем подразделения, подготовившего документ, и датированы.

Какие документы подлежат утверждению?

В каждой организации должен быть определен перечень документов, подлежащих утверждению. Такой перечень можно включить в Табель унифицированных форм документов или Инструкцию по делопроизводству организации.

При составлении перечня можно руководствоваться примерным перечнем документов, подлежащих утверждению, который приведен в Методических рекомендациях по внедрению ГОСТ Р 6.30-2003.

Примерный перечень документов, подлежащих утверждению

Акты (проверок и ревизий, приема законченных строительством объектов, оборудования; экспертизы; передачи дел; ликвидации организаций, учреждений, предприятий и т.д.)

Задания (на проектирование объектов, технических сооружений, капитальное строительство; на проведение научно-исследовательских, проектно-конструкторских и технологических работ, технические и т.д.)

Инструкции (правила) (должностные, по делопроизводству, технике безопасности, внутреннего трудового распорядка и т.д.)

Нормативы (расходов сырья, материалов, электроэнергии, технологического проектирования, численности работников и т.д.)

Отчеты (о производственной деятельности, командировках, научно0-исследовательских работах и т.д.)

Перечни (должностей работников с ненормированным рабочим днем, предприятий, на которые распространяются определенные льготы; типовых документальных материалов, образующихся в деятельности министерств и других организаций, с указанием сроков хранения материалов и т.д.).

Планы (производственные, строительно-монтажных, проектно-изыскательских, научно-исследовательских работ, внедрения новой техники; кооперированных поставок продукции; распределения продукции по установленной номенклатуре; доходов по жилищно-коммунальному ремонту; работы коллегии, научно-технического совета, ученого совета и т.д.)

Положения (об организации, о структурном подразделении, о премировании и т.д.)

Программы (проведения работ и мероприятий; командировок и т.д.)

Расценки на производство работ

Сметы (расходов на содержание аппарата управления, зданий, помещений, сооружений, использования средств фонда предприятия, на подготовку и освоение производства новых изделий; на капитальное строительство и т.д.)

Стандарты (государственные, национальные, организации, отраслевые)

Структура и штатная численность

Тарифные ставки

Уставы организаций

Формы унифицированных документов

Штатные расписания и изменения к ним

Основанием для составления перечня документов, требующих утверждения, являются законодательные и ведомственные нормативные акты, устанавливающие обязательную процедуру утверждения тех или иных документов. Причем законодательные акты могут касаться не только организационно-распорядительных документов, которые фиксируют решения административных и организационных вопросов, а также вопросов взаимодействия, обеспечения и регулирования деятельности органов государственной власти Российской Федерации, субъектов Российской Федерации, органов местного самоуправления, организаций, юридических и физических лиц независимо от форм собственности, но и других видов документов.

Так, большое внимание при составлении перечня документов, которые требуют утверждения, следует уделить первичным учетным документам. Все хозяйственные операции, проводимые организацией, должны оформляться оправдательными документами. Эти документы служат первичными учетными документами, на основании которых и ведется бухгалтерский учет.

В соответствии с Федеральным законом от 21.11.1996 № 129-ФЗ «О бухгалтерском учете» (в ред. от 01.07.2011) и постановлением Правительства РФ от 08.07.1997 № 835 «О первичных учетных документах» Госкомстат России по согласованию с Минфином России и Минэкономики России утверждает альбомы унифицированных форм первичной учетной документации. Примерный перечень первичных учетных документов, которые требуют утверждения, приведен в таблице.

Примерный перечень первичных учетных документов, требующих утверждения

Нормативно-правовой акт Наименование документа, требующего утверждения

Постановление Госкомстата России от 05.01.2004 № 1 «Об утверждении унифицированных форм первичной учетной документации по учету труда и его оплаты»

• № Т-7 «График отпусков»;

• № Т-73 «Акт о приеме работ, выполненных по срочному трудовому договору, заключенному на время выполнения определенной работы».

Постановление Госкомстата России от 21.01.2003 № 7 «Об утверждении унифицированных форм первичной учетной документации по учету основных средств»

• № ОС-1 «Акт о приеме-передаче объекта основных средств (кроме зданий, сооружений)»;

• № ОС-1а «Акт о приеме-передаче здания (сооружения)»;

• № ОС-1б «Акт о приеме-передаче групп объектов основных средств (кроме зданий, сооружений)»;

• № ОС-4 «Акт о списании объекта основных средств (кроме автотранспортных средств)»;

• № ОС-4а «Акт о списании автотранспортных средств»;

• № ОС-4б «Акт о списании групп объектов основных средств (кроме автотранспортных средств)»;

• № ОС-14 «Акт о приеме (поступлении) оборудования»

Постановление Госкомстата России от 01.08.2001 № 55 «Об утверждении унифицированной первичной учетной формы первичной учетной документации № АО-1 “Авансовый отчет”»

№ АО-1 «Авансовый отчет»

Постановление Госкомстата России от 25.12.1998 № 132 «Об утверждении унифицированных форм первичной учетной документации по учету торговых операций»

• № КМ-3 «Акт о возврате денежных сумм покупателям (клиентам) по неиспользованным кассовым чекам»,

• № ТОРГ-1 «Акт о приемке товаров»;

• № ТОРГ-2 «Акт об установленном расхождении по количеству и качеству при приемке товарно-материальных ценностей»;

• № ТОРГ-4 «Акт о приемке товара, поступившего без счета поставщика»;

• № ТОРГ-5 «Акт об оприходовании тары, не указанной в счете поставщика»;

• № ТОРГ-6 «Акт о завесе тары»;

• № ТОРГ-15 «Акт о порче, бое, ломе товарно-материальных ценностей»;

• № ТОРГ-16 «Акт о списании товаров»;

• № ТОРГ-20 «Акт о подработке, подсортировке, перетаривании товаров»;

• № ТОРГ-21 «Акт о переборке (сортировке) плодоовощной продукции»;

• № ТОРГ-22 «Акт о контрольной (выборочной) проверке яиц»

Унифицированные формы первичной учетной документации распространяются на юридические лица всех форм собственности, осуществляющие деятельность на территории Российской Федерации (за исключением кредитных организаций и бюджетных учреждений).

Кроме того, при составлении перечня следует учитывать и вид деятельности организации, т.к. унифицированные формы первичной учетной документации могут разрабатываться отдельно для различных направлений деятельности. Примером могут служить постановления Госкомстата России: от 29.09.1997 № 68 «Об утверждении унифицированных форм первичной учетной документации по учету сельскохозяйственной продукции и сырья» и от 25.12.1998 № 132 «Об утверждении унифицированных форм первичной учетной документации по учету торговых операций».

Кроме того, следует учитывать, что при составлении перечня документов, требующих утверждения, большое значение имеет организационно-правовая форма юридического лица, т.к. законы, регулирующие конкретную организационно-правовую форму юридического лица, содержат требования по поводу утверждения тех или иных документов (как правило, в них приводится перечень таких документов), например:.

Извлечение

из Федерального закона от 26.12.1995 № 208-ФЗ

«Об акционерных обществах»

(в ред. от 28.12.2010)

Статья 48. Компетенция общего собрания акционеров

1. К компетенции общего собрания акционеров относятся:

1) внесение изменений и дополнений в устав общества или утверждение устава общества в новой редакции;

10) утверждение аудитора общества;

11) утверждение годовых отчетов, годовой бухгалтерской отчетности, в том числе отчетов о прибылях и об убытках (счетов прибылей и убытков) общества, а также распределение прибыли (в том числе выплата (объявление) дивидендов, за исключением прибыли, распределенной в качестве дивидендов по результатам первого квартала, полугодия, девяти месяцев финансового года) и убытков общества по результатам финансового года;

19) утверждение внутренних документов, регулирующих деятельность органов общества…

Статья 65. Компетенция совета директоров (наблюдательного совета) общества

1. К компетенции совета директоров (наблюдательного совета) общества относятся следующие вопросы:

3) утверждение повестки дня общего собрания акционеров;

13) утверждение внутренних документов общества, за исключением внутренних документов, утверждение которых отнесено Федеральным законом к компетенции общего собрания акционеров, а также иных внутренних документов общества, утверждение которых отнесено уставом общества к компетенции исполнительных органов общества…

Извлечение

из Федерального закона от 06.02.1998 № 14-ФЗ

«Об обществах с ограниченной ответственностью»

(в ред. от 11.07.2011)

Статья 32. Органы общества

2.1. Уставом общества может быть предусмотрено, что к компетенции совета директоров (наблюдательного совета) общества относятся:

6) утверждение или принятие документов, регулирующих организацию деятельности общества (внутренних документов общества)…

Статья 33. Компетенция общего собрания участников общества

1. К компетенции общего собрания участников общества относятся:

6) утверждение годовых отчетов и годовых бухгалтерских балансов;

12) назначение ликвидационной комиссии и утверждение ликвидационных балансов…

Извлечение

из Федерального закона от 14.11.2002 № 161-ФЗ

«О государственных и муниципальных унитарных предприятиях»

(в ред. от 19.07.2011)

Статья 20. Права собственника имущества унитарного предприятия

1. Собственник имущества унитарного предприятия:

4) утверждает устав унитарного предприятия, вносит в него изменения, в том числе утверждает устав унитарного предприятия в новой редакции;

5) принимает решение о реорганизации или ликвидации унитарного предприятия в порядке, установленном законодательством, назначает ликвидационную комиссию и утверждает ликвидационные балансы унитарного предприятия;

12) утверждает показатели экономической эффективности деятельности унитарного предприятия и контролирует их выполнение.

Обратите внимание

Чтобы документ был утвержден должностным лицом, такое лицо должно обладать правом утверждения (подписи) документа.

Как правило, в соответствии с учредительными документами право подписывать и утверждать все документы организации имеет единоличный исполнительный орган – генеральный директор (директор, президент). В некоторых случаях в учредительных документах могут быть указаны должности руководителей, которые также могут подписывать и утверждать документы наряду с единоличным исполнительным органом. На практике такие варианты встречаются редко. В основном право подписи и утверждения каких-либо документов (за исключением документов, связанных с трудовым правом) делегируется на основании отдельного приказа о предоставлении права подписи конкретному должностному лицу или фиксируется в приказе о распределении обязанностей, в котором указываются не только полномочия отдельных руководителей, но и те документы, которые они могут подписывать и утверждать в пределах своих полномочий.

Иначе обстоит дело с первичными учетными документами. В соответствии с Федеральным законом от 21.11.2006 № 129-ФЗ «О бухгалтерском учете» (в ред. от 28.09.2010) перечень лиц, имеющих право подписи первичных учетных документов, утверждает руководитель организации по согласованию с главным бухгалтером. Но на практике часто встречаются такие формы документов, которые требуют утверждения руководителями сразу двух организаций, например: унифицированные формы № ОС-1 «Акт о приеме-передаче объекта основных средств (кроме зданий, сооружений)», № ОС-1а «Акт о приеме-передаче здания (сооружения)», № ОС-16 «Акт о приеме-передаче групп объектов основных средств (кроме зданий, сооружений)», утвержденные постановлением Госкомстата России от 21.01.2003 № 7. При утверждении таких первичных учетных документов не единоличным исполнительным органом, а другими должностными лицами последние должны быть включены в перечень лиц, имеющих право подписи первичных учетных документов, который утверждает руководитель организации по согласованию с главным бухгалтером, а также должна быть подготовлена доверенность.

Государственная система документационного обеспечения управления. Основные положения. Общие требования к документам и службам документационного обеспечения (одобрена Коллегией Главархива СССР 27.04.1988; приказ Главархива СССР от 25.05.1988 № 33).

Организационно-распорядительная документация. Требования к оформлению документов: Методические рекомендации по внедрению ГОСТ Р 6.30-2003 / Сост.: М.Л. Гавлин, А.С. Красавин, Л.В. Кузнецов и др.; Общ. ред. М.В. Ларин, А.Н. Сокова; Росархив, ВНИИДАД. М., 2003. 90 с.

Приказ о внесении изменений в Правила внутреннего трудового распорядка

Государственное казенное учреждение социального обслуживания

«Фроловский центр социального обслуживания населения»

П Р И К А З

«18» сентября 2014г. № 51

г. Фролово, Волгоградской области

О внесении изменений в Правила

внутреннего трудового распорядка

В целях исполнения требований, указанных в Протесте Фроловской межрайонной прокуратуры исх. г.

ПРИКАЗЫВАЮ:

1. Внести в Правила внутреннего трудового распорядка для работников, утвержденные приказом ГКУ СО «Фроловский ЦСОН» от 1 июля 2014 г. № 40 следующие изменения:

1.1. Пункт 2. Порядок приема и увольнения, подпункт 2.3. изложить в следующей редакции:

2.3. При поступлении на работу в учреждение гражданин обязан представить следующие документы:

— паспорт или иной документ, удостоверяющий личность;

— трудовую книжку;

— страховое свидетельство государственного пенсионного страхования;

— документы воинского учета – для в/обязанных и лиц, подлежащих призыву на в/службу;

— документ об образовании и (или) о квалификации;

-справку о наличии (отсутствии) судимости и (или) факта уголовного преследования либо о прекращении уголовного преследования по реабилитирующим основаниям.

При заключении трудового договора впервые, трудовая книжка и страховое свидетельства государственного пенсионного страхования оформляются учреждением.

2. Специалисту по кадрам ознакомить работников учреждения с изменениями в Правилах внутреннего трудового распорядка.

3. Настоящий приказ вступает в силу со дня его подписания.

4. Контроль исполнения настоящего приказа оставляю за собой.

Директор учреждения

Согласовано:

Главный бухгалтер

Приказ подготовила:

Специалист по кадрам

Приложение

к приказу ГКУ СО «Фроловский ЦСОН»

от «1» июля 2014 № 40

с изменениями от 01.01.2001г. № 51

ПРАВИЛА

внутреннего трудового распорядка для работников

ГКУ СО «Фроловский центр социального обслуживания населения»

1. Общие положения

1.1. Правила внутреннего трудового распорядка (далее — Правила) для работников ГКУ СО «Фроловский центр социального обслуживания населения» (далее — учреждение), разработаны в соответствии с Трудовым кодексом Российской Федерации и иными нормативными правовыми актами Российской Федерации и Волгоградской области, содержащими нормы трудового права и определяют порядок приема и увольнения работника, продолжительность рабочего времени, время начала и окончания работы, порядок учета рабочего времени, очередность предоставления отпусков, в том числе дополнительных, порядок и сроки выплаты заработной платы, и основные положения режима содержания служебных помещений.

1.2. Основные вопросы труда и отдыха (порядок перевода, права и обязанности работников и др.) регламентируются трудовым законодательством, иными нормативными правовыми актами РФ и Волгоградской области, коллективным договором (при его наличии).

1.3. Полномочия администрации учреждения применительно к настоящим Правилам осуществляются директором учреждения в соответствии с законодательством о труде РФ, законодательством Волгоградской области.

2. Порядок приема и увольнения.

2.1. Прием граждан на работу в учреждение осуществляется на условиях трудового договора.

2.2. Право приема граждан на работу, перевода, перемещения и увольнения работников учреждения имеет директор.

2.3. При поступлении на работу в учреждение гражданин обязан представить следующие документы:

— паспорт или иной документ, удостоверяющий личность;

— трудовую книжку;

— страховое свидетельство государственного пенсионного страхования;

— документы воинского учета – для в/обязанных и лиц, подлежащих призыву на в/службу;

— документ об образовании и (или) о квалификации;

-справку о наличии (отсутствии) судимости и (или) факта уголовного преследования либо о прекращении уголовного преследования по реабилитирующим основаниям.

При заключении трудового договора впервые, трудовая книжка и страховое свидетельства государственного пенсионного страхования оформляются учреждением.

2.4. При трудоустройстве работников специалист по кадрам обязан под подпись ознакомить работника с настоящими Правилами, должностной инструкцией и иными нормативными актами, имеющими отношение к исполнению работником должностных обязанностей.

2.5. Прекращение трудового договора и увольнение работника могут иметь место только по основаниям, предусмотренным законодательством РФ о труде, законом Волгоградской области «О работниках социальных служб Волгоградской области».

Расторжение трудового договора и увольнение работника оформляются соответствующим приказом директора учреждения.

2.6. Днем увольнения считается последний день работы. В день увольнения администрация обязана выдать работнику трудовую книжку и произвести с ним окончательный расчет.

3. Продолжительность рабочего времени, начало и окончание работы

3.1.Рабочее время — время, в течение которого работник в соответствии с трудовым распорядком и условиями трудового договора должен исполнять свои должностные обязанности, а также иные периоды, которые в соответствии с трудовым законодательством относятся к рабочему времени.

3.2.Нормальная продолжительность рабочего времени для работников не может превышать 40 часов в неделю.

3.3.Для работников учреждения проживающих и работающих на территории городского округа города Фролово устанавливается рабочая неделя продолжительностью 40 часов в неделю.

Время начала и окончания работы, перерыва для отдыха и питания устанавливается следующее:

понедельник-пятница: начало работы — 8 часов 30 минут; окончание работы — 17 часов 30 минут;

перерыв для отдыха и питания — с 12 часов 00 минут до 13 часов 00 минут.

3.4. Для работников учреждения проживающих и работающих на территории Фроловского муниципального района устанавливается рабочая неделя продолжительностью 36 часов в неделю.

Время начала и окончания работы, перерыва для отдыха и питания устанавливается следующее:

понедельник-пятница: начало работы — 8 часов 30 минут; окончание работы — 16 часов 50 минут;

перерыв для отдыха и питания — с 12 часов 00 минут до 13 часов 00 минут.

3.5.В учреждении устанавливается пятидневная рабочая неделя с двумя выходными днями — суббота и воскресенье.

В соответствии с трудовым законодательством в предпраздничные дни продолжительность рабочего дня сокращается на один час.

3.6. В учреждении устанавливаются дополнительные регламентированные технологические перерывы:

с 10 часов 00 минут до 10 часов 15 минут;

с 15 часов 00 минут до 15 часов 15 минут.

3.7.Работникам устанавливается нормированный рабочий день.

4. Порядок учета рабочего времени,

очередность предоставления отпусков

4.1.Руководители структурных подразделений учреждения организуют, учет рабочего времени для работников. Учет рабочего времени социальных работников отделения социального обслуживания на дому ведут специалисты по социальной работе по закрепленным за ними группам.

4.2.Порядок направления работника в командировку, оформления командировочных удостоверений осуществляется в соответствии с трудовым законодательством в порядке, определяемом Правительством Российской Федерации.

4.3.Работникам предоставляется ежегодный оплачиваемый отпуск на основании утвержденного графика отпусков.

Отдельным категориям работников в случаях, предусмотренных федеральными законами, ежегодный оплачиваемый отпуск предоставляется по их желанию в удобное для них время.

4.4.Сверх ежегодного основного оплачиваемого отпуска работникам предоставляется ежегодный дополнительный оплачиваемый отпуск в зависимости от стажа работы в социальной службе (далее именуется — дополнительный ежегодный оплачиваемый отпуск).

Отдельным категориям работников с ненормированным рабочим днем предоставляется ежегодный дополнительный оплачиваемый отпуск (Приложение )

4.5.Порядок и очередность предоставления отпусков, продление или перенос отпуска, отзыв из отпуска, замена отпуска денежной компенсацией, исчисление продолжительности отпуска регламентируются трудовым законодательством.

5.Порядок и сроки выплаты заработной платы

5.1.Порядок оплаты труда работников определяется правовым актом Правительства Волгоградской области.

5.2.При выплате заработной платы работника в письменной форме извещаются о ее составных частях, причитающихся им за соответствующий период, размерах и основаниях произведенных удержаний, а также об общей денежной сумме, подлежащей выплате.

5.3.Заработная плата выплачивается не реже чем каждые полмесяца – 1-го и 16-го числа каждого месяца.

5.4.Заработная плата перечисляется работнику на банковскую карту или указанный работником счет в банке.

При совпадении дня выплаты с выходным или нерабочим праздничным днем выплата заработной платы производится накануне этого дня.

5.5.Оплата отпуска производится не позднее, чем за три дня до его начала.

6. Основные положения режима содержания служебных помещений здания

6.1. В случае ухода из помещения в рабочее время работники, работающие в данном помещении, обязаны закрывать двери на ключ.

По окончании работы работники убирают всю рабочую документацию в соответствующие хранилища, закрывают и при необходимости опечатывают их, отключают от сети оргтехнику, другое оборудование и приборы, закрывают окна, выключают радио и освещение.

Уходя из помещения, закрывают двери на ключ.

Помещения, оборудованные техническими средствами охраны, должны сдаваться под охрану с проверкой работоспособности этих средств.

6.2. В служебных помещениях запрещается курение табака и проведение неофициальных мероприятий.

7. Заключительные положения

Нарушение настоящих Правил является нарушением трудовой дисциплины и влечет за собой применение мер дисциплинарного взыскания в соответствии с действующим законодательством.

Приложение

к Правилам внутреннего трудового распорядка

Перечень

должностей работников с ненормированным рабочим днем

Государственного казенного учреждения социального обслуживания

«Фроловский центр социального обслуживания населения»,

имеющих право на ежегодный дополнительный оплачиваемый отпуск

№ п/п

Наименование должностей (профессий) работников

Количество дополнительных календарных дней к ежегодному дополнительному оплачиваемому отпуску

Директор

Главный бухгалтер

Водитель автомобиля

Образец приказа о разработке проекта и внесении изменений в пвтр - Как правильно заполнять приказы - Шаблоны примеры

Образец приказа об изменении пвтр

07.12. 22:33

Образец приказа об изменении пвтр

образец заявления о регистрации юл

образец иска плесень в квартире

24 янв. г. - Объясните пошаговую процедуру внесения изменений в ПВТР. Zenya, а образец приказа не могли бы скинуть сюда? Я тоже ПВТР.

Их образец и содержание, утверждение и ответственность за их нарушение.Типовые ПВТР на . 2.2.1 Порядок утверждения;2.2.2 Приказ о внутреннем трудовом распорядке. 2.3 Внесение изменений в ПВТР. 3 Нарушение.

23 нояб. г. - Помогите, нужен приказ для изменения ПВТР, туда необходимо внести пункт об обязательной аттестации работников, кстати, в какой раздел правил. нужен образец приказа для изменения ПВТР - Кадровик.ру9 сен Приказ об утверждении ПВТР. Форум. кадровый портал. 26 фев приказ о введении сменного режима работы. Форум. кадровый. 22 ноя Суммированный учет. Форум. кадровый портал КАДРОВИК.РУ21 дек 2009Другие результаты с сайта www.kadrovik.ruКак внести изменения в правила внутреннего трудового. www.hr-portal.ru/. /kak-vnesti-izmeneniya-v-pravila-vnutrennego-trudo. Сохраненная копияПохожие14 марта г. - То есть работодатель готовит проект изменений в ПВТР и отправляет его. Изменения вводятся в действие приказом по организации.

Светлана Горшнева. «Можно ли заключить срочный трудового договор на время отсутствия «пропавшего» работника?» «Все для кадровика», № 04.

-12-18 22:00, Категория - Образцы документов. Поделиться… Предлагаем образец оформления изменений к Правилам внутреннего трудового распорядка. договора, локальные нормативные акты, кадровые приказы.Нужно внести изменения в ПВТР о изменении рабочего времени. Делается приказ о внесении изменений в ПВТР, дополнение к. как лучше внести изменения в ПВТРСообщений: 151 ноя правила внутреннего трудового распорядкаСообщений: 517 июн Изменение графика работыСообщений: 510 мар Изменение ПВТРСообщений: 68 фев Другие результаты с сайта www.kadrovik-praktik.ruПорядок внесения изменений в правила внутреннего. spok.by/izdaniya/. /poryadok-vneseniya-izmenenii-v-pravila-v_000000. Сохраненная копияПохожиеТак, по мнению автора, порядок внесения изменений в ПВТР должен. Образец приказа о разработке проекта и внесении изменений в ПВТР.

Очевидно, что закон придает ПВТР большое значение. издавать соответствующие приказы при любых вносимых в Правила изменениях.

ОТКРЫТОЕ АКЦИОНЕРНОЕ ОБЩЕСТВО "РОССИЙСКИЕ ЖЕЛЕЗНЫЕ ДОРОГИ" ПРИКАЗ от 27 августа 2004 года N 149. О внесении изменения и.

образец книги учета векселей, образец искового на страховую, образец заявки соревнований пауэрлифтинг. g

Правила внутреннего трудового распорядка - ПВТР

Один из самых важных и нужных документов на фирме – это правила внутреннего трудового распорядка (ПВТР). В таких правилах подробно описан рабочий день, распорядок, режим трудовой деятельности, меры поощрений и меры наказания и с пояснениями за что, обязанности сторон, так же ответственность в разных случаях, и много другое.

Для чего нужны правила внутреннего трудового распорядка (ПВТР)?

В статье 189 «Дисциплина труда и трудовой распорядок» ТК РФ сказано, что дисциплина труда это не что иное, как правила поведения, которые обязательны для всех сотрудников. Вот такие правила и должны быть подробно изложены и описаны в ПВТР.

Согласно закону работодатель должен создать такие условия, при которых будет возможно соблюдать ПВТР. А значит, он обязан закрепить положения в посменном виде.

Если же нет, сотрудники вольны нарушать трудовой распорядок. Поскольку за нарушение уволить будет довольно проблематично. ПВТР должен быть создан на несколько лет, поскольку это очень важный документ.

Нормативная база ПВТР

В «Трудовой распорядок и дисциплина труда» ТК РФ подробно изложен порядок составления ПВТР, нюансы в 189 и 190 статьях ТК РФ.

Составляя ПВТР воспользуйтесь Стандартом ГОСТа Р 6.30-2003«Унифицированные системы документации. Унифицированная система организационно-распорядительной документации. Требования к оформлению документов» и Постановлением Госкомтруда СССР от 20.07.1984 года №213 «Об утверждении Типовых правил внутреннего трудового распорядка для рабочих и служащих предприятий, учреждений, организаций». Только помните, что Постановление под номером 129 устарело.

Разработка правил внутреннего трудового распорядка

Каждое предприятие разрабатывает внутренний распорядок самостоятельно с учетом статей ТК, государственный поправки.

ПВТР направлены на укрепление дисциплины работников, правильному использованию времени на работе, что бы работа была эффективной и продуктивной.

Содержание правил внутреннего трудового распорядка

Стандарт ГОСТ

Государственный стандарт не обязывает, а рекомендует и согласно ему в ПВТР обязательно должно быть:

  1. Товарный знак, эмблему фирмы
  2. Код предприятия и формы документа
  3. Полное название предприятия
  4. Название документа, его вид и регистрационный номер
  5. Дату, когда был составлен и утвержден
  6. Адресаты
  7. Гриф, утверждающий полноту прав этого документа
  8. Резолюцию
  9. Отметку контроля
  10. Текс самого документа
  11. Подпись уполномоченного представителя власти на фирме
  12. Отметка, подтверждающая наличие правомерного приложения
  13. Печать
  14. Отметка о исполнении и направки его в дело.

Есть стандартные ПВТР, которые носят обязательный характер. Обязаны присутствовать в каждом таком документе. Поэтому обязательны такие подразделы:

  1. Положения общего характера. В нем указывают цели составления документа, и над кем будет иметь власть
  2. Правила приема сотрудников и их увольнение. Порядок взятия на работу должен быть расписан буквально поэтапно, так же оговорен должен быть испытательный срок и список необходимых документов.
  3. Основные обязанности и права сотрудников компании или фирмы. Он берет свою основу со статьи 21 ТК РФ
  4. Основные обязанности и права работодателя. Он уже берет свою основу со статьи 22 ТК РФ.
  5. Время работы. Четко прописано начало и окончание трудового дня, кол-во часов работы в день и смен в сутки или за неделю. Сотрудники с ненормированным графиком прописываются отдельно. А так же размеры заработной платы.
  6. Время, отведенное для отдыха. Сроки обеденных и специальных перерывов, выходные, когда предоставляются отпуска.
  7. Поощрение сотрудников. Описаны должны быть все виды, методы и за что поощряют сотрудников
  8. Что несет за собой нарушение дисциплины. Указывают меры взысканий и как применяют, в каком порядке
  9. Приложение. Заключение. Тут прописывают порядок решения споров.

Утверждение правил внутреннего трудового распорядка

Порядок утверждения

ПВТР могут издаваться как отдельным специальным документов, а могут выйти как приложение к Договору Коллективному. ПВТР утверждает специальный представительный орган на предприятии, выраженный советом работников или общим собранием. За пять дней после начала рассмотрения проекта ПВТР работники должны вынести решение согласны или если нет, причины и способы изменения.

Приказ о внутреннем трудовом распорядке

ПВТР можно утвердить как отдельным приказом или документом. В графе «Утверждены» нужно будет указать номер и дату документа.

Внесение изменений в ПВТР

В законе не сказано, не сказано точно, как вносить изменения в ПВТР, обычно их вносят как принятие поправок к закону.

Так как утверждения вносят двумя различными путями, значит, и изменения будут внесены тоже двумя путями.

  1. Если ПВТР утверждали приказом, значит для изменений достаточно издания нового приказа с изменениями, который соответственно отменит действие предыдущего.
  2. Если же ПВТР был утвержден как отдельный документ, значит, утверждается его переиздание и отмена старого. Значит придаться повторить процедуру принятия ПВТР заново.

Для того, что внести изменения, необходимо знать, как был принят ПВТР.

Нарушение правил внутреннего трудового распорядка

Прописанные меры взыскания за нарушение ПВТР прописывают в обычном порядке. Обычно объявляется просто или строгий выговор. Но это применимо, если работник был ознакомлен с ПВТР. Поэтому руководителю в обязательном порядке стоит ознакомить своих подчиненных с таким документом. Лист, подтверждающий, что сотрудник ознакомлен обязан содержать следующее:

Заводят, обычно отдельную книгу.

Приказ о разработке пвтр образец

Просмотров:  3

Описание:

В разделе указываются порядок, место и сроки выдачи зарплаты в соответствии со ст. Руководитель имеет право внести предлагаемые изменения или же не согласиться с ними в таком случае он все равно может утвердить пвтр с оформлением протокола, в котором будут указаны все разногласия руководителя и работников. По требованию работника работодатель обязан выдать ему надлежащим образом заверенную копию указанного приказа (распоряжения). Правила внутреннего трудового распорядка относятся к классу 02000000 и имеют кодовое обозначение 0252131.

Кроме того, отсутствие этого документа позволяет сотрудникам свободно нарушать уволить сотрудника в связи с невыполнением рабочих обязанностей при отсутствии пвтр тоже будет довольно затруднительно. Однако необходимо помнить, что постановление 213 было утверждено давно, до введения в действие трудового кодекса. Если работник в день увольнения не работал, то соответствующие суммы должны быть выплачены не позднее следующего дня после предъявления уволенным работником требования о расчете. Правда, необходимо учесть, что постановление 213 устарело, но в части, не противоречащей современному трудовому кодексу российской федерации им можно пользоваться.

Разработка правил внутреннего трудового распорядка правила внутреннего трудового распорядка каждое предприятие разрабатывает самостоятельно, опираясь на статьи трудового кодекса, государственные стандарты и внутренние документы предприятия. Указывается порядок предоставления выходных дней в соответствии со ст. Срок испытания не может превышать трех месяцев, а для руководителей организации и его заместителей, главного бухгалтера и его заместителей, руководителей филиалов, представительств или иных обособленных структурных подразделений организаций - шести месяцев, если иное не установлено федеральным законом. В связи с вышесказанным необходимо уделить особое внимание подготовке пвтр.

Он уже берет свою основу со статьи 22 тк рф. Положения действующего законодательства статьей 189 трудового кодекса рф, закреплено понятие дисциплина труда - обязательное для всех работников подчинение правилам поведения, определенным в соответствии с следует обратить внимание, что составление пвтр, предусмотренное статьей 189 тк рф, носит не рекомендательный, а обязательный характер. Фонд оплаты труда формула расчета или как рассчитать фонд оплаты труда в россии фонд оплаты труда определяется как общая денежная сумма. Правила утверждаются приказом об утверждении и введение в действие правил внутреннего трудового распорядка. Сроки обеденных и специальных перерывов, выходные, когда предоставляются отпуска. В дальнейшем необходимо определить перечень сотрудников которые должны оказать содействие в разработке пвтр (начальники отделов, бухгалтерия, другие работники), с которыми согласовываются пвтр (начальники отделов, юристы, бухгалтерия, другие работники). Специальные перерывы могут быть предоставлены, например, сотрудникам, работающим в холодное время года на открытом воздухе и грузчикам. Основные права и обязанности работников - заключение, изменение и расторжение трудового договора в порядке и на условиях, которые установлены трудовым кодексом российской федерации, иными федеральными законами - предоставление ему работы, обусловленной трудовым договором - рабочее место, соответствующее государственным нормативным требованиям охраны труда и условиям, предусмотренным коллективным договором (при его наличии) - своевременную и в полном объеме выплату заработной платы в соответствии со своей квалификацией, сложностью труда, количеством и качеством выполненной работы - отдых, обеспечиваемый установлением нормальной продолжительности рабочего времени, сокращенного рабочего времени для отдельных профессий и категорий работников, предоставлением еженедельных выходных дней, нерабочих праздничных дней, оплачиваемых ежегодных отпусков - полную достоверную информацию об условиях труда и требованиях охраны труда на рабочем месте - профессиональную подготовку, переподготовку и повышение своей квалификации в порядке, установленном трудовым кодексом российской федерации, иными федеральными законами - объединение, включая право на создание профессиональных союзов и вступление в них для защиты своих трудовых прав, свобод и законных интересов - участие в управлении организацией в предусмотренных трудовым кодексом российской федерации, иными федеральными законами и коллективным договором (при его наличии) формах - ведение коллективных переговоров и заключение коллективных договоров и соглашений через своих представителей, а также на информацию о выполнении коллективного договора, соглашений - защиту своих трудовых прав, свобод и законных интересов всеми не запрещенными законом способами - разрешение индивидуальных и коллективных трудовых споров, включая право на забастовку, в порядке, установленном трудовым кодексом российской федерации, иными федеральными законами - возмещение вреда, причиненного ему в связи с исполнением трудовых обязанностей, и компенсацию морального вреда в порядке, установленном трудовым кодексом российской федерации, иными федеральными законами - обязательное социальное страхование в случаях, предусмотренных федеральными законами - иные права, предоставленные ему трудовым законодательством.

как лучше внести изменения в ПВТР

ПОЛЬЗУЙТЕСЬ ПОИСКОМ НА ФОРУМЕ! Уважаемые форумчане, перед созданием тем, пользуйтесь, пожалуйста, поиском. На большинство вопросов ответы уже даны. Пожалуйста, будьте взаимовежливы . Наш с Вами форум - для приятного профессионального общения, сотрудничества и взаимопомощи. "Давайте жить дружно!"(с).

Пожалуйста, не оставляйте в форуме активных ссылок на другие ресурсы - это понижает рейтинг нашего сайта в поисковых системах яндекс и др.

Источники: fzfiqw.webnode.ru, ipgid.ru, oroja.vitour.ru, www.kadrovik-praktik.ru

Правила внутреннего трудового распорядка в 2019 году: правила и образец

Утверждение правил внутреннего трудового распорядка — что сказано в законе

Определение ПВТР и их роль в функционировании предприятий описаны в статье 189 ТК РФ. Из положений этой статьи следует, что правила внутреннего трудового распорядка утверждаются каждым работодателем в обязательном порядке. Этот документ регламентирует все аспекты рабочей деятельности в организации и составляется с учетом специфики ее работы.

Обязательного и утвержденного законодательно образца ПВТР нет, но это не означает, что каждая компания должна формировать правила с чистого листа и писать в них все что угодно. Есть два правила:

  1. Правила внутреннего ТР должны отвечать нормам законодательства и не могут нарушать гарантии, которые дает труженикам Трудовой Кодекс.
  2. Существуют типовые правила, которые можно взять за основу. Они утверждены постановлением еще советского Госкомтруда (№213 от 20.07.1984), но могут быть успешно адаптированы под современное предприятие.

Порядок принятия правил внутреннего трудового распорядка

Принятию этого локального акта посвящена статья 190 ТК. В ней сказано, что правила внутреннего трудового распорядка утверждаются работодателем, который должен учесть мнение представительного органа трудящихся. Процесс согласования также регламентируется законодательством, в статье 372 ТК.

Помните о требованиях статьи 68 ТК. В ней говорится об обязательном ознакомлении работников с локальными актами, это важный этап принятия ПВТР.

Порядок утверждения правил внутреннего трудового распорядка: 4 шага

  1. Разработать.
  2. Согласовать.
  3. Утвердить.
  4. Ознакомить.

Рассмотрим каждый из них более детально.

Как и кем утверждаются ПВТР: пошаговый алгоритм

Утверждение правил — это больше, чем просто подпись на соответствующем приказе. Ей предшествует комплексная и взаимосвязанная работа многих людей. Рассмотрим пошагово, как утверждаются правила трудового распорядка: кто и что делает на каждом этапе.

Кто задействован

Что конкретно делает

В какой срок

Шаг 1. Разработка ПВТР

Работодатель.

Имеется в виду орган управления или конкретное лицо, который уполномочен Уставом инициировать и разрабатывать локальные акты.

Инициирует разработку правил.

Принимает участие в формировании правил.

Обязательных по закону сроков нет.

Ответственный сотрудник с соответствующими полномочиями по Уставу. Чаще всего это кадровики или юристы.

Разрабатывает документ, формулирует правила. Формирует проект ПВТР.

Шаг 2. Согласование с профсоюзом или другим представительным органом трудящихся

Работодатель

Передает проект правил на согласование.

Нет законных рамок. Обычно — сразу по готовности проекта.

Профсоюз

Знакомится с проектом, формулирует свое мнение письменно.

Это может быть согласие или мотивированные замечания.

На формирование мнения у профсоюза есть 5 рабочих дней с момента получения проекта правил.

Работодатель

Если мнение положительное, сразу переходят к шагу 3.

Если есть замечания, учитывает их и повторяет шаги 1 и 2 до тех пор, пока профсоюз не даст согласие.

Ограничений по срокам нет.

Работодатель в сотрудничестве с профсоюзом

Консультируются, ведут переговоры с целью прийти к единому мнению.

3 рабочих дня после получения письменного мнения.

Оформляют протокол разногласий.

Строгих рамок нет. Обычно сразу после переговоров.

Шаг 3. Утверждение ПВТР

Работодатель

Ставит отметку «Утверждаю» в соответствующем грифе. Или издает приказ о введении правил.

Ограничений нет.

Шаг 4. Ознакомление сотрудников с ПВТР

Работодатель

Знакомит каждого нового сотрудника с правилами до того, как подписан трудовой договор.

Если штат набран, а в ПВТР внесены изменения, надо ознакомить с новой редакцией весь коллектив. Под подпись.

Установленных рамок нет. Но надо помнить, что пока работник не ознакомлен с правилами, ему нельзя вменять нарушение трудовой дисциплины и применять к нему дисциплинарные взыскания.

Работник

Читает правила. Ставит отметку «Ознакомлен» в специальном журнале или реестре ознакомления.

Правила внутреннего трудового распорядка подписывает работодатель. При этом в процессе утверждения нужны подписи других участников процесса: профсоюза на этапе согласования и работника на шаге ознакомления.

Есть еще один шаг, который не обязателен по закону, но может иметь место в компаниях, где профсоюз и руководство не приходят к единому мнению. Если представители профорганизации не согласны с принятием правил, они могут обжаловать это решение. Для этого обращаются в ГИТ (иногда в суд) или инициируют коллективный трудовой спор.

Особенности согласования

Перед тем, как утвердить правила внутреннего трудового распорядка, работодатель должен получить мнение представителей профорганизации. Но в некоторых компаниях нет профсоюза или другого представительного органа трудящихся. Кто согласовывает правила внутреннего трудового распорядка в этом случае?

Порядок действий такой:

  1. Если нет профсоюза, проект правил направляют представителю трудящихся, выбранному по статье 31 ТК РФ.
  2. Если и этого представителя нет, значит алгоритм утверждения отрабатывают без шага 2.

Выбирать профсоюз или представительный орган не обязательно! Достаточно сделать в правилах пометку в соответствии с требованиями статьи 8 ТК РФ.

В вопросе согласования есть момент, который касается не столько соблюдения законодательства, сколько эффективности производства. Дело в том, что соблюдение трудовая дисциплина непосредственно касается всех сотрудников на местах. Поэтому важно учитывать мнение представителей всех подразделений. Это не обязательно, но целесообразно.

Опыт многих компаний показал, что если правила внутреннего трудового распорядка организации утверждаются работниками, то нарушений дисциплины потом намного меньше, чем там, где эти правила грубо навязали.

Когда надо вводить ПВТР

В вопросах принятия локальных трудовых правил законодательство дает работодателям некоторую свободу. Обязательно лишь наличие ПВТР, а четких сроков утверждения и ввода в действие нет. В частности, статья 68 ТК (часть 3) требует, чтобы все устраивающиеся на работу соискатели были ознакомлены с ПВТР до оформления трудоустройства. При этом наказание за неознакомление не предусмотрено ни к КоАП, ни в УК.

Таким образом, время ввода в действие определяется тем же, кем утверждаются правила трудового распорядка — руководителем. Или лицом, которое по Уставу уполномочено принимать локальные нормативные акты.

С точки зрения проверок это означает, что главное — успеть до того, как на фирму придет комиссия. Рекомендуем принять правила как можно раньше, чтобы знакомить с ними всех соискателей при формировании штата. Ведь неознакомленный работник не несет никакой ответственности за свою дисциплину труда. Этот же принцип действует и с внесением изменений.

Правила внутреннего трудового распорядка утверждаются не только для контролирующих органов, но и в интересах производства. Поэтому нет смысла затягивать этот процесс.

Обязательно ли утверждать локальные правила трудового распорядка

Раз ответственности за неознакомление нет, можно не торопиться с принятием этого акта, а то и вовсе отказаться от него. Так думают некоторые работодатели и глубоко ошибаются. Утверждать ПВТР надо, за их отсутствие ГИТ назначает штрафы.

До 2016 года это требование касалось всех юридических лиц, но после издания ФЗ №348 от 03.07.2016 ситуация немного изменилась. Послабление получили микропредприятия — компании, в которых за последний год работало до 15 человек (ФЗ №209 от 24.07.2007). Таким организациям можно не принимать локальные нормативные акты, но тогда надо заключать трудовые договоры особого формата: с указанием локальных правил распорядка в тексте контракта (статья 309.2 ТК).

Разрабатываем кадровые документы правильно

Образец приказа об утверждении штатного расписания на 2021 год в 2020 году

Зачем нужен этот документ

Штатное расписание (или «штатка») составляется с момента создания организации и изменяется исходя из потребностей или финансовых возможностей работодателя. Применяется оно для оформления структуры, кадрового состава и численности, содержит перечень структурных подразделений, наименование должностей, специальностей, профессий с указанием квалификации и информацию о количестве сотрудников. Чтобы документ имел юридическую силу, требуется знать, как правильно составить приказ на утверждение штатного расписания, какими документами руководствоваться. Все правила и указания по применению и заполнению форм первичной учетной документации по учету труда и его оплаты утверждены постановлением Госкомстата России от 05.01.2004 № 1.

«Штатка», являясь одним из основных документов работодателя, включает сведения о структуре, количестве работников, фонде зарплаты. Необходимость изменения любого из этих элементов связана с разработкой и изданием обновленного формата, который утверждается новым распорядительным документом.

Когда составляют распоряжение на утверждение ШР

Это отправная точка, позволяющая использовать документ в учреждении. Бумагу необходимо разрабатывать в тех организациях, где применяется труд наемных работников. ТК РФ (ст. 57) устанавливает, что в трудовом договоре отражаются и трудовая функция в соответствии со штатным расписанием, и размер дохода, определенный в «штатке».

В процессе осуществления планирования оформляют локальный распорядительный акт о введении в действие штатного расписания, так как сведения из него применяются при формировании бюджета по зарплате. Этим же документом поясняют расходы на оплату за работу в целях обложения налогами.

Как составить

Единая унифицированная форма приказа об утверждении штатного расписания отсутствует, поэтому работодатели формируют его в свободном формате.

Документ составляется ответственным работником, на которого возложена такая функция (руководитель, начальник отдела кадров, бухгалтер). Предварительно необходимо определить общую структуру организации, чтобы правильно распределить людские и материальные ресурсы. В документ не вносятся фамилии работников, иные данные (адрес, телефон и т. д.), так как главная цель — определить структуру, численность и размер заработной платы. Распорядительный акт подписывает руководитель или иное уполномоченное им лицо.

Документ оформляется на стандартном бланке предприятия, утверждается работодателем и включает следующую информацию:

  • количество работников;
  • фонд оплаты труда;
  • дата, с которой новое вводится в действие, а прежнее отменяется.

Уставом разрешено определить и другой порядок, например, на правлении организации или заседании совета директоров. В этом случае дополнительно вносятся реквизиты соответствующего документа (протокола). А вот на сайте организации, как правило, не размещается и через почтовые ресурсы (mail, др.) не рассылается.

Постановлением Госкомстата утверждена унифицированная форма № Т-3, которая установлена во всех программных продуктах по учету кадров. Форма не является обязательной к применению. Федеральная служба по труду и занятости (Роструд) неоднократно в своих письмах указывала, что негосударственные организации вправе использовать формы первичных учетных документов, разработанные самостоятельно.

ГБОУ ДОД СДЮСШОР «Аллюр»

ИНН 123456789, КПП 123456789, ОКПО 123456789

полное наименование организации

ПРИКАЗ №

об утверждении штатного расписания

г. Москва

12.01.2021

В целях закрепления организационно-штатной структуры,

ПРИКАЗЫВАЮ:

1. Утвердить штатное расписание ГБОУ ДОД СДЮСШОР «Аллюр» согласно приложению к данному приказу.

2. Ввести в действие штатное расписание ГБОУ ДОД СДЮСШОР «Аллюр» с 12.01.2021.

З. Функцию по контролю за исполнением возложить на главного бухгалтера С.С. Сидорову.

Приложение: штатное расписание.

Директор

Иванов

И.И. Иванов

С приказом ознакомлены

Александрова

Начальник отдела кадров А.А. Александрова

Сидорова

Гл. бухгалтер С.С. Сидорова

Когда составляют на изменение

Такое распоряжение издается, когда требуется закрепить нововведения:

  • исключить вакансии или структурные подразделения из-за организационных перемен в деятельности учреждения;
  • ввести новые вакантные единицы в случае расширения производств или увеличения числа услуг;
  • сократить единицы;
  • поменять оклады;
  • изменить названия должностей или целых подразделений.

Оформить подобные изменения можно:

  • разработав приказ об утверждении нового штатного расписания и отмене старого, указав дату введения в действие;
  • утвердив новое.

Руководитель предприятия сам решает, какой способ выбрать.

Проводя процедуру сокращения штата или численности, работодатель не обязан вводить в действие новое штатное. Он вправе внести изменения в имеющееся. Это означает, что организация в процессе деятельности имеет одну «штатку» и приказами регулирует ее изменения.

Как составить распоряжение об изменении

Единый формат документа не утвержден. Работодатель вправе использовать самостоятельно разработанную форму. В проект следует включить:

  • дату введения изменений;
  • названия новых подразделений или должностей;
  • новое количество штатных единиц;
  • размер оклада, доплаты и надбавки.

Изменения вводят:

  • с даты издания приказа;
  • с даты, обозначенной в приказе для введения в действие изменений.

Это значит, что изменения вводятся позже: к примеру, дата издания приказа — 10.06.2019, а изменения — с 01.07.2019.

Приказ подписывает руководитель.

Что делать после подписания

У работодателя нет обязанности знакомить работников с самим расписанием или с приказом о его утверждении, поскольку оно не является локальным нормативным актом, связанным с трудовой деятельностью. Исключение составляют случаи, когда такая обязанность предусмотрена коллективным договором, соглашением или локальным нормативным актом (письмо Роструда от 15.05.2014 № ПГ/4653-6-1).

Как часто требуется утверждать новое расписание

Закон не требует ежегодно издавать приказ об утверждении. Но если в течение года в документ вносились изменения в виде дополнений, то в начале календарного года вводится новый вариант «штатки» — так удобнее в работе. Для бюджетных и некоммерческих организаций период, на который он утверждается, определяется собственником имущества и зависит от выделенного бюджета.

При введении нового варианта старый выводится из употребления. Требуется ли его хранить? Обязательно! В соответствии с Перечнем типовых управленческих архивных документов, образующихся в процессе деятельности государственных органов, органов местного самоуправления и организаций, с указанием сроков хранения (утв. приказом Минкультуры России от 25.08.2010 № 558) по месту разработки и утверждения, они имеют постоянный срок хранения.

Введение в работу с образцами FT-IR

% PDF-1.6 % 104 0 объект >>> эндобдж 149 0 объект > поток application / pdf

  • null
  • Некоторые методы работы с пробами более эффективны, чем другие, для определенных типов проб. Чтобы получить спектр наилучшего качества от вашего образца, важно знать, какой метод работы лучше всего подходит для вашего типа образца.
  • 2014-07-10T15: 50: 08.298-04: 00
  • Введение в работу с образцами FT-IR
  • 1860210cd6cd5e70562658192c799a28a1220e6cd70ed3b2014-07-10T15: 48: 37.301-04: 00 Библиотека Adobe PDF 9.9False2014-07-10T15: 33: 03-04: 002013-06-04T11: 36: 28-04: 002014-07-10T15: 33: 03-04: 00
  • 1JPEG / 9j / 4AAQSkZJRgABAgEASABIAAD / 7QAsUGhvdG9zaG9wIDMuMAA4QklNA + 0AAAAAABAASAAAAAEA AQBIAAAAAQAB / + 4AE0Fkb2JlAGSAAAAAAQUAAgAD / 9sAhAAMCAgICAgMCAgMEAsLCxAUDg0NDhQY EhMTExIYFBIUFBQUEhQUGx4eHhsUJCcnJyckMjU1NTI7Ozs7Ozs7Ozs7AQ0LCxAOECIYGCIyKCEo MjsyMjIyOzs7Ozs7Ozs7Ozs7Ozs7OztAQEBAQDtAQEBAQEBAQEBAQEBAQEBAQEBAQED / wAARCAEA AKQDAREAAhEBAxEB / 8QBQgAAAQUBAQEBAQEAAAAAAAAAAwABAgQFBgcICQoLAQABBQEBAQEBAQAA AAAAAAABAAIDBAUGBwgJCgsQAAEEAQMCBAIFBwYIBQMMMwEAAhEDBCESMQVBUWETInGBMgYUkaGx QiMkFVLBYjM0coLRQwclklPw4fFjczUWorKDJkSTVGRFwqN0NhfSVeJl8rOEw9N14 / NGJ5SkhbSV xNTk9KW1xdXl9VZmdoaWprbG1ub2N0dXZ3eHl6e3x9fn9xEAAgIBAgQEAwQFBgcHBgI7AQACEQMh MRIEQVFhcSITBTKBkRShsUIjwVLR8DMkYuFygpJDUxVjczTxJQYWorKDByY1wtJEk1SjF2RFVTZ0 ZeLys4TD03Xj80aUpIW0lcTU5PSltcXV5fVWZnaGlqa2xtbm9ic3R1dnd4eXp7fh2 + f3 / 9oADAMB AAIRAxEAPwD0Xp / T8A4GMTjUkmmuT6bf3R5JKbH7P6f / ANxqf + 22 / wBySlfs / p // AHGp / wC22 / 3J KV + z + n / 9xqf + 22 / 3JKV + z + n / APcan / ttv9ySlfs / p / 8A3Gp / 7bb / AHJKV + z + n / 8Acan / ALbb / ckp X7P6f / 3Gp / 7bb / ckpX7P6f8A9xqf + 22 / 3JKV + z + n / wDcan / ttv8AckpX7P6f / wBxqf8Attv9ySlf s / p // can / ttv9ySlfs / p / wD3Gp / 7bb / ckpX7P6f / ANxqf + 22 / wBySlfs / p // AHGp / wC22 / 3JKV + z + n / 9xqf + 22 / 3JKV + z + n / APcan / ttv9ySlfs / p / 8A3Gp / 7bb / AHJKV + z + n / 8Acan / ALbb / ckpX7P6 f / 3Gp / 7bb / ckpofYMH9vbfs9UfZJjY2J9T4JKb / T / wDk / G / 4mv8A6kJKcXqv1qs6bn24TccWCrb7 i8idzWu42nxSU1P + fFv / AHEb / nn / AMijSlf8 + Lf + 4jf88 / 8AkUqUr / nxb / 3Eb / nn / wAilSlf8 + Lf + 4jf88 / + RSpSv + fFv / cRv + ef / IpUpX / Pi3 / uI3 / PP / kUqU6 / QeuP6z6 + 6kU + js4dunfu8h + 6gp1k lKSUpJSklKSU5 + Zl9UrNZwcIZLHsDnONjWQT2hyQTIUaazs / 6yn6PTGDxm5h / wC / BJC3276z / wDl ZX / 26z / yaSlfbvrP / wCVlf8A26z / AMmkp08KzKtxmPzahTeZ31ghwGpjUE9klJ0lOf8A97 // AKB / + jElNjp // J + N / wATX / 1ISU5vUOu14eZZjOwbLizb + kaAQZaHeHmkpr / 85qv / ACtu / wA0f3JUpX / O ar / ytu / zR / clSlf85qv / ACtu / wA0f3JUpX / Oar / ytu / zR / clSlf85qv / ACtu / wA0f3JUpX / Oar / y tu / zR / clSl2 / Wljfo9OvbPgI / glSl / 8AnZ / 3QyPu / wBiVKV / zs / 7oZh4f7EqUr / nZ / 3QyPu / 2JUp X / Oz / uhkfd / sSpT0CSnB6s7FDsf1 + p3YB9FsV1FwDh + 8dqQ2XT + YueXdNcNp6 / kkdwTYQitW2dJ / 8vMj / ppKVs6T / wCXmR / 00lN7ozMD7e04 / VLst4a4 + k / dBEROvggp6FJTn / 8Ae / 8A + gf / AKMSU2On / wDJ + N / xNf8A1ISU5 + fm / WCnLsrwsJl1AjZYTqZAJ / PHdJTX / aX1q / 8AK6v7 / wD1IkpX7S + tX / ld X9 // AKkSUr9pfWr / AMrq / v8A / UiSlftL61f + V1f3 / wDqRJSv2l9av / K6v7 // AFIkpX7S + tX / AJXV / f8A + pElK / aX1q / 8rq / v / wDUiSlftL61f + V1f3 / + pElK / aX1q / 8AK6v7 / wD1IkpX7S + tX / ldX9 // AKkSUr9pfWr / AMrq / v8A / UiSnR6VkdUyG2HqeO3HLSNgaZkGZ / OckprZ4zj6h3Xp9Oa30my + 0sBB / dG8hIbLp / MWpt6xM / sPF ++ r / wAkktX29Y / 8o8X / ADqv / JJKVt6x / wCUeL / nVf8AkklN7pNeV6j3 5nT6cItA2Or2EmZkewlJTqJKc / 8A73 // AED / APRiSmx0 / wD5Pxv + Jr / 6kJKeY69TgP6te6 / HzLHn ZLqS3YfY3ia3flRU5 / 2bpf8A3F6h97P / AEkkhX2bpf8A3F6h97P / AEkkpX2bpf8A3F6h97P / AEkk pX2bpf8A3F6h97P / AEkkpX2bpf8A3F6h97P / AEkkpX2bpf8A3F6h97P / AEkkpX2bpf8A3F6h97P / AEkkpX2bpf8A3F6h97P / AEkkpX2bpf8A3F6h97P / AEkkpX2bpf8A3F6h97P / AEkkpX2bpf8A3F6h 97P / AEkkp6n6u5NduH9mpptpZjQ1vrRuduLndg1BKHqjsJpo + 09RvwXek2GUuc0OH7x2gpDZdP5i 5z7eikw / rmY6POw / 98RWsd / Qv / LrM / 8ABP8A0mkpW / oX / l1mf + Cf + k0lOz0AYRZc / CzLs1pLQ43b vaRPG5reZQU6ySnP / wC9 / wD9A / 8A0YkpsdP / AOT8b / ia / wDqQkpwOs5AZ1K5v7YfiRt / QBljg32t 7t015RU0vtY / + eCz / tu5JSvtY / 8Angs / 7buSUr7WP / ngs / 7buSUr7WP / AJ4LP + 27klK + 1j / 54LP + 27klK + 1j / wCeCz / tu5JSvtY / + eCz / tu5JTKvKxzuGR1 + 8jadvptuYd3afadPJJTH7WP / AJ4LP + 27 klNvBw8 / qLHPwut2WNYYcdtjYJ / rEJKbP7C65 / 5b2fc7 / wAmgp0em9OyMFzjdl25Qexgi1xdDxO4 tngFJSDNd1Eej9jwKsxnpN3Psc0EHw9xCQ2XT + YtQv69Ht6PjA + JdWf + / hJatu + sX / lRi / ez / wBK JKVu + sX / AJUYv3s / 9KJKbvS7Osm8szcKnFpLSd1RbJdpAhr3JKdVJTn / APe // wCgf / oxJTY6f / yf jf8AE1 / 9SElOP1TqnSMbPsoyunfaLW7d1npsdu9rSNXa6Awkpq / troH / AJU / + A1oqV + 2ugf + VP8A 4DWkpX7a6B / 5U / 8AgNaSlftroH / lT / 4DWkpX7a6B / wCVP / gNaSlDrfQD / wB5P / gNaSlftroH / lT / AOA1pKV + 2ugf + VP / AIDWkpX7a6B / 5U / + A1pKTUfWfpmMC3G6fZSHakV1saCfPaQgp1 + l9Ur6rS + 6 ut9QY7YRYACdAe0 + KSm6kpwOru6cHY / 2zPvw3 + i3ayndBHidrXJDZdP5i5 + / oX / l1mf + Cf8ApNFa rf0L / wAusz / wT / 0mkpW / oX / l1mf + Cf8ApNJTfxeiUZtDcnG6nmPqfO128iYJadHNB5CCnQ6d0n9n 2ut + 1X5G5u3bc7cBrMhJSv8Avf8A / QP / ANGJKbHT / wDk / G / 4mv8A6kJKQdVxbM2plNGa7Ce124uY TJEcaPZ4pKcz9g5 // l7d97v / AEukpX7Bz / 8Ay9u + 93 / pdJSv2Fn / APl7d97v / S6SlfsHP / 8AL277 3f8ApdJSv2Dn / wDl7d97v / S6SlfsHP8A / L2773f + l0lK / YOf / wCXt33u / wDS6Snf9Wr99v3hJSvV q / fb94SUu17HfRcD8DKSmSSlJKcPqmNXcaHP6lVgkVNGywMJd / K972pDZdP5i57sKhvPXqPkys / k sRWrfZMf / wAvaf8Attn / AJNJTa6eOnYlzrMrqlGWwtLRW5jGgGQd07neCCnZxM7p159DCuqeWgu2 VkaCdTA8ykptJKc // vf / APQP / wBGJKbHT / 8Ak / G / 4mv / AKkJKcXq2D9XLuo2WZ + U6vIdt3sDoAhr QPzD2jukpqfs36of9zHf54 / 8gipX7N + qH / cx3 + eP / IJKV + zPqh / 3Nd / nj / yCSlfs36of9zHf54 / 8 gkpX7N + qH / cx3 + f / AOYJKV + zfqh / 3Md / nj / yCSlfs36of9zHf54 / 8gkpX7N + qH / cx3 + eP / IJKV + z fqh / 3Md / nj / yCSm70x / 1a6VY + zFzATYA12906DX90IKdXG6r07Lt9HGvZZYQTtbzASU20lOJ1JzA aN3Sz1D9E39IBO3 + T9EpDZdP5i0jZVI / 7HHa / wAn / wBRpLV99X / zuu / zR / 5BJSt9X / zuu / zR / wCQ SUkx81 + I82Y3QbKnkbS5ggxzH0PJJTv0WOtprtew1ue1rnMdy0kSWn4JKaf / AHv / APoH / wCjElNj p / 8Ayfjf8TX / ANSElOd1zpRvjJwsSm / Je4Cw2 / ugR + 83wCSnJ / Y3Wf8Aytw / w / 8ASiKlfsbrP / фунт ч / ч / 6USUr9jdZ / 8AK3D / AA / 9KJKV + xus / wDlbh / h / wClElK / Y3WP / K3D / wBf + upKdjC6DguxaznY dLcgg + oGcAyePceyCk / 7A6N / 3Er + 4 / 3pKV + wOjf9xK / uP96SlfsDo3 / cSv7j / ekpX7A6N / 3Er + 4 / 3pKS43SunYlvrY1DK7ACNzeYKSm2kpxuotc40FvVm9O / RN / Ru2 + 7 + V7ntSGy6fzFo + 4af85G / wCa 3 / 0oitV7v / nkb / mt / wDSiSmVdd1tjaqvrEHveYa0NaSSf + uJKdzAxsjFo9LKyDlP3E + o5u0wY0iS gpspKc // AL3 / AP0D / wDRiSmx0 / 8A5Pxv + Jr / AOpCSnF68OoYmQcv9onFxrCGVsDXOg7ROjQedpKS nK / aeR / 5dO / 7bf8A + RRQr9p5H / l07 / tt / wD5FJSv2nkf + XTv + 23 / APkUlK / aeR / 5dO / 7bf8A + RSU r9p5H / l07 / tt / wD5FJSv2nkf + XTv + 23 / APkUlK / aeR / 5dO / 7bf8A + RSUr9p5H / l07 / tt / wD5FJSv 2nkf + XTv + 23 / APkUlK / aeR / 5dO / 7bf8A + RSUzp6tay5j7esOexrgXN9N + oB1H0UlPY02svpZfUZZ a0PaeJDhIQS5PUQ0miel / tD9E39Jp7f5OoKQ2XT + YtEgzDfq4CPMtH / osorVe7 / 522 / 5zf8A0mkp lXZdVY22r6uhj2GWuDmggj / raSndwcjIyscW5OOcWySPTcdxgd5gIKbCSnP / AO9 // wBA / wD0Ykps dP8A + T8b / ia / + pCSmv1nDzsyhjMF1LXtfucb2h5iDxurs1SU5H7C + sX + lwf + 2mf + 8yKlfsL6xf6X B / 7aZ / 7zJKV + wvrF / pcH / tpn / vMkptdN6P1GrILup / ZLqdpAbXUwHdpB / mWflQU6v7PwP + 41P / bb f7klK / Z + B / 3Gp / 7bb / ckpX7PwP8AuNT / ANtt / uSUr9n4H / can / ttv9ySlfs / A / 7jU / 8Abbf7klK / Z + B / 3Gp / 7bb / AHJKV + z8D / uNT / 223 + 5JSdrWsaGMAa1ogAaAAdgkpx + oloNE9U / Z / wCib + j0938r UhIbLp / MWnLP / ni / 6n / ySS1iRW4yfrEfkQPyPSUrZV / 88Tv84f8Ak0lK2Vf / ADxO / wA4f + TSU63R qtlVlgz3dQa9wAeTIaRyB7j4pKX / AO9 // wBA / wD0YkpsdP8A + T8b / ia / + pCSnC + seN9lu / aFubk1 V3ODG1UCdpDR42s / dSU4v23F / wC5 / UP80f8AvQihX23F / wC5 / UP80f8AvQkpX23F / wC5 / UP80f8A vQkpX23F / wC5 + f8A5o / 96ElK + 24v / c / qH + AP / ehJSvtuL / 3P6h / mj / 3oSUr7bi / 9z + of5o / 96ElK + 24v / c / qH + aP / ehJTs4XQ7s / Fry6ep5TWWglofIOhI1i0 + CCWwz6tZTLGvPU73bXBxBmDBmP5xJT vJKUkpxOpTNEdKHUf0Tf0hIG3 + TqxyQ2XT + YtP3f / O23 / Ob / AOk0Vq3u / wDnbb / nN / 8ASaSl / d / 8 7bf85v8A6TSUr3f / ADtt / wA5v / pNJTt9KaBhtP2QYJc4k0CDBmJ0DeYQUj / 73 / 8A0D / 9GJKbHT / + T8b / AImv / qQkpz8 / q / VcXMfRjdOfkVNjbaN0OkNJ4aRoTCSmv + 3euf8AlRZ97v8AyCSlft3rn / lR Z97v / IJKV + 3euf8AlRZ97v8AyCSlft3rn / lRZ97v / IJKV + 3euf8AlRZ97v8AyCSlft3rn / lRZ97v / IJKUOvdcIn9kWf9L / yCSlft3rn / AJUWfe7 / AMgkpX7d65 / 5UWfe7 / yCSlft3rn / AJUWfe7 / AMgk pX7d65 / 5UWfe7 / yCSnW6dk5OXjC7KoONYSR6bpmB31ASU0OoloNE9U / Z / wCib + j0938rUhIbLp / M WnLP / ni / 6n / ySS1EX0kkn6xP + QI / I5FSt1H / AM8Vn4 / + SSUrdR / 88Vn4 / wDkklPR4T2WYlLq7ftD dgb6375b7S75kIKa3 / e // wCgf / oxJTY6f / yfjf8AE1 / 9SElNDrQ6NnAYXUMsUuqcH7Wva1wJHfcH dnJKcn9i / VT / AMsXf9u1 / wDpNFSv2L9VP / LF3 / btf / pNJSv2L9VP / LF3 / btf / pNJSv2L9VP / ACxd / wBu1 / 8ApNJTd6XV9XOk3Puxs8Oc9uwiyxhESD + a1vggp0 / 210j / ALMU / wCeElK / bXSP + 5lP + eEl K / bXSP8AuZT / AJ4SUr9tdI / 7mU / 54SUr9tdI / wC5lP8AnhJTOjqfT8mwU4 + RXZYZhrXAkwkptJKc fP8AU / QbOlM6iPSb + keWAt / k + 9jkhsun8xaZGVPt + rtAHmaj / wB8CS1bbl // ADu4 / wD4H / 5FJStu X / 8AO7j / APgf / kUlOph9Ow7sZluV03HotdO6r02O2wSBqG + CSm9XVXSwVUsbWxv0WsAaB8AElNL / AL3 / AP0D / wDRiSmx0 / 8A5Pxv + Jr / AOpCSnJ + sXT6BtzKcWi7IseGvN9hYIDY721ifaElOH6F / wD3 A6f / ANvj / wB60VK9C / 8A7gdP / wC3x / 71pKV6F / 8A3A6f / wBvj / 3rSUr0L / 8AuB0 // t8f + 9aSl242 Q5wDen4Bc6AALwZPw + 1pKT / sjq // AJTYv + ef / elJSv2R1f8A8psX / PP / AL0pKV + yOr / + U2L / AJ5 / 96UlK / ZHV / 8Aymxf88 / + 9KSlfsfqx / 7x8X / tw / 8AvSkpLjYXXsO4ZGN0nGrsbIDg + eRB5ySkp3Ol X9atdZ + 1seugAD0zWQZOszFj0FNTqhrBo39Ud08 + k39G2fd / K0ISGy6fzFo7qP8A54rPx / 8AJIrW G3GOp + sVuvg54 / 7 + kpkymix7a2fWG5znENaA5 + pOg / PSU3v + buf / AOW + V97v / SiCnWwcezExWY9t zsh7Jm2yS50knWSeJhJTW / 73 / wD0D / 8ARiSmx0 // AJPxv + Jr / wCpCSnO6zm / V65 / 2DqtpDqXBxYB ZoS2Rqxvg5JTl7PqP / pHf + Df + RRUrZ9R / wDSO / 8ABv8AyKSlbPqP / pHf + Df + RSUrZ9R / 9I7 / AMG / 8ikpnUfqVTYy1ljg5jg5pi7kGR + akp1f + dHQv + 5P / gdn / kEFK / 50dC / 7k / 8Agdn / AJBJSv8AnR0L / uT / AOB2f + QSUr / nR0L / ALk / + B2f + QSUr / nR0L / uT / 4HZ / 5BJSv + dHQv + 5P / AIHZ / wCQSU3MLqGH 1Gt1uHZ6jGna47XNgxP5wCSnP6iLyaPS6XV1Aek2bLNkt / k + 8FIbLp / MWnGZ / wDO7j / + B / 8AkUlq tuX / APO7j / 8Agf8A5FJS7ftrHB7Pq / Q1zTIINYII7j2pKekSUpJTn / 8Ae / 8A + gf / AKMSU2On / wDJ + N / xNf8A1ISU0us9MtymizApxjkFw9R99bHEtAjlzHeSSnK / YfXf9F0 // tmv / wBJIqV + w + u / 6Lp / / bNf / pJJSv2h23 / RdP8A + 2a // SSSlfsPrv8Aoun / APbNf / pJJSv2h23 / AEXT / wDtmv8A9JJKV + w + u / 6Lp / 8A2zX / AOkklK / YfXf9F0 // ALZr / wDSSSnU6X0drMdw6ri4j7t52mupkbIbH5je8oKbf7J6 X / 3Dx / 8Atpn / AJFJSv2T0v8A7h5 // bTP / IpKV + yel / 8AcPH / AO2mf + RSUmoxsfGaWY1TKWkyRW0N BPj7QElMqP5mv + qPyIDZdP5izRWqSUpJSklKSU5 // e // AOgf / oxJS / T7 / wBQxh / wNf8A1ISU4nV8 6 + vqNrGdUGK0bYp2vO32t7tYRrykpqjOySJ / boH9iz / yCKl / tuR / 5fN / zH / + QSUr7bkf + Xzf8x // AJBJS / 2zI / 8AL5v + Y / 8A8gkpX2zI / wDL5v8AmP8A / IJKV9syP / L5v + Y // wAgkpX2zI / 8vm / 5j / 8A yCSlfbMj / wAvm / 5j / wDyCSlfbMj / AMvm / wCY / wD8gkpX2zI / 8vm / 5j // ACCSlfbMj / y + b / mP / wDI JKdr6vWXWtvfZnDPbLQ0gEbCN0 / SA5kIKdWj + Zr / AKo / IgNl0 / mLNFapJSklKSUpJTn / APe // wCg f / oxJTWwd7cPHnUCpn / UhC005HUjfb1G30cfEsHt1uLA / wCi36Qc8FFSA05wP9E6f / nV / wDpVJCv Szv + 4nT / AL6 // SiSkjMHqzwHM6dhOaeHNDCD91iSmf7O6z / 5W4f + az / 0okpcdN60f + 8zC / zWf + TS Ur9mda / 8rML / ADWf + TRUv + zOtf8AlZhf5rP / ACaClfsvrf8A5WYX + az / AMmkpX7L63 / 5WYX + az / y aKl / 2X1v / wArML / Nb / 5NJSv2X1v / AMrML / Nb / wCTSU63QcfqOMbm5mNRjMdtLBQAJOszDigp1KP5 mv8Aqj8iA2XT + Ys0VqklKSUpJSklOf8A97 // AKB / + jElNbDfOFR5VM / 6kJlstNDN6PhZOQ7JuL91 gH0SIkAN8D4JwKyQWr + q3TgQh32ExJaSBH / RRtayf9W + lMIk2AHT6X + xK006OHXRh57cXHJLGTAJ k6ku / igpuUEOYCeSkpLoNeElK3Ad0kLghFS4KSmSSlJKXSUpJTCj + Zr / AKo / IgNl0 / mLNFapJSkl KSUpJTn / APe // wCgf / oxJTmY94bh0awBUyT8go2dd95cxzHGIhzHDXjVOCyRCan7bmUB / qs2u1ad vMfBOBpjq1m3V1kDLsBe2QQOPigli7OxmuisucPGISoqtJVngODgHR5oobjtz3c9pCCmdVYJkmR / FFSb2tgDRBLKR2SUvKKGQSUpJS6SmFH8zX / VH5EBsun8xZorVJKUkpSSlJKc / wD73 / 8A0D / 9GJKe dZkfZ8WptgLXmtgAI8gmCJtmlMUuy0OrLgS4R2B / InsTr4F2PbVXTTYAdsAN5HySIQGhl2sGVEyN pEnSSD5JBRQPuYOOUlLHKAYdeySnaquLvTsadCwSJQTSUXuqbAiJ0kpKZV32Wn3NDPAl3PwSUnbv 8o8QZSUkadYRQkCSl0lKSU125WNRVW2 + 1lZLGkB7g0xHmUBsun8xV + 0MD / uTT / 243 + 9Far9oYH / c mn / txv8AekpX7QwP + 5NP / bjf70lK / aGB / wByaf8Atxv96SklV9N4LqLG2AGCWODhPySU0 / 8Avf8A / QP / ANGJKRehVd02tt7A8Cpp18gEEtOzoWLY8ZAte2IAa3QR5pKVhdFoxLftDS4WtcS3a4xtPGiJ JKKplk9HxLnPul7LXSdw4J80LTTyp6gJLY47py1gc95BAAE6alJTuYXVqBRWyxwaWtAl2g + 9Npdb oU + jkt3s2PB / OYSdUEptr6w1rHNDRyHo2htU3tgBz2T4B2iKGyx7SRBQSmCKF0lKSU831x2ELMf7 Vhsynei2HPyRQQJOm2RPxSGy6fzFzN / SP / Kun / 3ID / ySK1W / pH / lXT / 7kB / 5JJSt / SP / ACrp / wDc gP8AySSkuKOg23trycCnHqM7rftu / bAJHta + TJSU9L0rH6ZRjn9lbfRe4klri8Fw05cXIKYf97 // AKB / + jElKZ7un0juam / 9SEEoRbPt7D + CNIZCwNg940SpS77y8hjjpBlKktTI6V0zqAqfkY7Sa5jb 7ZB7O2xKSGvd9VejXFzmVupcRoGOO0Hx2n + 9FSJn1SxwwD14f3IrBH / SJQUjv6PnYrCGOstrbxtt FYj + qAENU2GmzR211Qa + SJsLnEHzkoEpGrp9MteBDi0n + S0NCVpp26HSRKK1stPuhFCRJSklPMfW AxbjagfoG8vpb3P + m1SGyZ / MXK3fym / 9u4qK1W7 + U3 / t3FSUrd / Kb / 27ipKVu / lN / wC3cVJT13RX h / TqnCsVACPaWuDo0L5r9uqCWP8A3v8A / oH / AOjElI6iW4lM / mtbPwLQglzn2ObY6oaBp5KeFpS1 v3GZkDukpI97dpjVxEfAIJZ0vIrCSkwfCSkjbGxMpKc7ruYMaihx1rfaGvPgCDB + 9Ox1xMea + Fo7 67RLYf8AipjAFgjMjZLh30uPsG0tMPbGo + SiyYqFhnx5iTRdjGe0kAEn5EflUQDKS2qzLyihMkpd JTzh2gE242gP6BvLKXdz / ptUhsmfzFzKqLrnbKavUdE7WUYzjHyRWpv2b1D / ALiWf + w2P / ckpX7N 6h / 3Es / 9hsf + 5JTKrp + ay1j7MF9jGuBcw49ADgDq2QO6Sno + m5Nlk4 / 2B + FWxstnaG88AN + KCVv + 9 / 8A9A // AEYkpDjvnCYHf6NuvwASS4f1g6jV019Lywv9YHcQY1bHilxUqraDfrVgAAEWMPf2g / xR 4wjhLbo + sfSbRtZa4nkjYZ / ilxBXCVsfqmTblvewFlMQA4akfBNEiSkgAKzOu3U5FFOLRblvudsO z2hnmTEQnao0dR3qOHvJ + AOiFqa + bisyqwy4bwOASe6VoIaLejsbYLKn2VuH7p0 + 5SDKQxnEC6VO JZ6rLZAc3lwEEjwKMsoIRHDRdpri5oIChZ2VD5efNOKA2ggpdJTjdSdisNLcnpluc70h72Vb9v8A JJSGyZ / MUGPn4uLZ6uN0TKqfEbmUQYPZJDco63Zfcyk9PzKw9wbvfWQ1s93HwSU6iSlJKUkpz / 8A vf8A / QP / ANGJKaNNgGMwHT2N / Ikl5f67uJqxXDgPePwCEgkF5vp9Jys2qlwJYXS / + qNSgBaiaezp xaWQcZjGtjhrQD96fVLLSVMYbiH66SPmlSrbLj9lh5qfY06E1iYHiQkBapGm1TfTcwPY7Tj3AtP3 FIiioG0ns8QglC / Kx2OLAS5w5DGk / wAEFIj1bFq1cSPjAP3alKlOjh51d7JrB + eiSW3UGl24aHuE lNpvCKFnvZWx1ljgxjAXOc4wABqSSUkgEmg1W9Y6S8w3NxnGCYFrDoBJP0uwCbxx7sp5XMP0JfYW 21zXNDmkOa4SCNQQU5hIpdJSklKSUpJTn / 8Ae / 8A + gf / AKMSU45ujFE87G / wSS5PXsZnUKqW6hrC XHaJ5CEioByfsleBW67FBN0Q0nzOqUNSqQAdOm19mGL3tsY5w92yQI81IsLLEcKbXvcHAOjmSSB8 U72yVnuRdTHy2PdsreJ / dKaYELhIFujc76VYd8DH5UxciyhXiYF2Za0B1bC / aToD2CSXhLsvrXWr xTW617Hu2n0wRVX5vIjRGkW72J0TqDLW7hXa1g2y18zH8kwkoF6PFpsqaA9hb5RA / BBLfpY / mCPB JTcZMapKVZWy6t1VrQ9j2lrmnUEEQQUiLTGRibDx37Pwa6PrBYyljXYxc2kgasBYQQ3w5VXhFSdr 38hlgBO + / wBrYf1jquBV9mD2WNbXih2dob6LLQQ9xkkQNo1KPuSiK8mMcrhyni / vad6T4XVerZmX i4zLqtj / AFnOt2bg9lTmgFujBJmJGngjGc5EBjy8thxwlIg9NPP + Xmhwesday2dPJyKweosyf8ED 6ZomCPcJmEozma13X5uVwYzP0n0cPXuj / wCcnUX4wvfczHeMZltLNgd9psLixzROvbhuqHvSpd9w xCdAX6qOvyh6ulz30sfY3Y9zQXN / dJGoVgahyZgCRAaX / e // AOgf / oxFa0Mdjh5zBa0Oa5rRB76J BJSNYyoCqpoa3wSCix + w4TXm0Us3czE6 / BKkWl3N0rgbXaEdoKKnkTmsFttLtHUvdWf7JVwCxbnk 1IhqV2ZNeWHyh22O0PBbKdemy0R9W72FJcypgcdxgS7x81ROpdAaBM + mu5m23UEatdqD8iglpno1 DH + rjNa10zy4D / NBhGyqg3KcdzSNzdfJBLerEDlBSZr0kphwihdJTV9LODbB6oJNm6vgEMmdpdsj / o / OdUlMrq8sh4pWAE2Nc0HSGANDmztdyQSkpi6jONmSRkxXa2KG7BuqdETP5w76jx + SUyvpynhw pv8ASBFe07QSNrybOf3m6JKZWsyCCanj6YIB09sQW7tro114SUmSU5 // AHv / APoH / wCjElOdhOfb VU86NaxsD5IqZvya2EwZd + RKkW13ZTrnBlZMdz4o0pf1K63gvOg1cSeANUqU + PZh2nsf1O + 6ioCt 9ziTuMmXcp8ZyDFLFGRbOV1zIou3HJDY4b9L8EfektHLwpt / VHr / AFPN + sOJ0 + jKudVfbutaTLNg Bc6A6ewURNlmEaD64XBok6BBLDIsZTRZf + 40kR49kYxuQCJGhbm4fWMotAs2u84g / grE8EWGGaTr Yl7r5LgBHgq8o0zRlbcZymr2wEULpKaF3SWXW2WjJyqja0tLarS1oJFg3tb2d + k58h5JKXt6TXb6 cZGTV6e2fStLd + 1u33xykpg / o1b2vacrLBeZDhc7cyQwQw9vofiUlMLehV21Co5ua0hxeLG3neJD mwCQdPckpX7Ar2vBzc4l0Q43ulsd2 + CSnUSU5 / 8A3v8A / oH / AOjElPL / ALZaKq6nPbWGtaNoPkpK W2hs6rQ2ZIPzHdI6BI1QW9frqYRVtE992qZxhPAXkOt / XHrFjLsOtldJe0sL2kuO06HbOmoTgbWn R4otc06oEFNrEEcpqXsP8VtbD9ZTfYQ0UUWOBJjV0N / ikp9eGTj / AOkZ / nBJDndczaK8RtLHsm1 + sOHA1U / LC5Ww8wajTl4 + TUIHqD5kKebDF6PpmRRsJNjO35wVTJu2sezosycef51n + cExkTjJxv8A SS / zh / ekhT8zDraX2X1saOXOe0AfeUlIv2t0r / uZj / 8AbrP / ACSSlftbpX / czH / 7dZ / 5JJSv2t0r / uZj / wDbrP8AySSlftbpX / czH / 7dZ / 5JJSv2t0r / ALmY / wD26z / ySSlftbpX / czH / wC3Wf8AkklN H9p9N / bnqfa6Nv2Tbu9RkT6nE7klP // Z256256
  • 2JPEG / 9j / 4AAQSkZJRgABAgEASABIAAD / 7QAsUGhvdG9zaG9wIDMuMAA4QklNA + 0AAAAAABAASAAAAAEA AQBIAAAAAQAB / + 4AE0Fkb2JlAGSAAAAAAQUAAgAD / 9sAhAAMCAgICAgMCAgMEAsLCxAUDg0NDhQY EhMTExIYFBIUFBQUEhQUGx4eHhsUJCcnJyckMjU1NTI7Ozs7Ozs7Ozs7AQ0LCxAOECIYGCIyKCEo MjsyMjIyOzs7Ozs7Ozs7Ozs7Ozs7OztAQEBAQDtAQEBAQEBAQEBAQEBAQEBAQEBAQED / wAARCAEA AKQDAREAAhEBAxEB / 8QBQgAAAQUBAQEBAQEAAAAAAAAAAwABAgQFBgcICQoLAQABBQEBAQEBAQAA AAAAAAABAAIDBAUGBwgJCgsQAAEEAQMCBAIFBwYIBQMMMwEAAhEDBCESMQVBUWETInGBMgYUkaGx QiMkFVLBYjM0coLRQwclklPw4fFjczUWorKDJkSTVGRFwqN0NhfSVeJl8rOEw9N14 / NGJ5SkhbSV xNTk9KW1xdXl9VZmdoaWprbG1ub2N0dXZ3eHl6e3x9fn9xEAAgIBAgQEAwQFBgcHBgI7AQACEQMh MRIEQVFhcSITBTKBkRShsUIjwVLR8DMkYuFygpJDUxVjczTxJQYWorKDByY1wtJEk1SjF2RFVTZ0 ZeLys4TD03Xj80aUpIW0lcTU5PSltcXV5fVWZnaGlqa2xtbm9ic3R1dnd4eXp7fh2 + f3 / 9oADAMB AAIRAxEAPwD0THx8c0VfomfQb + aPAJtpZ + hisMekwnt7R / cgZAKpeynGa2fSZ / mhMnk4QuEbc + 9 + O06Vs / zQs / NzdNjHitqOto / 0bP8ANCqS5uRbAwBh6tI / wbP80Jv3qS72Qqcc67Gg / wBUJ45ko9pd ttbPpVs + O0KeHMlacALZquxzzWz / ADQrUOZthlgpOLcYAg1smJHtCsDJYYZYqQDMoJDRSyf6n + xU p5c3ZcIRTOqwyxzy5oJHZrQPyKOUwdTIqrwabh2ztrpbaB + ftAlQxzT6JMQy3tYS66hrW + IAMfFO PMZBujgB2TNFDmhzamEHg7Qpo81Ix0WmGrC1 + O32Gpu5wgDYNfwUU + dlHRIx2578Sqt8GtoDtRoF LCfGPFB0V9mp5FbfuCBBTajiUkyGNH9kKvl5cy2K6MwFfZGf6Nh + QVY8rmX + 5Fr + hV9q2bGbvTng R9L4K392PscN + rdZ7nqt6OrJDceoT + Y38i0p5gGMRRuzA4bgfgqs + ZXCDUv6k7gHXwUU85kGbHja b8ut + pe1p7iZP3BU5xJOrbhCkJyaB + cT8NP70wQDLwlicqgDcZA + J1 / BO4R2VwyXGTSfcTHlP94Q 4R2VwSSNtrdoHc / vD + 6U4V3QQVnCxg3M1HlqpYkhGhSMyXlo8RqNVYhkKyWINqrJa9m53tlXMU + K OrVyYaLAs3NdFjog6af3JkuTxkWxmUg0nZdtLQGOdppCoTBjKggUVUZeTmPND3kAjXsmnUi11CIt v1sfU0A2S1o7cpnAQd9EGQLGy2i0b2hznN + iROhSkYkaKAIc23OySAHMePJwhKFxN2v4IpaOocNs Gv4ferQzg7scsRGyf7fjDlwBPEkJ4lErOGSK7qdTQYM + TdSmnIAkYyXK / a7vt0 + kY2bY78 + KGtXa / wBsOqeoTTWxkuLmtGnwTckybWkq9ewj92FW6s0Ylr3w / WS7xEwPwThkrRsQjSJlRadzGtae2gRu UmYzERq2Q9lVRvyD7AOQAN3y8EoizTBKd6rMm39Lc2CfosI + iPPzTjGI0C + AluV3047vpt08Alwx DJxSa9lDG / 0d + wnsdUqBXiR6hCXZ1Org54Hdh3 / gkBFeBjkrecjWRW7u5sz / AGgU8Gik1BPRg3tO 4P3B2sgnlTRmxTyxK4ysyrex7SRtPb + KsYJmVtbJCJajTZkHS3Yf3TqocghbUMSEtWPfQ4vD95Ig ToPwURhGY0W8ZDMHOsdtPtb5uJ / gmnAFDIE4yjg1tx90hvBd3 + ajnCVpsSXF1eZVNjog / mmPxUfC YlN0hyLMfHpIDvo66mUREyKgbLRb6WYSCQQyCI8fipTcF3FTN2O5wLWTPiEBJHG5f2Tqv2v6Hafp jjhWOPHwq9wW7WO8ua2PzWNE / EKtPRUNS2WguEdlCdWzAJHOqxqzdZ9EfMkngDzUuKNnRfKQjGy1 3WMxrnO6gQ32B4ob7nGeGmOIVqGISjcWpLKTLVm31r7Rl5bdm3 + Zx / 3B + 8 / + V5dvio5zENA2MOIn 1SZPdY7jQKKyW0AGAY / kuKBTaRu4DRC1pXa5wJ0j4JarSwdhPyXh7GFpH5w0 / BSQC33TFv4VWRjO O4NcCI / 3yn8BjqGCchNHmvtDH + wMBBBPbjxUglPsuA0eafsDjBLXJ0dmKabGzHUvi0F3g4oHh3a8 i3R1KoOa0DUkKMCVorRM57H6ynLLQ2En6Dtv4hNMAUidIW4wsduveS3wAAn4oS9I0XCZKRxxwIHt juNEz1FbxFG24Vl2xzneWn + xO9uwoz7q9W77TMt / m / nylwelZxi23g1VeiyWudIBJmNYVfLP1NrF GRG7dLaGNLyDW1olziZAA7qOyTo2o3EalyOoZ7sY15HpuuyLTHTsQA7y46C17fPt4K / iwkgx2H6R / Y1suXiPEfoP2pejfV7KouPUuquN2Zb7na + 2scwPE + aWfPIx4YCopxRhh2SPqd048QWbBOonn8VT jZ3P26M4yghY0Wu0dtP3Iy4gN / xUMsPH8UVmGGw0CHeIPt17Soo5L62uGfWlmYw4LwPlKeJrpT8E 7cNobua4E + YhSAit2I5Dey9bnA7ABqlElBkCm9InXdH5FYiFnE5We2 + n1Sx4LSw7mHgyDr8VLGQ2 LLGUZDV5g5La3a1Bxb + YeR8EhjsbsWRG3MpfIsDmT8x / epfbkNmtMhdmQ6p29o9ZvlDiPlKRgJb6 MRnWzZHUw5ktmf3Yg / lUfskFbxgrs6kyATKacRUTTM9Qbb7WiPNIYa3VxInb3nWwx4QE4QAV7iel h5aDA1JKbKQCyyWPqD7Ty3ZsiJ7z48JcPpY + M29H03peS3CodeWte5gLhPEqHJy + UzPDs3cMYRjq hz8bqJyBXW2t + NUA5wLj + ksM7GnTgGFb5bljCBMj6zt4KyzHEBEaJOk9Eux3Ozc17cjqFs + rc07g AfzK9AWtUXM4MsvTHSLJhyRGpGrpDFc0h4hr3VWfIZTHcfazHmI0xyMfMNLvswAc7hzzAbPeNUcP IGMhxnboGPJm9OgZ / ZHTAh0cwoZchmPZl + 8Bd2JZYdj65aADz3BmdEsXw7LjPEJi / r / BhllEjsoY jhq47fjx + RWByk + oifIlJy + JTDCtj6Q + 5OHL / wBX8VpyHuibgWeu + xxD3BntjT5Qp / YJiABS2OSj bYrxTsBMT37ox5YxT7ltbMwQabCGtc4tI8OQnnDpskZC8tk9Cyb2Q6qCBLTIDgFDixZYruIuHmdJ z8d36WsuZ ++ 2J + au48cixZGoMe0GWHd89fuU / wB2n2akyzbXnE / oS4EdiZh5pn3YnQhbZZsZc9 + z JAY / 7gfmEjyU60QMtGi3a8W2sSGsA8T / ALVHLk8i8zCVlWXZ / NAEfvaNb96h4DIs472S04ObkPLa vcIh9sw0fyQlLkMsRqAtEhLYs / 2Xd9r + zS3d6cbfnKi + 7ZOKurL7R4LrR7Hp2RV9kqa6twcGN3Ee 7t48p + THK92zAsraMa64Xn1pEEsaCGu28SjEyjGrCiLNr3ustoltZYefUcYI15EJQEYy3RZpsC3c JqaXgfncA / AqMwrc0v4rC1r7tg9jRJH53n8EoiN7rSUDXZOODtZNckgh4RJ8W6qQiE9zqiyAzZk2 vduFW4ED6LgmHHEdVA2vdfkCt0VNaI1L3T + ARhCF7pkSrGteWsoaQ2GBxc7l0 / ujyT5RBJkgFNW1 / qv9xJAHgjemyAzLZPP8PyJwKis / 0iwh / YahOoKtyL + oVsEhhd4cKKMJd2QyDn3Z + Pc8C + otZOpb B / uT / bl3RxhV3Ren5TBbW1rmu4c1TRy8LHKILRd0B7SfQtcG + Zn8oKcMvZaYLHoFtg22P3jwOn8F J70hsxnEDutX9XjVWbm + pLfzR7jPkCm / eZgbJHLxlKrpujpDBSx + bvO4gBr3aBx4B2phznSxS + OD 1GjboVY9eNhvZmVtZWwRzIdOuiRmRE8S / gEpjgcTd / lT1Yrj052yY5jxmFV4tbb / AAaVbs0dTdZR hWCk1N9k3PIbIj6LRy6VFPNHHxA6n90a / wC854JNFvP6vS6txpY + 7kD0xIJ / raBQRlMUZAR / vH9i ++ LbVrWdWsdglv2O4uIgt08YPBUoyQGT54 / b / Yt9XDsVYnWCKWVtZtdECvIJqcPAB22Cn5JAkyI0 7xqQ / igS0 / irJ6tkNZUDiO9z2iW2MIPw1CbDJgN1P8D / AASeIVoser3 / AGaXY4r3EgOfa3WT22bk DmwCXzX5A / tR6q2aeB9Ya5IrqNll9xDGztBiXOdqNGgBPy5L1IoRColu5vUw3CN9haAWkgMkz8zC ixczEzoRP1KZDTdni5wvxw4NDorY7a7TkaahSHmBGW34qrRli9Qb / OWMNTHna0h + 4bhy06Kc5L21 QG6 / Jazx + 8f3JQyX0TSD7U21rwBBiJlPJtQci5kaIAUkloW16mE8ISYWXbgvke6p306zwfMeaJAK regxW05VYyMZwNT + I8RoQoOAgribDTyMu4XOrxmghhLS46mRzopox01KwlgOoZlGtjGvbHJBaf4o mOmiOrK / 1s7Dx / UdsNjiHNA0IbqXx5KsZGQDdhGOOZpJnPx6ul1UBxc4gOY4giQOTr3T5yHAArFC XumTz3pt + 28CfS + fKhvRtV6mGVkG7AwA0h5btlpMTEaJvLYvLYvbyyJBHjTjSmCHYp6iPQDciaXhv0X t2Djt2VTJ8PyGVwHEO41XDONi5j8ys9DLQ8bt / E6 / SU45XJ798J + xbxjh4Z4WcD0kUkG50wa4L5C dPkcvvcVcPjsoZRw1bWZk2jGxhdoGZJDQdS1vIb8k / NiEsh5ddPxUJUG0TlW4NDK6XzSQ5 + 4BoEz H0o8Uz7vGMyZTiL8UcZI0BaHTMaw0hj2P3te7bbU5pLSQQdJ1HiFYnGAkanGj0NrQSRsW11N + SzF bhug7W7Q7VroP7zXJ2HksZPHE / th3hBym6LfxDlVY72nHs0bW2QJHtb5KM4IE / PFl4jWymWPZ0 / 3 t0c8ukkaknsFLHHET3 + xN2HS3EVNb9IhoEn4JAWUrVtv9NxYGifFPMU25 + RTmu5vaz + q2fyo0q3J 6iyrCxrMzOyrRVUNziNPLQCe6QCreTt + unRW2EMw78hv79tu0n + zqnUi3a + rn + MDp5yKsOhlmE57 4ZW73VOLuxjifggY2q3Ws6g77Zc7cGl1jiWzwSZjVIKXuzXPZsL9XGAJ5lFTtdYa2nLYaHCNgA2u 0BiDACq5QBLR0eW1hq5tl1haG + 9xngGT95 + CZuy7bNbeftP50 + l5b927wRpF6udd1dhxcWcekhob uEESPkVNjnnEj6y4cowPR0beu1Mx2 / Zi5gIG7Gs / SMIOntLtQosWCWbIeL5v3o6H6rrERpt2alnW LHdOc0U0bw + ARWJgFPiMoy1xy + 1BI4dmP7Zz29NbTU70pkO9MBpOviEpcnKeXikCfO0DKBGgUXTH 5QdS + hu99Je / adefztVLPHECUZenioWqM + yrcvLc245JeXvsa73TwCmHkJwqo6eCPeB6tLDufU2s QRD3n8EcmGVnRIkG + 3OyfUqaJe007HtdqCPDVDHy8hqBRtJkC2aMqxuLa3cQC7QSfBSZ8Y4x3XRL b37vRZ + 60IYxuuLt750HwQiEtqvSo / NSFLSyEFPMfXMOP1ezA0FxhvH9ZuqI3UXylrtrCdoOvJEp yE / TnuHUsaxo1bax0Adg4FBT6LS7J6he55tGQ6TLmj062Ds36JJR4aWiQOyamjMxMivMqsrZk45P p1uAdU / cIMhwBkdkjS4Eh0se92SALWenkcgEks07tPKqnAQdG9Hm4ka7p3Mtg6axGhj + CHsSXfe4 Frbz9t + iNvp7dka / S5lMrRl4hd9HEHTv1CrItsaGACATrx5BaQhy0ZUZauAZT6NgP6W2n02lz7nE AOj2tHdCMiZHgFR / EpANapB1PpGHSK6cY5FsyXOMN / vKglkzk + k8I / FXDCtdWqetWnHdQ2ipsuLt wbqPJSCWbjvjKKjWzGnqnpvYbKmkNbALdDPinyy5qIu / Nb7cS2L + sG6kNAa8CQGvbqJHihjidTC4 n8Fwj3a2L1SikMNuIyzYXbtY3SNOxSnm5g3UvwSBFJd1U3NrFFDKPSEbmyS6fGVGPdl80ibXARGw ZYz3GiCZLnbilKPqXgupjndY34gJRGhXO1SdzkIhc32fzfyKKmnkBJLmZzGvqLXAESDB8igpzL + n dD2 / rGPUbXmQCxp3D4RylaqcLqGNj1b7cCllNfpHe2toAnjwUmM2WPJs1eh9Z / ZlpfeHPxn6WBo9 wMaOCnnDjFtfFkEJcNMOs / WCzqbyyn9DQOGDVx / rFKOIRVkzSlsHDysrMZAZZaGQY2vcBu7cFR5Q LZcBNPf / AFEuy7 + hb8t77HC57WusJJ2gN0l3ZQlmDtwPtk / 8F / 35Chuu4jVW8YwH02c8BTiFFpGS aptfqhtphjnau8J7p0ZHGDQtV227un0Fhux7Q8AwGnQmPwTsQxZfArSZBAcG1rPULTDuFN91F7o4 jSmYTn7C8hrXaSTEJHl4Dco4yrJGJQBXU42PJ1I0b8lEJjaIXgkBqtEg / FRiO6SdkwEByXCkFvYz f0LT5JkhqyRLq4o97PjKFeleDq7OOIOqaAutvs + h8kEtW9JLQyK / UGzjcQJQU1j0WhzvWulxa / cD McDRJTh9dDWYFrGzLWkHUxyOJRh8wRP5XknhpxjWHDc47olXokcNOdOxkutELKnCS8tEecn8ECFw kHo / qt0zGz8XJ9aZY5sERIkh5rJ + J8xPFKNOjyOMTBt6npOP6NDve5 + 9x5jSNOykwyM4AlOQVKmx / wBrP + tf9 + Uq14xpHpM + AVwRaBK9jh + KXCq193tbqgYWU2uLn7SNx07SiIarbWc8kgE9kuAKtE4z a1HhRxapGxh5oCK4yST7XIUuBdLHH6Fg8gmTDJF1MTW5vkCmkaLw7FKaV4bwEN + SYuDTvMIJajnA vaP5QQUluBdS6NZIj7iCElPN9SxXZ4OP9F7x7iII05KUTRVIWHmsz6tdRod7Kze2dCwSrMckWpLH MJMb6qdRtaDYz0Qf3tClLLFUcU3e6V0 / 9hVWVh + 83Q4 + REhZPxP9YYuhyceAF1 + nuBxm + ZP5VY5f TGFuX5ilgfa / + tf9 + Uyx4Zp / RtPgIWqIaORKeqnkyXePCJh6VoyHiUCXsAHZKMBeqjkJGiwJkO7G Qj7YpAyG / BTnHcPJAYxSpZTat36VvwKZwrzPVID7wPIJcHoTxetLPtP + vdMIZQXWo + iweQUcwzQL pYf88fJqZIMkS7FHbzKiLIG / HtPwTCuDRyWk8IJc66m5xml + x4MtcRIkeIQUwsu6w1gBppeB9Nwe Wzr5 + SSnN6jnN6c1uXl + 60gxXXxI5Jd3 + QSWZMgg5Dvr3ZjX + jfjClwiW2CHCdRIc5Kis4snZtu + uOVlY7T06jGDy6h3XktY0RzoCltumGW5cJGrWuz + rZgl + R0m0t4aW2Njy37WpXEs5jOO7rfVvq9f UKLqX010WYj / AE3 + g7fU4nWWO7 + aNUtt1oh3qZ9vpTP9pJTwYn0BPeFuAaOFK6KrdWgeCJjoVsuj On2jXuUJx0XYzSxH6IDzKIj6iivQwOk / JOEbK2Yo0xg7gU3g1QCkJOh7hIQAFMsrq07HS0DxKhlB lhO3Wx3CGyoZwotqBdPCcPUJ + AUUom2WJdigiWwoZaBkDot1Z8QoivDVuCCWqR7klMcqs20GuS2Y 9w5EagoKea + sFeW19TrA2a / 5uxshp + HggxZsfFVbuBl9Nd1C12Xk4wvtP0nepJMcaNbKKI + 6OzTO LkgfZsfDfVjOP6SARuHhOrkiaX4sBlK5lb9hvtMNqvDDoA9zmt + ZdCZcy3DHBEb29v8AV / pZxMQV VNGwtE9mgjuP707Vrki2 / wCl7vRkx6UbvLfMooS1 / wCL3p1mOycm / wBwDvze4 / qq1 / pGY6BqHkoE bld / + Lvprucm / wD6H / kUv9J5OwQeQxnqVv8Axvemhpb9pvjn83 / yKB + KZOwUOQhVWWJ / xfdNiPtN / wD0f / Iof6Vydgu + 5QrcrH / F / wBN / wC5N / 8A0f8AyKH + l8g6BB5HGTdlj / 43 / TQf6Tf / ANH / AMig fjGT90IHw / GDuVH6hdO / 7kXf9H / yKb / pjL + 6F / 3KHcrt + o / T2RGRcY / q / wDkUyXxfIf0QocnAJ2f VXEriLrDHjt / uTJfFch / RDL7EWxX0THq1a95 + Mf3KM / E8nYJGENmvEZWQQSY8VHL4hM9AuEAEoJa IUZ56fYLqRvaHcpv36fYKpqZeB9pDWi6yoAy70yBu8iYlD7 / AD7KprfsVoMjItHwMfih / pCfYJps DDZ6Qqtcbo0JeAd3xEQmn4jPsEUgPRumE7jjtnykfkKH + k59grhDIdMwG8UN / H + 9NPxTJ2CeFduH h2mWY9YI77QT + KB + LZOwVwhKSTodR4cD8E0 / F8n7oVwhBu / Xf + tf9 + S / 0vkq + EK4Xq8AB2BjEiSa aySf6oW3QWJ9jP3R9yXCFK2M / dh4JcI7KV6df7o + 5Lhj2Ur06 / 3W / cEOCPZS3pVfuN + 4JcEeylel V + 437gl7ceylejT + 437gl7cOylejT / o2 / cEPbh3ClvQo / wBGz / NCXtQ7BSvQo / 0bP80Je1DsFWr7 PR / o2f5oS9nH + 6FWr7Pj / wCiZ / mhD2cf7oVa32bH / wBEz / NH9yXs4 / 3R9irV9mxv9Ez / ADR / cl7G P90fYq1fZcb / AENf + aP7kvYxfuj7FWr7Li / 6Gv8AzR / ch93xfuj7FWVvsmL / AKGv / NH9yX3fF + 6P sTZV9kxP9DX / AJg / us + 7Yf3R9irKvseJ / oK / 8xv9yh4XD + 5H7Aqy0PsuN + 3dno17fsk7doifU5iE vu2H9wfYFWW70 / 8A5Pxv + Jr / AOpCmQ2ElKSUpJSklKSUpJSklKSUpJSklKSUpJSklKSUpJSklKSU pJSklOf / AN7 / AP6B / wDoxJTY6f8A8n43 / E1 / 9SElM35DK7fTfoC2Z51JiIUcsojKiqlhlVFxaCYD S4mDpHKAzwJpNLjJpP53Pkf7kfeh4RTF2VU14bMjWXa6R8tU2WeIKaZuvqaS1ztRoRBPaU85Yg1a Gh3qvdtHi0SZA93yTPfjdJpl9opgu3aDU6Hvone9CrtFKdkVtrNolwaYMDWUpZYiPEqlxfUXbQdT 5Ea + CIyxJpSRPUpJSklKSUpJSklKSUpJSklKSU5 // e // AOgf / oxJSXp7HfYMb9I7 + Zr / AHf3R / JQ pdxDskfih9jbHWP3N / q9tR + amSwiUrVxeC32Noc5 / qP9wO76MQefzU32I2TauLwQk4REHMEENB99 eu3jsoTk5c / pj7Qm / BYV4dpFbcvcdQ1oew / S8BtSHsTNCY8rCr8Gb68eqwvsyix8 / nOYDxx9HwIT pe1CVynR8wi9Nl2Y9Nw3svdYJEkFrgS0aTDU6MMeTUStRl4LGnh4eg7IO / aGBpczdA1Gm1AxxXwm Wvaxar8EpxQWOYbHw87nfR5P9lSnECCO6uIdlNxQ1wd6jzDt8HbE / wCagMIBu1cXgnUq1bc0uLQR uEEjuAePyIcQulKc4NBc4gACSToAAkSALKlFzWjc4gDQSeNdAkZACypdFSklMXWVtMOcAdNCQPpG B95TTOIOpUu1wcA5pBBEgjUEFEEEWFLoqUkpz / 8Avf8A / QP / ANGJKbHT / wDk / G / 4mv8A6kJKbCSm L / oO + BTZ / KVNfBdf9noDmMDPTb7g8kxtEe3YPyqvyZye1CwKodfDy / akqpe5jsktY6w + tw2J + gz9 5zUsUjEzoX6unkO9Kawdb + 0nOrYNx3S17цейю0PVYGf3okDXXfyh5p6NnG3nKvNoDH7We1pkR7 oMwNeeys4OI5p8Qo6bfVB2RO9NuK + wbbaHkvcD7XiTJ1 / eHZQy4RhMtJQOvY / wC + nqtZlXtPqNc4 tNvp6hgZ9LbA / PkIT5jIDxAmuKulb15qpel + S / 7OHXH9PUbHENboQG / R9v8AK7p2KWWXBc / mjew8 PDxRoqi6 ++ 30nXFm1hPtDZJbZYydQezRKGHLkyz4TKtPD96Q / YkoK8q9 + VtaDNrBLq9snYbANvqH b7uVBDmMks1DqOldOLvpqqtGy6yyzAyvV5Y2xsnbJAb32EidVZOSU + WycXQEdO3gjqtkuyPszfUY xrN1UkPJP02dvTH5UM8svtCwKuPXxHgobon5mS1gsa50WMsc0uDAPaxzwWAS7t + cop81lERIHcHt 2J06 / amklt + RQ5rTZv8AUYHFzgAGEvY0kbQNPf3UuTNkxEDiux9moH7UUiyNzMh5NnqFpo1IEj9I TB2gBQ57jlOt / J / 0khlj5GSccXmzRjqmbA1oBDxVPb + WnYc + U4 + Pi2MRWnXh / iohn695qpyPVg22 Maa4bADnQWjSZ + ak97IYRnxfNIaad9lU31fWuf8A97 // AKB / + jElNjp // J + N / wATX / 1ISU2ElKSU s1oaA1oAAEADQABAAAUFKDWtktAG4yY7njVIRA2Ut6dYfvDRuP50a6x3 + QQ4I3daqX2t3b4G4iJ7 wOyPCLvqph9no3 + r6bN / O7aJ + 9M9nHxcXCL70q1OxsdxLnVMJd9IloJPx0SODFIkmI18FWyDGN2w 0DYNrYHA8B9ycIRFabKRnEx3WF7mNdIA2kAt0LnTEcy5RnlcRlZH8tf4ptm6il4IfW1wMAggHQcf dKfLFjluAi1xXWGekGgMiNsCIPaERCIjw1p2UuWtcNrgCNDB401CJiCKKkZxcYzNNfuMn2jU + eij + 74j + iPsTZZljCZLQTBbqOx5CeYRPRDFuPQ0Q2tgGmgaBwZh5pow4wNIj7FWuKqmt2BjQ2QYAESI j7oCIxwAqhSkIwKRb6pJJDt0EN5BkS7buP3qAclDj4vr0 / или / FNtlWkOf / 3v / wDoH / 6MSU2On / 8A J + N / xNf / AFISU2ElKSUpJSklKSUpJSklKSUpJSklKSUpJSklKSUpJSklKSUpJSklOf8A97 // AKB / + jElNjp // J + N / wATX / 1ISU2ElKSUpJSklKSUpJSklKSUpJSklKSUpJSklKSUpJSklKSUpJSklOf / AN7 / AP6B / wDoxJTY6f8A8n43 / E1 / 9SElNhJSklKSUpJSklKSUpJSklKSUpJSklKSUpJSklKSUpJS klKSUpJTn / 8Ae / 8A + gf / AKMSU2On / wDJ + N / xNf8A1ISU2ElKSUpJSklKSUpJSklKSUpJSklKSUpJ SklKSUpJSklKSUpJSklOf / 3v / wDoH / 6MSU2On / 8AJ + N / xNf / AFISU2ElKSUpJSklKSUpJSklKSUp JSklKSUpJSklKSUpJSklKSUpJSklOf8A97 // AKB / + jElNjp // J + N / wATX / 1ISU2ElKSUpJSklKSU pJSklKSUpJSklKSUpJSklKSUpJSklKSUpJSklOf / AN7 / AP6B / wDoxJTY6f8A8n43 / E1 / 9SElNhJS klKSUpJSklKSUpJSklKSUpJSklKSU88zrXXndUPSzh0eo1gud + kP83uDZ + Oqh9yfFVOieU5YYfc4 jW23Vt9J + sGLnj07rKqsk2PrbSHe4hhgGD4p2PKJMPM8lPFqATGt20zrHS7PU2ZVTvSaXvhw0aDB d8J7o + 5HuxHlcwq4nVi7rnR2NDnZlIa6YO8QY5hL3Yd0jk85 / RLOnq3S77PSpyqbH7d8NeD7QJJ + 5EZInqiXLZoizEr4vU + n5r3V4mQy17RJa06xxPw80ozjLYoycvlxi5RptJzE5 / 8A3v8A / oH / AOjE lNjp / wDyfjf8TX / 1ISU2ElKSUpJSklKSUpJSklKSUpJSklKSUpJTlswdv1gt6n61e37KKXVT72nc 1 + 4 + WiYIHjtsnmAeWGOteK3Pr + rxfj4lTMipxry3Zhcw / TYTrtPiJCj9k0PNsh5hHika3jwtWj6v A4jKzl47mupspxbm22OFm + dQ1z9jRHIaCh7Bpkl8SgZWAdwTt0 / N0mdIobm476rKA3Bxjj21CJDr GwHEdp8 + U / 2tR5Nc85cJA3ZlbUZ9XA6jEw3ZVQdgVZNOSWauh3lrthjSID51TfZNAMx + JR45yA + Y xI + jZ6d0i9mdRZl30l3T8duMyugkuIBBDrN0RoOEY4zYJ6MebnIShKMQfUbNu8pmg5 // AHv / APoH / wCjElNjp / 8Ayfjf8TX / ANSElNhJSklKSUpJSklKSUpJSklKSUpJSklKSUgfh51lj7bKw91lZpfu kgsPLSOISUzZRWzYRJLAWtc5xcYcQTq4knhJSBnS8BmPViCkGmiDUxxLtsEOEFxJ5CSmw6pjpDhO 4gnzI4 / IkpiMagOtcGAOvg2kDV0ANEn4BJS7KKq7bLmCh3kF + pgkANmJiYaAkpIkpz / + 9 / 8A9A // AEYkpjgdV6Y3BxmuzKARUwEG1kg7R / KSUn / a3Sv + 5mP / ANus / wDJJKV + 1ulf9zMf / t1n / kklK / a3 Sv8AuZj / APbrP / JJKV + 1ulf9zMf / ALdZ / wCSSUr9rdK / 7mY // brP / JJKV + 1ulf8AczH / AO3Wf + SS Ur9rdK / 7mY // AG6z / wAkkpX7W6V / 3Mx / + 3Wf + SSUr9rdK / 7mY / 8A26z / AMkkpX7W6V / 3Mx / + 3Wf + SSUr9rdK / wC5mP8A9us / 8kkpX7W6V / 3Mx / 8At1n / AJJJSv2t0r / uZj / 9us / 8kkpX7W6V / wBzMf8A 7dZ / 5JJSv2t0r / uZj / 8AbrP / ACSSlftbpX / czH / 7dZ / 5JJSv2t0r / uZj / wDbrP8AySSlftbpX / cz H / 7dZ / 5JJSv2t0r / ALmY / wD26z / ySSmj + 0 + m / tz1PtdG37Jt3eoyJ9TidySn / 9k = 256256
  • доказательство: pdfxmp.сделал: 557BE2C44B2068118A6DAF043229041Cxmp.did: 9525AFAC402068118A6DF72418C65FB5uuid: 5dfdc1a1-490a-4c04-9848-a2abe1feeaa1defaultxmp.iid: 260622974B2068118A6DAF043229041Cxmp.did: E1D2E6EB472068118A6DAF043229041Cxmp.did: 9525AFAC402068118A6DF72418C65FB5
  • xmp.iid: 9525AFAC402068118A6DF72418C65FB5created2013-02-08T12: 32: 41.000-05: 00Adobe InDesign 7.5
  • сохранено Adobe InDesign 7.5xmp.iid: B920B209552068118A6DF72418C65FB52013-02-08T12: 34: 58.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: BA20B209552068118A6DF72418C65FB52013-02-08T12: 34: 58.000-05: 00 / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: BE20B209552068118A6DF72418C65FB52013-02-08T12: 41: 29.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 1B556E94602068118A6DF72418C65FB52013-02-08T13: 57: 35.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: F39FADA9612068118A6DF72418C65FB52013-02-08T14: 05: 21.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 97986D10622068118A6DF72418C65FB52013-02-08T14: 08: 13.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: C38059E0692068118A6DF72418C65FB52013-02-08T15: 04: 08.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 65A7D5DB6A2068118A6DF72418C65FB52013-02-08T15: 11: 10.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: BDFA4B636C2068118A6DF72418C65FB52013-02-08T15: 22: 07.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 35E198FC6D2068118A6DF72418C65FB52013-02-08T15: 33: 34.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 651398E56E2068118A6DF72418C65FB52013-02-08T15: 40: 05.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 1513E3356F2068118A6DF72418C65FB52013-02-08T15: 42: 20.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: C41B0E48712068118A6DF72418C65FB52013-02-08T15: 57: 09.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: D6A93443722068118A6DF72418C65FB52013-02-08T16: 04: 10.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: D7A93443722068118A6DF72418C65FB52013-02-08T16: 05: 43.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: F77F1174072068118A6DAC5263CA107B2013-02-11T10: 00: 41.000-05: 00 / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 9A3C1674072068118A6DAC5263CA107B2013-02-11T10: 00: 41.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 0F1A1374072068118A6DBB6E2A48D30A2013-02-11T10: 52: 41.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 8671CBFB072068118A6DBB6E2A48D30A2013-02-11T10: 56: 29.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 4CD9D6BC172068118A6DBB6E2A48D30A2013-02-11T12: 49: 15.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 4DD9D6BC172068118A6DBB6E2A48D30A2013-02-11T12: 50: 34.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 8A9D22068118A6DBB6E2A48D30A2013-02-11T16: 40: 26.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 4171E193422068118A6DBB6E2A48D30A2013-02-12T09: 42: 41.000-05: 00 / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: A5947F3F5D2068118A6DBB6E2A48D30A2013-02-12T09: 42: 41.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 07359A8C5E2068118A6DBB6E2A48D30A2013-02-12T09: 52: 00.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 851C86B95F2068118A6DBB6E2A48D30A2013-02-12T10: 00: 24.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: F7A59D496E2068118A6DBB6E2A48D30A2013-02-12T11: 44: 39.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 919C2A696F2068118A6DBB6E2A48D30A2013-02-12T11: 52: 42.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 929C2A696F2068118A6DBB6E2A48D30A2013-02-12T12: 26: 46.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 2F88B63A822068118A6DBB6E2A48D30A2013-02-12T14: 07: 25.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 3F80C6C98B2068118A6DBB6E2A48D30A2013-02-12T15: 15: 50.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 70F0A0368C2068118A6DBB6E2A48D30A2013-02-12T15: 18: 53.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: CF1509EC3A206811871FC9B103BF80582013-02-12T15: 40: 16.000-05: 00 / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 14AC271CFE206811871FC9B103BF80582013-02-12T15: 40: 16.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: EE96B27302216811871FC9B103BF80582013-02-12T16: 11: 21.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: C0BBEE8306216811871FC9B103BF80582013-02-12T16: 40: 26.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 71F0A0368C2068118A6DBB6E2A48D30A2013-02-13T09: 38: 53.000-05: 00 / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 237BF480B22068118A6DBB6E2A48D30A2013-02-13T09: 38: 53.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 247BF480B22068118A6DBB6E2A48D30A2013-02-13T11: 03: 26.000-05: 00 / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 1807BE4FBE2068118A6DBB6E2A48D30A2013-02-13T11: 03: 26.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 29C7B8A1C02068118A6DBB6E2A48D30A2013-02-13T11: 20: 02.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: A1252FA5C12068118A6DBB6E2A48D30A2013-02-13T11: 27: 18.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 6368FA98C22068118A6DBB6E2A48D30A2013-02-13T11: 34: 07.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: DE5DDC33C32068118A6DBB6E2A48D30A2013-02-13T11: 38: 27.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: D0E2F06AC52068118A6DBB6E2A48D30A2013-02-13T11: 54: 18.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 18DE2CDDC52068118A6DBB6E2A48D30A2013-02-13T11: 57: 30.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 22D80328C82068118A6DBB6E2A48D30A2013-02-13T12: 13: 54.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: D2EF5E80CA2068118A6DBB6E2A48D30A2013-02-13T12: 30: 42.000-05: 00 / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: CC816480CA2068118A6DBB6E2A48D30A2013-02-13T12: 30: 42.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 01983B79CC2068118A6DBB6E2A48D30A2013-02-13T12: 44: 49.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 44CC74F4CC2068118A6DBB6E2A48D30A2013-02-13T12: 48: 15.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: CB55936ECD2068118A6DBB6E2A48D30A2013-02-13T12: 51: 40.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 1EB1C9CECD2068118A6DBB6E2A48D30A2013-02-13T12: 54: 22.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 4DCEBF74CE2068118A6DBB6E2A48D30A2013-02-13T12: 59: 00.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 9062B2ACCE2068118A6DBB6E2A48D30A2013-02-13T13: 00: 34.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 35831944D72068118A6DBB6E2A48D30A2013-02-13T14: 02: 04.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: F095B76AD82068118A6DBB6E2A48D30A2013-02-13T14: 10: 18.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 09844448D92068118A6DBB6E2A48D30A2013-02-13T14: 16: 30.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: DB31E2EBD92068118A6DBB6E2A48D30A2013-02-13T14: 21: 05.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: F3A6C96FDA2068118A6DBB6E2A48D30A2013-02-13T14: 24: 46.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 66BC55BFDE2068118A6DBB6E2A48D30A2013-02-13T14: 55: 38.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: D3F89C41E12068118A6DBB6E2A48D30A2013-02-13T15: 13: 35.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 3C0FBAC4E12068118A6DBB6E2A48D30A2013-02-13T15: 17: 15.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: A48CF25BE32068118A6DBB6E2A48D30A2013-02-13T15: 28: 38.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: D36980FEE32068118A6DBB6E2A48D30A2013-02-13T15: 33: 11.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 41D08D4FE52068118A6DBB6E2A48D30A2013-02-13T15: 42: 37.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 80A2E375E52068118A6DBB6E2A48D30A2013-02-13T15: 43: 41.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 81A2E375E52068118A6DBB6E2A48D30A2013-02-13T15: 46: 15.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: A5DFFD68EC2068118A6DBB6E2A48D30A2013-02-13T16: 33: 26.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: A6DFFD68EC2068118A6DBB6E2A48D30A2013-02-14T11: 05: 40.000-05: 00 / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 082E969E1A2168118A6DBB6E2A48D30A2013-02-14T11: 05: 40.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: F6895B2E232168118A6DBB6E2A48D30A2013-02-14T12: 06: 57.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: DAAD04A7BE216811871FC9B103BF80582013-02-14T13: 00: 13.000-05: 00 / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 9FBAFD167A226811871FC9B103BF80582013-02-14T13: 00: 13.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 378A4F947C226811871FC9B103BF80582013-02-14T13: 18: 02.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 8F03AABF7C226811871FC9B103BF80582013-02-14T13: 19: 15.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 00D1FAB0342168118A6DBB6E2A48D30A2013-02-14T14: 12: 18.000-05: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: C488C00C3D2068118A6D96F4808169D32013-05-09T10: 57: 24.000-04: 00 / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 1038D48A6B2068118A6D96F4808169D32013-05-09T10: 57: 24.000-04: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 02DDCDE16C2068118A6D96F4808169D32013-05-09T11: 07: 00.000-04: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 9072CD9B6E2068118A6D96F4808169D32013-05-09T11: 19: 21.000-04: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 4F078A226F2068118A6D96F4808169D32013-05-09T11: 23: 08.000-04: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 50078A226F2068118A6D96F4808169D32013-05-09T11: 27: 23.000-04: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 01801174072068118A6DAF043229041C2013-06-03T12: 51: 55.000-04: 00 / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: D3AD1374072068118A6DAF043229041C2013-06-03T12: 51: 55.000-04: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: BB401A7C072068118A6DAF043229041C2013-06-03T12: 52: 09.000-04: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 180D3A47452068118A6DAF043229041C2013-06-04T10: 23: 55.000-04: 00 / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: E1D2E6EB472068118A6DAF043229041C2013-06-04T10: 23: 55.000-04: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: EEEF4DEF4A2068118A6DAF043229041C2013-06-04T10: 45: 29.000-04: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 250622974B2068118A6DAF043229041C2013-06-04T10: 50: 11.000-04: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 260622974B2068118A6DAF043229041C2013-06-04T10: 51: 28.000-04: 00 / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: 557BE2C44B2068118A6DAF043229041C2013-06-04T10: 51: 28.000-04: 00 /; / метаданные
  • сохранено Adobe InDesign 7.5xmp.iid: DE8B73ED0D2668118083AFF6F7C3A87C2013-06-04T11: 26: 42.000-04: 00 /; / метаданные
  • 1563
  • таксономия документов: брошюры и каталоги / брошюры по продукции
  • Библиотека Adobe PDF 9.9 Ложь конечный поток эндобдж 101 0 объект > эндобдж 105 0 объект > / Font> / ProcSet [/ PDF / Text / ImageC] / Properties >>> / Shading> / XObject >>> / Rotate 0 / TrimBox [0.0 0.0 387.0 603.0] / Тип / Страница >> эндобдж 1 0 объект > / Font> / ProcSet [/ PDF / Text] / Properties >>> / Shading >>> / Rotate 0 / TrimBox [0.0 0.0 387.0 603.0] / Type / Page >> эндобдж 8 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text] / Properties> / MC1 >>> / Shading >>> / Rotate 0 / TrimBox [0.0 0.0 387.0 603.0] / Type / Page >> эндобдж 13 0 объект > / Font> / ProcSet [/ PDF / Text] / Properties >>>>> / Rotate 0 / TrimBox [0.0 0.0 387.0 603.0] / Type / Page >> эндобдж 16 0 объект > / ExtGState> / Font> / ProcSet [/ PDF / Text / ImageC] / XObject >>> / Rotate 0 / TrimBox [0.0 0.0 387.0 603.0] / Тип / Страница >> эндобдж 24 0 объект > / Font> / ProcSet [/ PDF / Text] >> / Rotate 0 / TrimBox [0.0 0.0 387.0 603.0] / Type / Page >> эндобдж 31 0 объект > / Font> / ProcSet [/ PDF / Text] >> / Rotate 0 / TrimBox [0.0 0.0 387.0 603.0] / Type / Page >> эндобдж 33 0 объект > / Font> / ProcSet [/ PDF / Text] / Properties >>> / XObject >>> / Rotate 0 / TrimBox [0.0 0.0 387.0 603.0] / Type / Page >> эндобдж 76 0 объект [34 0 R 35 0 R 36 0 R 37 0 R 38 0 R 39 0 R 40 0 ​​R 41 0 R] эндобдж 48 0 объект > / ProcSet [/ PDF / ImageC] / XObject >>> / Subtype / Form >> stream H, A @} N / `L2df _ (] + [; ʒAgphGΖBOi> / Y ({ oS1Z: S; xm4> 6C '

    The Perfect Brief Part 4

    Прежде чем писать введение, мы должны подумать о его назначении и задать себе вопрос:

    Нам вообще нужно представление?

    Необходимо ли введение?

    Мы понимаем, что для большинства юристов может показаться противоположным - даже кощунственным - не начинать брифинг вступлением, но вот наши доводы:

    Большинство юристов пишут введение только потому, что видят, как это делают другие юристы.Эти введения обычно просто констатируют очевидное. Когда мы начинаем с такого абзаца, лучшее, что может случиться, - это то, что судья его не прочитает.

    По мере того, как терпение судей становится все тоньше, а количество слов становится труднее, каждое слово становится драгоценным. Не тратьте слово на предложения, которые судья вряд ли прочитает или оценит.

    Если суд или юрисдикция требуют введения, укажите его. Но если это не требуется, мы лучше рассмотрим наше дело, если сначала спросим себя: расскажет ли введение судье что-то, что ей нужно знать, прежде чем она будет читать дальше? Если ответ отрицательный, начните со своих фактов.

    Есть несколько ситуаций, в которых было бы целесообразно включить введение; выборка:

    • Наш случай - одно из первых впечатлений.
    • Судья новичок в сложном деле с длительной процессуальной историей.
    • Мы должны сообщить судье, что наше ходатайство о упрощенном решении касается только определенных пунктов.
    • Вовлечено столько игроков, что судье нужна программа.

    Избегайте повторения подписи

    Большинство юристов открывают сводки, повторяя информацию, содержащуюся в подписи непосредственно над введением.Большинство судей пропускают этот абзац, потому что он не содержит ничего, что им нужно знать. Так почему же большинство сводок до сих пор открываются вот так:

    ПРИХОДИТСЯ СЕЙЧАС Montezuma Chemical Company, ответчик по вышеуказанной названной и пронумерованной причине, отвечает на ходатайство истца Ballard Chemical Company, Inc. о разрешении подать первую измененную жалобу, и в обоснование этого с уважением представит Суду следующее:

    . . . когда на один дюйм выше этого помещается подпись:

    ОТВЕТ
    MONTEZUMA CHEMICAL COMPANY НА BALLARD CHEMICAL COMPANY, INC.'S
    ДВИЖЕНИЕ ДЛЯ ПЕРЕАДРЕСАЦИИ ПЕРВОЙ ИЗМЕНЕННОЙ ЖАЛОБЫ

    или:

    Ответчик через своих поверенных, Абель, Бейкер и Чарльз, с уважением представляет свое резюме в поддержку своего ходатайства о вынесении решения в упрощенном порядке.

    . . . когда на полтора дюйма выше это подпись, которая гласит:

    КРАТКОЕ ОПИСАНИЕ ПОДВИГАЕМЫХ В ПОДДЕРЖКУ
    ЕГО ДВИЖЕНИЯ К ОБЩЕМУ РЕШЕНИЮ

    Больше уважения к судье проявляется в том, чтобы ценить его время, давать ему информацию, необходимую для выполнения его работы, что, как мы неоднократно упоминали в этой серии статей, заключается в поиске справедливого решения.

    Если вы пишете введение, делайте его коротким

    Если введение необходимо, сделайте это быстро. Обычно вы можете сформулировать свое дело для судьи в трех предложениях (хотя второе предложение, объясняющее вашу позицию, может состоять из двух или трех предложений):

    Предложение 1: Ваша позиция
    Предложение 2 : Почему вы так думаете
    Предложение 3 : Что вы хотите, чтобы судья сделал с этим

    Излагая этот обзор заранее, вы предоставляете судье и секретарю контекст для понимания всего, что следует далее.Например:

    Введение

    Приговор первый - Ваша позиция: Беспрецедентное требование племени тлинкитов о восстановлении сайта отличает все законы о процедурах изгнания и требует, чтобы этот суд рассмотрел два вопроса, которые никогда не рассматривались другим судом. Предложение второй - почему вы так думаете: многие племена пытались изгнать землевладельцев, но ни одно племя никогда не требовало, чтобы землевладелец сначала восстановил землю до ее естественного состояния более полувека назад. Третий приговор - что вы хотите от судьи: поскольку требование племени возникает через 60 лет после постройки первой дамбы и требует огромных затрат для ответчика Стокарда, а также потому, что требование племени не может быть выполнено без предварительного определения прав и обязанностей. из Соединенных Штатов под управлением Агентства по охране окружающей среды, Стокард просит этот суд разрешить ему делать открытия в лачесах и присоединиться к Соединенным Штатам в качестве незаменимого участника.

    Не загромождайте начальный абзац определенными терминами

    В течение многих лет тенденция не давала определения терминов. Хотя многие юристы и судьи больше не используют определенные термины, избавиться от этой привычки сложно. Советуем юристам не определять термины по трем причинам:

    1. определение терминов мешает нашему письму, делая его трудным для чтения;
    2. читатель должен нести бремя отслеживания наших определений; и
    3. определений не имеют смысла.

    Допускается использование более короткой версии длинного имени, но вам не нужно сообщать судье, что вы собираетесь это сделать; просто сделай это. Если вы упомянете региональный медицинский центр Гамильтона и в следующем предложении или абзаце напишете Гамильтон или региональный медицинский центр Гамильтона или даже медицинский центр, каждый читатель поймет, что вы имеете в виду; не нужно его определять даже при первом упоминании.

    И вместо того, чтобы использовать аббревиатуры и акронимы для определения стороны, особенно вашего клиента, как «FTREA», почему бы не назвать ее более приятным «First Trust»? Обратите внимание, насколько лучше звучит это предложение, когда мы отбрасываем определения:

    Данный спор возникает из трудового договора истца Джона Кендрика («Кендрик») («Соглашение») с Ответчиком First Trust Real Estate Advisors, Inc.(«FTREA»).

    против

    Этот спор возникает из трудового соглашения истца Джона Кендрика с Ответчиком First Trust Real Estate Advisors, Inc.

    Даже без определения терминов, в следующий раз, когда мы напишем «Кендрик», или «соглашение», или «Первый траст», никто не запутается.

    Предупреждение

    Если вы партнер, всегда уточняйте у партнера, прежде чем опускать определения, но мы не рекомендуем их использовать, потому что в этом нет необходимости. Мы, юристы, используем определенные термины как рефлекс, потому что мы видим, что каждый другой юрист использует их, но они почти всегда не нужны.А их избегание делает наше письмо более плавным и понятным.

    Заключение

    Если у вас нет веской причины написать введение, мы не будем вводить бриф. Мы могли бы использовать вступительное предложение, чтобы сразу же убедить судью склониться в нашу сторону, а затем добавили бы дополнительную информацию, которая еще больше подталкивает судью к нам, и продолжаем до тех пор, пока судья не захочет принять решение за нас. Мы обсудим, как собрать эту информацию, чтобы привлечь судью в следующий раз, в The Perfect Brief, Part 5: Developing Your Facts.

    Гэри Киндер преподавал более 1000 программ письма для Американской ассоциации юристов, Управления социального обеспечения, PG&E, Kraft, Microsoft и юридических фирм, таких как Jones Day, Sidley и WilmerHale. Его признанный критиками «Золотой Корабль в Глубоком Синем море» занял седьмую строчку в списке бестселлеров New York Times.

    Вирусный контроль экспрессии vTR имеет решающее значение для эффективного образования и распространения лимфомы, вызванной вирусом болезни Марека (MDV)

    Vet Res.2010 сентябрь-октябрь; 41 (5): 56.

    Наджат Чбаб

    1 Institut für Virologie, Freie Universität Berlin Philippstr. 13 10115 Берлин Германия

    2 Отделение микробиологии и иммунологии, Колледж ветеринарной медицины, Корнельский университет Итака, штат Нью-Йорк, 14853 США

    Аннемари Эгерер

    1 Institut für Virologie, Freie Universität Berlin Philippstr. 13 10115 Берлин Германия

    Инес Вейга

    1 Institut für Virologie, Freie Universität Berlin Philippstr.13 10115 Берлин Германия

    Кейт В. Яросински

    2 Отделение микробиологии и иммунологии, Колледж ветеринарной медицины, Корнельский университет Итака, штат Нью-Йорк, 14853 США

    Николаус Остеридер

    1 Institut für Virologie, Freie Universität Berlin Philippstr. 13 10115 Берлин Германия

    2 Отделение микробиологии и иммунологии, Колледж ветеринарной медицины, Корнельский университет Итака, штат Нью-Йорк, 14853 США

    1 Institut für Virologie, Freie Universität Berlin Philippstr.13 10115 Берлин Германия

    2 Отделение микробиологии и иммунологии, Колледж ветеринарной медицины, Корнельский университет Итака, штат Нью-Йорк, 14853 США

    Поступила 21 января 2010 г .; Принято 27 апреля 2010 г.

    Авторские права © Авторы, опубликовано INRA / EDP Sciences, 2010 г. Это статья в открытом доступе, распространяемая в соответствии с условиями некоммерческой лицензии Creative Commons с указанием авторства (http://creativecommons.org/licenses/by-nc /3.0/), который разрешает неограниченное использование, распространение и воспроизведение на любых некоммерческих носителях при условии правильного цитирования оригинальной работы.Эта статья цитировалась в других статьях в PMC.

    Abstract

    Вирус болезни Марека (MDV) - это альфа-герпесвирус, вызывающий летальные Т-клеточные лимфомы у кур. MDV уникален тем, что содержит две копии субъединицы вирусной теломеразной РНК (vTR) в своем геноме, демонстрируя 88% идентичность последовательности ортологу курицы, chTR. Минимальный рибонуклеопротеидный комплекс теломеразы состоит из белковой субъединицы с активностью обратной транскриптазы (TERT) и TR. Физиологически комплекс компенсирует прогрессирующее укорочение теломер, которое происходит во время митоза и участвует в процессе иммортализации клеток.Предыдущие исследования показали, что MDV vTR выполняет вспомогательную функцию во время онкогенеза. Сравнительный анализ in vitro вирусных промоторов и промоторов куриного TR показал, что промотор vTR (PvTR) был в 3 раза более эффективным, чем промотор chTR (PchTR) в птичьих клетках, и что более сильная транскрипционная активность PvTR была в значительной степени результатом E -box, расположенный на два нуклеотида ниже сайта начала транскрипции гена vTR. Чтобы проверить гипотезу о том, что PvTR необходим для экспрессии vTR и, следовательно, для эффективного образования опухоли, мы создали рекомбинантный вирус, vPchTR + / + , в котором промотор vTR был заменен промотором chTR.In vivo рост vPchTR + / + был неотличим от роста родительского вируса; однако индукция опухоли была снижена более чем на 50%, а лимфомы были меньше и менее распространены по сравнению с лимфомами, индуцированными родительским вирусом. Мы пришли к выводу, что PvTR не требуется для литической репликации in vivo, но необходим для эффективной транскрипции vTR и, таким образом, критически важен для эффективного образования лимфомы MDV.

    Ключевые слова: MDV, лимфома, вирусная теломеразная РНК, контроль промотора

    1.ВВЕДЕНИЕ

    Вирус болезни Марека (MDV) - это вирус птичьего герпеса, вызывающий болезнь Марека (MD), высококонтагиозную и злокачественную Т-клеточную лимфому у кур. MDV является представителем рода Mardivirus в подсемействе Alphaherpesvirinae [4, 5]. Геном MDV имеет длину примерно 180 т.п.н. и состоит из уникального длинного (UL) и уникально-короткого (US) сегментов, каждый из которых фланкирован инвертированными повторами, называемыми концевыми и внутренними длинными повторами (TRL и IRL), и терминальные и внутренние повторы короткие (TRS и IRS) соответственно [17, 37].MD характеризуется иммуносупрессией, неврологическими симптомами и индукцией Т-клеточных лимфом во внутренних органах уже через 2 недели после инфицирования (p.i.). Согласно существующей модели патогенеза, инфекция инициируется в дыхательных путях после вдыхания инфекционного вируса, где инфицируются фагоцитарные клетки, макрофаги и / или дендритные клетки (DC). В течение 24 часов после первоначального поглощения вирус обнаруживается в бурсе Фабрициуса. Литическая репликация происходит во многих типах клеток, включая В- и Т-клетки, но только Т-клетки, преимущественно с фенотипом CD4 +, несут скрытые MDV, которые в конечном итоге могут привести к трансформации [2, 29].

    Помимо важности для здоровья животных, MDV представляет собой хорошую модель для изучения вирус-индуцированного онкогенеза. Хорошо известно, что MDV кодирует онкопротеин Meq, который, как было показано, непосредственно вызывает трансформацию клеток. Недавно сообщалось, что другой вирусный продукт, кодирующий компонент теломеразной РНК (TR), названный vTR, играет роль в развитии, поддержании и распространении опухолей, индуцированных MDV [36]. MDV содержит в своем геноме две идентичные копии vTR, причем одна копия содержится как в TRL, так и в IRL [7].

    TERT, обратная транскриптаза, и ее партнер TR представляют собой каталитическое ядро ​​теломеразы, эукариотического рибонуклеопротеинового комплекса, который за счет добавления теломер компенсирует неспособность ДНК-полимеразы копировать 3'-конец линейных хромосом [1]. Теломеры являются важными нуклеопротеидными структурами всех эукариотических хромосом, защищая их от деградации экзонуклеазами и сквозных хромосомных слияний. Теломераза реплицирует теломеры, используя TERT и его внутреннюю РНК-матрицу TTAGGG внутри TR для добавления нескольких повторов на концах хромосом.Такое удлинение ДНК компенсирует эрозию теломер во время каждого раунда репликации ДНК [1, 40]. Теломеразная активность не обнаруживается в нормальных соматических клетках, но сильно экспрессируется во время внутриутробного развития и конститутивно экспрессируется в высокопролиферативных клетках, таких как клетки зародышевой линии, стволовые клетки и лимфоциты [11, 38]. Следовательно, эрозия теломер ограничивает репликативную способность соматических клеток [9, 20], и когда теломеры укорачиваются до критической длины, клетки вступают в стадию, называемую репликативным старением, когда деление клеток предотвращается [10].

    Уровни теломеразы повышены более чем в 85% случаев рака человека. Высокая теломеразная активность и стабилизация длины теломер также обнаружены в спонтанно индуцированных опухолях или трансформированных вирусами клеточных линиях [16, 31, 32]. В клетках, инфицированных онкогенными вирусами, увеличение активности теломеразы было связано с усилением регуляции компонента TERT через сложную сеть факторов транскрипции и цис-действующих последовательностей [22].

    MDV уникален среди вирусов, поскольку это единственный известный вирус, кодирующий собственную теломеразную РНК.Штамм MDV RB-1B vTR представляет собой РНК из 443 нуклеотидов, которая демонстрирует 88% гомологию последовательности с последовательностью гена TR курицы (chTR), что позволяет предположить, что она была взята из генома курицы [7]. Функциональность vTR была продемонстрирована на TR-дефицитных мышиных клетках, в которых vTR способен поддерживать активность теломеразы, взаимодействуя с TERT более эффективно, чем chTR [8]. Роль vTR в лимфомагенезе MDV также была продемонстрирована, поскольку делеции области CR1-2 в обеих копиях vTR онкогенного штамма MDV RB-1B приводили к 60% снижению опухолей у инфицированных цыплят [36].Лимфомы у кур, зараженных вирусом с делецией vTR, были меньше по размеру и менее широко распространены. Таким образом, vTR выполняет вспомогательные функции во время онкогенеза, увеличивая частоту и тяжесть лимфомы, вызванной MDV [36]. Кроме того, усиление регуляции активности теломеразы во время инфекции MDV было связано с увеличением экспрессии гена vTR [33]. Анализы in vitro показали, что повышающая регуляция экспрессии vTR на самом деле связана с более сильной транскрипционной активностью промотора vTR (PvTR), который был связан с E-боксом, расположенным на два нуклеотида ниже сайта начала транскрипции гена vTR.Онкопротеин c-Myc участвует в регуляции транскрипции vTR, что, в свою очередь, может контролироваться посредством активности Meq [19, 24, 33].

    Здесь мы проверили гипотезу о том, что подлинный PvTR необходим для эффективной и своевременной скоординированной экспрессии vTR и, следовательно, эффективного образования опухоли. Создав рекомбинантный вирус, vPchTR + / + , в котором PvTR был заменен его куриным аналогом, мы наблюдали, что литическая репликация vPchTR + / + in vivo неотличима от репликации родительского вируса.Однако индукция опухоли была снижена более чем на 50%, и эти лимфомы были меньше по размеру и менее широко распространены по сравнению с лимфомами, индуцированными родительским вирусом. Эти данные указывают на то, что PvTR также важен для эффективного образования лимфомы MDV, скорее всего, благодаря высокому уровню экспрессии vTR.

    2. МАТЕРИАЛЫ И МЕТОДЫ

    2.1. Клетки и вирусы

    Клетки куриных эмбрионов (CEC) получали из 11-дневных эмбрионов, как описано ранее [30], и поддерживали в минимальной необходимой среде (Biochrom, Берлин, Германия) с добавлением 10% фетальной бычьей сыворотки (Biochrom) и выращены при 37 ° C в атмосфере 5% CO 2 .

    Мутант, в котором PvTR был заменен промотором chTR (PchTR), был назван vPchTR + / + , а ревертантный вирус, в который был повторно вставлен промотор vTR, был назван vPvTR + / + . Мутанты были получены из pRB-1B, инфекционной бактериальной искусственной хромосомы (BAC), содержащей геном высоковирулентного штамма RB-1B [26], который был восстановлен для горизонтальной передачи [13]. Родительский vRB-1B и рекомбинантные вирусы vPchTR + / + и vPvTR + / + были восстановлены путем совместной трансфекции ДНК ВАС с помощью CaPO 4 с помощью pCAGGS-NLS / Cre [12, 15], плазмиды, экспрессирующей Cre фермент для вырезания последовательностей mini-F с использованием сайтов loxP в ЦИК.После 2–4 пассажей готовили запасы вируса и замораживали в жидком азоте до дальнейшего использования.

    2.2. Бактерии, плазмиды и ВАС

    Все плазмиды конструировали и поддерживали в клетках Escherichia coli Dh20B, выращенных при 37 ° C в среде Лурия-Бертани (LB), если не указано иное. Поддержание ВАС и Red рекомбинации были выполнены в штамме E. coli GS1783 (любезно предоставленном доктором Грегори Смитом, Северо-Западный университет, Чикаго, Иллинойс, США), несущем pRB-1B и содержащим профаг λ, кодирующий ферменты рекомбинации Exo, Beta и Гэм [35].Последовательности PvTR были заменены последовательностями PchTR в геноме pRB-1B с помощью двухэтапного мутагенеза Red, следуя стратегии, описанной для введения длинных участков последовательности [35]. ДНК, выделенную из CEC, использовали в качестве матрицы для ПЦР-амплификации PchTR с праймерами PchTR-F и PchTR-R (таблица I). Продукт ПЦР расщепляли Hin dIII и Eco RI и клонировали в соответствующие сайты плазмиды pUC18, получая рекомбинантную плазмиду pUC18-PchTR. Вторым этапом было конструирование универсальной плазмиды для переноса pEPkan-PchTR, которая содержит кассету для переноса, названную PchTR-I-SceI-aphAI, и содержит представляющие интерес последовательности (PchTR) с последовательностью aph AI, которая придает устойчивость к канамицину. ( кан r ), соседний сайт I-SceI и дупликация короткой последовательности PchTR.С этой целью фрагмент I-SceI-aphAI амплифицировали с помощью ПЦР из плазмиды pEPkan-S [35] с использованием праймеров pEPchTRpromIN-F и pEPchTRpromIN-R (таблица I). После очистки из геля продукт ПЦР клонировали в плазмиду pUC18-PchTR с использованием единственного сайта Pst I, расположенного во фрагменте PchTR. Кассета PchTR-I-SceI-aphAI была амплифицирована из плазмиды pEPkan-PchTR с использованием праймеров PvTRexch-Forw и PvTRexch-Rev, а затем введена в pRB-1B с помощью первой рекомбинации Red после электропорации 100 нг очищенного фрагмента в GS1783, несущий BAC.Вставка кассеты для переноса привела к дублированию короткого участка последовательности в PchTR, который был использован для удаления гена устойчивости aph AI с помощью второй рекомбинации Red после индукции эндонуклеазы рестрикции I-SceI [35]. Точно такая же процедура была повторена во втором длинном повторяющемся районе, что привело к введению двух копий PchTR в pRB-1B; конечная конструкция была названа pPchTR + / + .

    Таблица I.

    Праймеры, использованные в этом исследовании.

    Праймеры Последовательность 5 '→ 3'
    PchTR AAAAAAGCTTCAAGAGATCGGCGTTGCTTTC Подчеркнутый Hin DIII сайт
    PchTR-R AAAAGAATTCGCCTCCACCCGCCACGCGTG Подчеркнутый Eco RI-сайт
    pEPchTRpromIN-F AAAACTGCAGCTAGCTTGCTGGCGGTGTCCGGAGCAAA TCCGCATCTCGAACTGTAGGGATAACAGGGTAATCGATTT Подчеркнутый Pst Я на сайте
    pEPchTRpromIN-R AAATCTGCAGGCCAGTGTTACAACCAATTAACC Подчеркнутый Pst Я на сайте
    PvTRexch-Forw CCCCAAAAACCTCTCGCGGCCGACGCGCCCCCAGGGATGTAATTACGTCCCTCCCCCCTAGGGGGCAGCAGGCCAAGAGATCGGCGTTGCTTTC
    PvTRexch-Rev G ACACAGCGGAGCCTTCCACCCGCCACGTGTGCCTTCCACCCGCCACGCGTG
    Resc-PvTR-F AAGCTTGACAGGCAGTTGTACACCTG Подчеркнутый Хин DIII
    RESC-PvTR-R GAATTCCTGAAAGTCAGCGAGTAAAC Подчеркнутый Eco RI-сайт
    PEP-PvTR-F GGATCCGATCCCGCAGACCCCGGCCCACAGGAAGGGGCGGGGCACGTGCAGGATGACGACGATAAGTAGGGATAAC
    PEP- PvTR-R GGAT CCGGGTAATGCCAGTGTTACAACCA
    EPrescPvTR-F CCAAAAACCTCTCGCGGCCGACAGGCAGTTGTACAC КТГ
    Кан-F TAGGGATAACAGGGTAATCGATTTATTC
    Кан-R GCCAGTGTTACA ACCAATTAACC
    SB-PchTR-forw CAAGAGATCGGCGTTGCTTT
    SB-PchTR-rev CAAGCTAG CTGCAGTCTCAG
    qRCC CCTG
    qRT-PCRvTR-Rev CCTAATCGGAGGTATT GATGGTACTG
    vTR-зонд Fam-CCCTCCGCCCGCTGTTTACroduceG-BHQ45 9018 в последовательности 9018/18 В геноме PvTR амплифицировали с праймерами Resc-PvTR-F и Resc-PvTR-R (табл.Я). Фрагмент PvTR расщепляли Eco RI и Hin dIII и клонировали в pcDNA3 (Invitrogen, Дармштадт, Германия), получая рекомбинантный вектор pcDNA3-PvTR. Праймеры pEP-PvTR-F и pEP-PvTR-R (таблица I) были использованы для ПЦР-амплификации кассеты I-SceI-aphAI из pEPkan-S и перенесены в уникальный сайт Bam HI pcDNA3-PvTR, генерирующий переносят плазмиду pEPkanPvTR. Из этого вектора фрагмент, содержащий последовательность PvTR и кассету I-SceI-aphAI, амплифицировали с праймерами EPrescPvTR-F и Resc-PvTR-R (Табл.I) и использовали для восстановления pPchTR + / + с помощью двухэтапной рекомбинации Red точно так, как описано выше.

    2.3. Саузерн-блот-анализ

    Зонды, используемые в Саузерн-блот-анализе, получали с использованием набора для синтеза зондов ПЦР DIG (Roche Applied Science, Мангейм, Германия) в соответствии с протоколами производителя. Маркированный DIG кан r зонд амплифицировали из плазмиды pEPkan-S с использованием специфических праймеров Kan-F и Kan-R (Табл. I). Зонд PchTR, меченный DIG, амплифицировали с праймерами SB-PchTR-forw и SB-PchTR-rev (табл.Я). Для саузерн-блот-анализов ДНК, расщепленную Pst I, разделяли электрофорезом в 0,8% агарозном геле, гели окрашивали бромидом этидия и ДНК переносили на нейлоновые мембраны (Amersham, Freiburg, Германия) в соответствии с инструкциями производителя с использованием 20 × SSC.

    2.4. Измерение площадей бляшек

    Один миллион ЦИК, засеянных в шестилуночные планшеты, инфицировали 100 бляшкообразующими единицами (БОЕ) родительского вируса vRB-1B, мутантного вируса vPchTR + / + или спасающего вируса vPvTR + / + .На 5 день p.i. клетки фиксировали 3% параформальдегидом в течение 15 минут, затем проницаемостью 0,5% Triton X-100 в течение 5 минут. Клетки инкубировали в блокирующем растворе (0,1% Triton X-100, 3% бычий сывороточный альбумин в фосфатно-солевом буфере) при комнатной температуре в течение 20 мин. Непрямую иммунофлуоресценцию (IIF) проводили с мышиным антителом 011 против pp38 [28, 30], а затем с вторичным козьим антимышиным антителом, меченным Alexa Fluor 568 (Invitrogen). Цифровые изображения 75 отдельных бляшек были получены с использованием эпифлуоресцентного инвертированного микроскопа Axiovert S100 и цифровой камеры AxioCam HRc (Zeiss, Jena, Germany).Площадь бляшек измеряли с использованием программного обеспечения ImageJ 1 Национальных институтов здравоохранения, и для каждого вируса определяли средний размер бляшек и стандартные отклонения.

    2,5. Репликация вируса in vitro

    Кривые роста вируса определяли, как описано ранее [25]. Вкратце, 1 × 10 6 CEC были инфицированы приблизительно 100 БОЕ родительских или мутантных вирусов. При 0, 24, 48, 72, 96, 120 и 144 часах в день монослои собирали и инокулировали на свежую ЦИК в трехкратных чашках.На 5 день p.i. бляшки окрашивали IIF, как описано выше. Среднее количество бляшек определяли для каждого вируса в каждый момент времени. Было проведено два независимых эксперимента.

    2.6. Эксперименты на животных

    Коммерческие цыплята белого леггорода, свободные от специфических патогенов (SPF) (Lohmann Tierzucht, Куксхафен, Германия), содержались в изоляторах. Три группы однодневных цыплят ( n = 13) были инокулированы подкожно 1000 БОЕ vRB-1B (группа 1), мутантным vPchTR + / + (группа 2) или вирусом спасения vPvTR + / + (группа 3).Цыплят ежедневно обследовали на наличие симптомов MD, умерщвляли при очевидных клинических признаках и обследовали на предмет грубых поражений MD. Эксперимент был прекращен через 8 недель после заражения.

    Число копий вирусной ДНК в куриной крови определяли с помощью количественных ПЦР-анализов. Цельная кровь, полученная из крыловой вены инфицированных цыплят на 4, 7, 11, 18, 24, 32 и 42 дни. был использован для выделения ДНК с использованием набора ДНК крови E-Z 96 (OMEGA bio-tek). Количественную оценку геномных копий MDV с помощью КПЦР проводили, как описано ранее [12, 39].

    2.7. Относительная количественная оценка экспрессии vTR с помощью qRT-PCR

    Общая РНК была извлечена из ложно инфицированных ЦИК или клеток, инфицированных либо vRB-1B, vPchTR + / + , vPvTR + / + , либо вирусом, в котором обе копии vTR были удалены (vCR1-4 - / - , [36] с использованием набора RNeasy Plus Mini Kit (Qiagen, Hilden, Германия) в соответствии с инструкциями производителя. Целостность РНК была подтверждена электрофоретически окрашиванием бромистым этидием и OD 260 / OD 280 Коэффициент поглощения> 1.95. Затем РНК использовали для анализа экспрессии vTR с помощью qRT-PCR с использованием одностадийного набора TaqMan RNA-to-Ct (Applied Biosystems, Дармштадт, Германия). Последовательности праймеров (qRT-PCRvTR-Forw, qRT-PCRvTR-Rev) и последовательность vTR-зонда перечислены в таблице I. Реакция qRT-PCR состояла из 4 мкл РНК (1 мкг), 1 × TaqMan RT- Смесь для ПЦР, 1 × смесь ферментов TaqMan RT, 900 нМ каждого праймера и 250 нМ зонда в конечном объеме 20 мкл. Был использован следующий протокол экспериментального запуска: стадия RT (48 ° C в течение 15 минут), активация фермента (95 ° C в течение 10 минут), денатурация, программа амплификации / расширения повторяется 40 раз (95 ° C в течение 15 с, 60 ° C). C в течение 1 мин).Все анализы qRT-PCR проводили в системе быстрой ПЦР в реальном времени ABI Prism 7500 (Applied Biosystems), а результаты анализировали с помощью программного обеспечения Sequence Detection Systems версии V2.0.3 с использованием сравнительного метода Ct (2 -∆∆Ct ) относительной количественной оценки.

    3. РЕЗУЛЬТАТЫ

    3.1. Конструирование рекомбинантного MDV

    MDV содержит в своем геноме две копии гена vTR, локализованного во фрагменте Bam HI L, который обнаружен как в области TRL, так и в области IRL [7].Мутант MDV, в котором обе копии PvTR были заменены на PchTR, был получен из pRB-1B [26] с использованием двухэтапной стратегии Red-опосредованного мутагенеза, которая позволяет безмаркерные манипуляции с ДНК ВАС, как описано ранее [35] . Геномная ДНК каждого клона, генерируемого на каждом этапе рекомбинации, затем анализировалась с помощью ПЦР, полиморфизма длины рестрикционного фрагмента (ПДРФ) с использованием расщепления Bam HI (данные не показаны) или Pst I, а также методом Саузерн-блоттинга с использованием зондов, специфичных для кассеты канамицина. или последовательность PchTR.Теоретические геномные модификации ДНК ВАС были подтверждены для каждого клона ВАС (рис. 1). Мы смогли показать, что во время генетической манипуляции не происходило никаких ложных перестроек, как показано RFLP, хотя формально нельзя исключить незначительные модификации или перестройки последовательности. Точно так же ревертант BAC pPvTR + / + с двумя копиями PvTR, повторно вставленными в мутант pPchTR + / + , был создан с использованием той же процедуры и проанализирован с помощью тех же методов (рис. 1).

    Полиморфизм длины рестрикционного фрагмента и Саузерн-блот-анализ рекомбинантного ВАС MDV.Готовили ДНК pRB-1B и мутантного ВАС, полученного из него, расщепляли Pst I и разделяли на 0,8% агарозном геле вместе с маркером 1-Kb (M, Promega) и маркером, меченным Dig (M-D). Саузерн-блот-анализ выполняли с использованием созданных с помощью ПЦР зондов, меченных дигоксигенином, с использованием олигонуклеотидных праймеров, специфичных для кассеты канамицина (средняя панель) или последовательности PchTR (правая панель).

    3.2. PchTR индуцирует низкие уровни vTR in vitro

    Чтобы определить влияние на экспрессию vTR при замене PvTR его куриным аналогом PchTR, CEC инфицировали либо vRB-1B, мутантным вирусом vPchTR + / + , либо спасателем. vPvTR + / + вирус.Через 48 ч p.i. из инфицированных клеток экстрагировали тотальную РНК и использовали в качестве матрицы для анализа экспрессии vTR с помощью qRT-PCR. Через 48 ч p.i. экспрессия vTR была в 3 раза ниже в клетках, инфицированных мутантным вирусом, по сравнению с таковой в клетках, инфицированных родительским vRB-1B или спасающим вирусом (рис. 2). В ложно инфицированных клетках и в клетках, инфицированных вирусом, в которых были удалены обе копии vTR, vCR1-4 - / - [36], экспрессия vTR не обнаруживалась (рис. 2). Мы пришли к выводу, что PchTR имеет более низкую транскрипционную активность в птичьих клетках, чем PvTR, и, следовательно, промотор не находится под контролем фактора вирусного происхождения.

    Относительное количественное определение РНК vTR в инфицированных ЦИК. ЦИК были ложно инфицированы (MI) или инфицированы либо родительским вирусом vRB-1B, мутантным вирусом vPchTR + / + , спасающим вирусом vPvTR + / + , либо вирусом, удаленным для обеих копий vTR (vCR1-4 - / - ). Через 48 ч p.i. общую РНК экстрагировали и использовали для анализа экспрессии vTR с помощью qRT-PCR. Относительную экспрессию гена vTR нормализовали по уровням клеточной экспрессии GAPDH. Планки погрешностей представляют собой стандартную ошибку среднего значения двух независимых экспериментов в 48-часовой временной точке.

    3.3. Уровни vTR не влияют на репликацию MDV in vitro

    Родительский vRB-1B, мутантные вирусы vPchTR + / + и vPvTR + / + оценивали на свойства роста in vitro путем анализа размеров бляшек (рис. 3A) и роста кинетика (рис. 3Б). Определение средних площадей бляшек продемонстрировало отсутствие заметной разницы при сравнении vPchTR и vPvTR + / + с vRB-1B ( p = 0,25 и p = 0,7, соответственно) (рис.3А). Точно так же кинетика роста мутантного вируса vPchTR + / + была практически неотличима от кинетики родительского вируса vRB-1B или спасенного вируса vPvTR + / + (фиг. 3B). Из результатов исследования свойств роста созданных мутантных вирусов in vitro мы пришли к выводу, что мутантный вирус vPchTR + / + был подобен родительскому vRB-1B в отношении характеристик роста в культивируемых клетках и что уровни экспрессии vTR не влияли на Репликация MDV in vitro.

    (A) Относительный размер бляшек, индуцированных vRB-1B, vPchTR + / + или спасающим вирусом vPvTR + / + . ЦИК были инфицированы вирусами и на 5-й день p.i. клетки анализировали с помощью IIF с анти-pp38 MAb 011 и Alexa Fluor 568 козьим антимышиным IgG (Molecular Probes). Для каждого вируса было сфотографировано 75 случайных бляшек с помощью цифровой камеры (Axiovert 25 с Axiocam, Zeiss) и размеры бляшек были определены с помощью программного обеспечения ImageJ. Средняя площадь бляшек вируса vRB-1B дикого типа была установлена ​​равной 100%, и были рассчитаны средние относительные площади бляшек vPchTR + / + и vPvTR + / + .Приведены средние значения и стандартные отклонения (планки погрешностей). (B) Кинетика многоступенчатого роста vRB-1B, vPchTR + / + и vPvTR + / + . Один миллион ЦИК были инфицированы примерно 100 БОЕ указанного вируса. В заданное время p.i. клетки трипсинизировали, титровали и совмещали со свежей ЦИК. На 5 день p.i. клетки фиксировали; проницаемые и вирусные бляшки подсчитывали после IIF. Показаны средние титры вирусов и стандартные отклонения (шкалы ошибок) результатов двух независимых экспериментов.

    3.4. Уровни vTR не влияют на цитолитическую репликацию MDV in vivo

    Следующая серия экспериментов посвящена репликации in vivo vPchTR + / + в естественном хозяине. Три группы однодневных цыплят инфицировали подкожно либо vRB-1B, либо vPchTR + / + , либо vPvTR + / + . На 4, 7, 11, 14, 21, 28, 35 и 42 дни после заражения у инфицированных животных собирали образцы цельной крови. Было определено количество копий вирусных геномов, и результаты суммированы на рисунке 4.Оба вируса vPchTR + / + и vPvTR + / + сохраняли скорость репликации вируса, практически аналогичную таковой для vRB-1B, за исключением того, что на 35 день p.i. уровни виремии были немного выше у птиц, инфицированных vPvTR + / + , по сравнению с птицами, инфицированными мутантным или родительским вирусом. Однако разница не была статистически значимой ( p = 0,3), и вирусные нагрузки vPvTR + / + достигли значений, практически идентичных таковым для вирусов дикого типа и мутантных вирусов на 42-й день.я. Взятые вместе, результаты показали, что замена PchTR вместо PvTR в геноме MDV не ухудшает способность мутантного вируса к репликации in vivo.

    Высокие уровни vTR необходимы для цитолитической репликации MDV in vivo. Общая ДНК, выделенная из образцов цельной крови, взятых на 4, 7, 11, 14, 21, 28, 35 и 42 дни p.i. от цыплят, инфицированных vPchTR + / + , vPvTR + / + или родительским vRB-1B, использовали для анализа qPCR вирусного гена ICP4 и гена хозяина (iNOS).Средние вирусные нагрузки представлены в виде копий ICP4 на 1 × 10 6 копий куриного iNOS. Статистически значимых различий в уровнях вирусемии не наблюдалось между группами, инфицированными vPchTR + / + , vPvTR + / + или vRB-1B. На графиках представлены средние значения для 13 цыплят на группу и даны стандартные отклонения (планки погрешностей).

    3.5. Мутантный MDV, несущий промотор chTR, нарушен в образовании и распространении лимфомы

    Для исследования роли vTR в лимфомагенезе, индуцированном MDV, цыплята, инфицированные мутантным вирусом vPchTR + / + , родительским вирусом vRB-1B или спасающим вирусом vPvTR + / + контролировали на предмет клинических признаков и макроскопических патологических поражений.Заболеваемость БМ оценивалась до 56 дней подряд. в это время все выжившие цыплята были умерщвлены и исследованы на предмет грубых поражений MD. Инфекция vPchTR + / + вызвала значительное снижение заболеваемости опухолью (46%, p <0,05) по сравнению с vRB-1B (92%) или vPvTR + / + (85%). Разница в процентном соотношении у птиц, у которых развиваются опухоли после инфицирования vRB-1B (92%) и vPvTR + / + (85%), не была значимой ( p = 0,56).

    Что касается характера распределения лимфомы, мы заметили, что опухоли в группе vPchTR + / + были менее распространены, поскольку только у 31% кур развились опухоли более чем в двух различных участках органов по сравнению с 84% в vRB- 1Б группа и 54% в группе ревертантов (рис.5). Эти результаты показали, что vPchTR + / + отличается от vRB-1B и vPvTR + / + с точки зрения канцерогенного потенциала в естественном хозяине. Более того, мы смогли продемонстрировать, что высокие уровни vTR, контролируемые промотором вируса, необходимы для патогенеза MDV и могут влиять на прогрессирование заболевания.

    Мутантный вирус, несущий две копии промотора chTR, ослаблен. Животным вводили подкожно 1000 БОЕ либо vRB-1B, либо vPchTR + / + , либо vPvTR + / + .В ходе эксперимента умирающих птиц забивали и вскрывали. В конце эксперимента (8 недель p.i.) выживших птиц также вскрывали и оценивали на MD. Регистрировали заболеваемость и заболеваемость лимфомами. Лимфомы, индуцированные мутантными вирусами, несущими две копии промотора chTR, показали измененный характер распространения у отдельных цыплят. Значения соответствуют проценту птиц, инфицированных указанными вирусами, у которых не развилась лимфома (0), у которых было менее (<2) или равно или более двух участков проявления лимфомы (больше или равно 2). наблюдаемый.

    4. ОБСУЖДЕНИЕ

    MDV - один из наиболее известных онкогенных герпесвирусов [3] и единственный известный на сегодняшний день вирус, который кодирует собственную теломеразную РНК (vTR). Доказательства, касающиеся роли vTR в патогенезе [36], подчеркнули важность теломеразы в развитии рака, но подняли новые вопросы относительно механизма, с помощью которого экспрессия vTR способствует онкогенезу.

    Функциональный анализ показал, что vTR может восстанавливать активность теломеразы, взаимодействуя с TERT более эффективно, чем это делает chTR [7, 8].Интересно, что активность теломеразы во время инфекции MDV увеличивается в лимфоцитах, клетках-мишенях для трансформации, и была связана с высокими уровнями экспрессии vTR [33]. Эти данные свидетельствуют о том, что chTR является ограничивающим фактором и что высокое количество копий vTR является предварительным условием для увеличения активности теломеразы и стимулирования иммортализации клеток.

    Регуляция активности теломеразы варьируется у позвоночных и достигается за счет экспрессии TR и TERT на различных уровнях, таких как контроль транскрипции и субклеточная локализация каждого компонента.Модуляция теломеразы, которая включает сложную сеть факторов транскрипции и цис--действующих последовательностей, в основном изучалась на модельных организмах и человеке [22]. Что касается регуляции теломеразы, курица имеет много общих черт с человеком, таких как возраст, связанный с укорочением теломер [6] или подавление теломеразы в большинстве соматических клеток и тканей во время эмбрионального и постнатального развития [34]. Как описано для промотора hTR, анализ последовательности промоторов chTR и vTR выявил общие сайты связывания факторов транскрипции, которые участвуют в поддержании базальных уровней экспрессии TR.Важно отметить, что этот анализ идентифицировал цис- элементов, специфически вовлеченных в регуляцию транскрипции vTR, включая три E-бокса и сайт EBS [7, 33]. Наличие дополнительных сайтов связывания факторов транскрипции на промоторе vTR подразумевает другие уровни контроля экспрессии vTR.

    Наше исследование было направлено на определение того, необходимы ли последовательности промотора vTR для лимфомагенеза. Чтобы проверить эту гипотезу, мы использовали высокоонкогенный штамм MDV RB-1B для создания мутантного вируса, названного vPchTR + / + , несущего промотор куриного TR вместо промотора vTR.Мы показали с помощью qRT-PCR, что по сравнению с родительскими и ревертантными вирусами vPchTR + / + имел пониженные уровни экспрессии vTR в культуральных клетках, подтверждая, что промотор vTR имеет более сильную транскрипционную активность, чем его куриный аналог (рис. 2). Кроме того, мы показали, что репликация vPchTR + / + не была нарушена in vitro, поскольку vPchTR + / + реплицируется с уровнями, аналогичными уровням родительских и ревертантных вирусов (рис. 3). Этот результат также свидетельствует о том, что во время генетических манипуляций с ДНК ВАС не происходило никаких ложных перестроек.Важно отметить, что репликация in vivo vPchTR + / + также была сходна с вирусами дикого типа и спасательными вирусами (рис. 4). Таким образом, наши результаты хорошо коррелируют с результатами Trapp et al. [36], которые показали, что экспрессия vTR необходима для литической репликации MDV и установления латентного периода, указывая на то, что vTR выполняет роль, поддерживающую онкогенез, а не влияя на онкогенез из-за неспособности эффективно реплицироваться литически. В соответствии с этой интерпретацией наш эксперимент in vivo показал, что высокие уровни vTR необходимы для патогенеза MDV и для прогрессирования заболевания.Лимфомагенез у цыплят, инфицированных мутантом vPchTR + / + , был снижен на 54% по сравнению с вирусами дикого типа и спасательными вирусами (рис. 5). Более того, поражения у животных, инфицированных мутантным вирусом, были меньше по размеру и менее распространены, что практически идентично результатам, полученным ранее с мутантами с делецией vTR [36]. Таким образом, наши данные подтверждают, что экспрессия vTR важна не только для лимфомагенеза MDV, но и уровни экспрессии, контролируемые вирусом, необходимы для его канцерогенной функции.

    vTR может приводить к увеличению активности теломеразы совместно с chTERT in vitro [8]. Помимо роли vTR в теломеразном комплексе, некоторые из его проонкогенных функций, по-видимому, не зависят от действия теломеразы. Корреляция между экспрессией vTR и его онкогенными свойствами была продемонстрирована на клетках DF-1, в которых активность теломеразы не обнаруживается. Экспрессия vTR приводила к морфологическим изменениям в клетках DF-1, аналогичным тем, которые наблюдались после экспрессии истинного онкобелка MDV, Meq [36].Meq - это ядерный онкопротеин, необходимый для лимфомагенеза MDV, который действует как регулятор транскрипции [21]. В зависимости от своего партнера по димеризации он может вызывать активацию или подавление транскрипции [18]. Подобно vTR, Meq экспрессируется как во время литической, так и латентной инфекции, и более высокие уровни Meq были обнаружены в опухолевых клетках и в линии лимфоидных клеток, трансформированных MDV [14, 27]. Интересно, что более высокие уровни транскрипции Meq также были связаны с более высокими уровнями активности теломеразы в лимфоцитах и ​​образованием опухолей у кур.Предыдущее мутационное исследование сайта AP-1 в промоторе vTR не имело никакого эффекта на транскрипционную активность промотора vTR в клетках MSB-1, экспрессирующих Meq [33]. В соответствии с этими данными попытки идентифицировать сайты связывания Meq в геноме MDV с помощью экспериментов с ChIP не смогли идентифицировать связывание Meq в промоторе vTR [18]. На основании этих результатов можно предположить, что Meq может косвенно трансактивировать экспрессию vTR посредством димеризации с одним из своих клеточных партнеров. Примечательно, что гетеродимеры Meq / c-Jun трансактивируют экспрессию c-Myc [18, 19, 23] и что сайты связывания c-Myc присутствуют на промоторе vTR.Присутствие E-боксов в промоторе vTR совместимо с прямым действием белков суперсемейства bHLH-Zip, таких как факторы транскрипции Myc / Mad / Max, которые регулируют многие клеточные функции, включая пролиферацию, дифференцировку и апоптоз. Способность c-Myc связываться с промотором vTR и трансактивировать экспрессию гена vTR была выявлена ​​in vitro с помощью анализов сверхэкспрессии в клетках LMH [33]. Эксперименты с ChIP также показали, что эндогенно экспрессируемый c-Myc может взаимодействовать с промоторной областью vTR, содержащей E-Boxes 2 и 3, в клетках MSB-1 [33].

    Как упоминалось ранее, MDV vTR является одновременно литическим и латентным геном, поскольку он экспрессируется в ЦИК, инфицированных MDV, и в линиях лимфобластоидных клеток, трансформированных MDV [33, 36]. Полуколичественный анализ экспрессии vTR с помощью ОТ-ПЦР показал, что уровень vTR в лимфоидных клетках в 17 раз выше, чем в ЦИК, подвергающихся литической репликации. Тот факт, что c-Myc также экспрессируется как в литически, так и в латентно инфицированных клетках, убедительно свидетельствует о том, что в активацию транскрипции vTR вовлечены дополнительные факторы.Шкрели и др. предположили, что Ets-1 может быть фактором, участвующим в регуляции транскрипции vTR, а анализ сайта EBS, расположенного на промоторной последовательности vTR, выявил присутствие специфического связывающего домена для трех белков Ets, PU.1, Ets-1 и PEA3 [33]. Однако только Ets-1 оказался потенциальным кандидатом из-за высоких уровней экспрессии Ets-1 в лимфоидных тканях у взрослых птиц.

    В заключение мы показали, что экспрессия vTR через его эндогенный промотор (PvTR) важна для лимфомагенеза MDV.Дальнейшие исследования, идентифицирующие специфические элементы промотора vTR, вызывающие повышенные уровни экспрессии vTR, и их важность in vivo помогут очертить патогенез смертельной лимфомы, индуцированной MDV.

    Благодарности

    Это исследование было поддержано грантом Национальных институтов здравоохранения (5R01CA127238), предоставленным N. Osterrieder и K.W. Jarosinski и за счет неограниченных средств, предоставленных Н. Остеридеру из Свободного университета Берлина.

    Список литературы

    1.Блэкберн Э. Х., Переключение и передача сигналов в теломере, Cell (2001) 106: 661–673 [PubMed] [Google Scholar] 2. Калнек Б.В. Болезнь Марека - модель герпесвирусной онкологии, Crit. Rev. Microbiol. (1986) 12: 293–320 [PubMed] [Google Scholar] 3. Калнек Б.В., Патогенез вирусной инфекции болезни Марека, Curr. Верхний. Microbiol. Иммунол. (2001) 255: 25–55 [PubMed] [Google Scholar] 4. Дэвисон А., Комментарии по филогенетике и эволюции герпесвирусов и других крупных ДНК-вирусов, Virus Res. (2002) 82: 127–132 [PubMed] [Google Scholar] 5.Дэвисон А.Дж., Эволюция герпесвирусов, Ветеринар. Microbiol. (2002) 86: 69–88 [PubMed] [Google Scholar] 6. Делани М.Е., Крупкин А.Б., Миллер М.М., Организация последовательностей теломер у птиц: доказательства массивов экстремальной длины и укорочения in vivo, Cytogenet. Cell Genet. (2000) 90: 139–145 [PubMed] [Google Scholar] 7. Fragnet L., Blasco M.A., Klapper W., Rasschaert D., РНК-субъединица теломеразы кодируется вирусом болезни Марека, J. ​​Virol. (2003) 77: 5985–5996 [Бесплатная статья PMC] [PubMed] [Google Scholar] 8.Fragnet L., Kut E., Rasschaert D., Сравнительное функциональное исследование вирусной теломеразной РНК на основе естественных мутаций, J. Biol. Chem. (2005) 280: 23502–23515 [PubMed] [Google Scholar] 9. Харли К. Б., Футчер А. Б., Грейдер К. В., Теломеры укорачиваются при старении фибробластов человека, Nature (1990) 345: 458–460 [PubMed] [Google Scholar] 10. Харли К. Б., Вазири Х., Контр С. М., Оллсопп Р. С., Теломерная гипотеза клеточного старения, Exp. Геронтол. (1992) 27: 375–382 [PubMed] [Google Scholar] 11. Хияма К., Хираи Ю., Киоидзуми С., Акияма М., Хияма Э., Пятишек М.А. и др., Активация теломеразы в лимфоцитах человека и гематопоэтических клетках-предшественниках, J. Immunol. (1995) 155: 3711–3715 [PubMed] [Google Scholar] 12. Яросински К.В., Остерридер Н., Наир В.К., Шат К.А., Аттенуация вируса болезни Марека путем делеции открытой рамки считывания RLORF4, но не RLORF5a, J. Virol. (2005) 79: 11647–11659 [Бесплатная статья PMC] [PubMed] [Google Scholar] 13. Яросински К.В., Маргулис Н.Г., Камил Ю.П., Спатц С.Дж., Наир В.К., Остерридер Н., Горизонтальная передача вируса болезни Марека требует US2, протеинкиназы UL13 и gC, J. Virol. (2007) 81: 10575–10587 [Бесплатная статья PMC] [PubMed] [Google Scholar] 14. Jones D., Lee L., Liu J.L., Kung H.J., Tillotson J.K., Вирус болезни Марека кодирует ген основной лейциновой молнии, напоминающий онкогены fos / jun, который высоко экспрессируется в лимфобластоидных опухолях, Proc. Natl. Акад. Sci. USA (1992) 89: 4042–4046 [Бесплатная статья PMC] [PubMed] [Google Scholar] 15. Камил Дж.P., Tischer B.K., Trapp S., Nair V.K., Osterrieder N., Kung H.J., vLIP, гомолог вирусной липазы, является фактором вирулентности вируса болезни Марека, J. ​​Virol. (2005) 79: 6984–6996 [Бесплатная статья PMC] [PubMed] [Google Scholar] 16. Kim NW, Piatyszek MA, Prowse KR, Harley CB, West MD, Ho PL и др., Специфическая связь активности теломеразы человека с бессмертными клетками и раком, Science (1994) 266: 2011–2015 [PubMed] [Google Scholar] 17. Kingham B.F., Zelnik V., Kopacek J., Majerciak V., Ney E., Шмидт К.Дж., Геном вируса герпеса индеек: сравнительный анализ с вирусами болезни Марека, J. ​​Gen. Virol. (2001) 82: 1123–1135 [PubMed] [Google Scholar] 18. Леви AM, Изумия Ю., Бруновскис П., Ся Л., Parcells MS, Редди С.М. и др., Характеристика участков связывания хромосом и партнеров по димеризации вирусного онкопротеина Meq в Т-клетках, трансформированных вирусом болезни Марека, J .Virol. (2003) 77: 12841–12851 [Бесплатная статья PMC] [PubMed] [Google Scholar] 19. Леви А.М., Гилад О., Ся Л., Изумия Ю., Чой Дж., Цаленко А. и др., Meq вируса болезни Марека трансформирует куриные клетки посредством транскрипционного каскада v-Jun: конвергентного трансформирующего пути для онковирусов птиц, Proc. Natl. Акад. Sci. USA (2005) 102: 14831–14836 [Бесплатная статья PMC] [PubMed] [Google Scholar] 20. Линдси Дж., Макгилл Н.И., Линдси Л.А., Грин Д.К., Кук Х.Д. Утрата теломерных повторов у людей с возрастом in vivo, Mutat. Res. (1991) 256: 45–48 [PubMed] [Google Scholar] 21. Лупиани Б., Ли Л.Ф., Цуй Х., Химено И., Андерсон А., Морган Р.В. и др., Ген Meq, кодируемый вирусом болезни Марека, участвует в трансформации лимфоцитов, но не является необходимым для репликации, Proc. Natl. Акад. Sci. USA (2004) 101: 11815–11820 [Бесплатная статья PMC] [PubMed] [Google Scholar] 22. Mergny J.L., Riou J.F., Mailliet P., Teulade-Fichou M.P., Gilson E., Естественная и фармакологическая регуляция теломеразы, Nucleic Acids Res. (2002) 30: 839–865 [Бесплатная статья PMC] [PubMed] [Google Scholar] 23. Наир В.К., Кунг Х.Дж., Онкогенность вируса болезни Марека: молекулярные механизмы, в: Дэвисон Ф., Наир В. (ред.), Болезнь Марека, развивающаяся проблема, Elsevier Academic Press, Лондон, 2004 [Google Scholar] 24. Остерридер Н., Камил Дж. П., Шумахер Д., Тишер Б. К., Трапп С. Вирус болезни Марека: от миазмов к модели, Nat. Rev. Microbiol. (2006) 4: 283–294 [PubMed] [Google Scholar] 25. Parcells M.S., Андерсон A.S., Кантелло J.L., Морган Р.В., Характеристика инсерционных и делеционных мутантов вируса болезни Марека, у которых отсутствуют US1 (гомолог ICP22), US10 и / или US2 и соседние открытые рамки считывания с короткими компонентами, J.Virol. (1994) 68: 8239–8253 [Бесплатная статья PMC] [PubMed] [Google Scholar] 26. Петербридж Л., Браун А.С., Бейджент С.Дж., Хоус К., Сакко М.А., Остерридер Н., Наир В.К., Онкогенность вирулентного вируса болезни Марека, клонированного в виде бактериальных искусственных хромосом, J. Virol. (2004) 78: 13376–13380 [Бесплатная статья PMC] [PubMed] [Google Scholar] 27. Росс Н., О'Салливан Г., Ротвелл С., Смит Г., Берджесс С.К., Ренни М. и др., Ген EcoRI-Q вируса болезни Марека (meq) и небольшая антисмысловая РНК к ICP4 в большом количестве экспрессируются в Клетки CD4 + и клетки, несущие новый лимфоидный маркер, AV37, при лимфомах болезни Марека, J.Gen. Virol. (1997) 78: 2191–2198 [PubMed] [Google Scholar] 28. Rudolph J., Seyboldt C., Granzow H., Osterrieder N., Продукт гена 10 (UL49.5) вируса герпеса 1 лошадей необходим и достаточен для функционального процессинга гликопротеина M, J. Virol. (2002) 76: 2952–2963 [Бесплатная статья PMC] [PubMed] [Google Scholar] 29. Шат К.А., Чен С.Л., Калнек Б.В., Чар Д., Трансформация субпопуляций Т-лимфоцитов герпесвирусом болезни Марека, J. ​​Virol. (1991) 65: 1408–1413 [Бесплатная статья PMC] [PubMed] [Google Scholar] 30.Шумахер Д., Тишер Б.К., Фукс В., Остерридер Н., Восстановление серотипа 1 вируса болезни Марека (MDV-1) из ДНК, клонированной в качестве бактериальной искусственной хромосомы, и характеристика гликопротеин-B-отрицательного мутанта MDV-1, J. Virol. (2000) 74: 11088–11098 [Бесплатная статья PMC] [PubMed] [Google Scholar] 31. Шэй Дж. У., Баккетти С., Обзор активности теломеразы при раке человека, Eur. J. Cancer (1997) 33: 787–791 [PubMed] [Google Scholar] 32. Шэй Дж. У., Райт У. Э., Теломераза: мишень для лечения рака, Раковые клетки.(2002) 2: 257–265 [PubMed] [Google Scholar] 33. Shkreli M., Dambrine G., Soubieux D., Kut E., Rasschaert D., Участие онкопротеина c-Myc в регуляции гена вирусной теломеразной РНК во время лимфомагенеза, индуцированного вирусом болезни Марека, J. ​​Virol. (2007) 81: 4848–4857 [Бесплатная статья PMC] [PubMed] [Google Scholar] 34. Тейлор Х.А., Делани М.Е., Онтогенез теломеразы у кур: влияние подавления на пре- и постнатальную длину теломер in vivo, Dev. Разница в росте. (2000) 42: 613–621 [PubMed] [Google Scholar] 35.Тишер Б.К., фон Эйнем Дж., Кауфер Б., Остерридер Н., Двухэтапная опосредованная красным рекомбинация для универсальных высокоэффективных безмаркерных манипуляций с ДНК в Escherichia coli , Biotechniques (2006) 40: 191–197 [PubMed] [PubMed] [ Google Scholar] 36. Trapp S., Parcells M.S., Kamil J.P., Schumacher D., Tischer B.K., Kumar P.M. и др., Теломеразная РНК, кодируемая вирусом, способствует злокачественному Т-клеточному лимфомагенезу, J. Exp. Med. (2006) 203: 1307–1317 [Бесплатная статья PMC] [PubMed] [Google Scholar] 37. Тульман Э. Р., Афонсу К.Л., Лу З., Жак Л., Рок Д.Л., Кутиш Г.Ф., Геном очень вирулентного вируса болезни Марека, J. ​​Virol. (2000) 74: 7980–7988 [Бесплатная статья PMC] [PubMed] [Google Scholar] 38. Райт У.Э., Пятишек М.А., Рейни У.Э., Берд У., Шей Дж. У., Теломеразная активность в зародышевой линии и эмбриональных тканях и клетках человека, Dev. Genet. (1996) 18: 173–179 [PubMed] [Google Scholar] 39. Юнис Р., Яросински К.В., Шат К.А., Связь между скоростью репликации вирусного генома и вирулентностью штаммов герпесвируса болезни Марека, Virology (2004) 328: 142–150 [PubMed] [Google Scholar] 40.Закиан В.А., Теломеры: начало понимать конец, Наука (1995) 270: 1601–1607 [PubMed] [Google Scholar]

    Pvt Уравнение состояния - обзор

    1.1.2 Дорожная карта книги

    Книга содержит пять разделов: моделирование процессов, термодинамика, синтез процессов, интеграция процессов и дизайн-проект. Каждый раздел состоит из нескольких глав, всего 21 плюс приложения. Дорожная карта, изображенная на Рисунке 1.1, представляет собой обзор глав.

    Рисунок 1.1. Дорожная карта книги.

    Главный проспект связывает вводную главу по IPD с разделом, посвященным Design Project , конечной цели, и в то же время позволяет циркулировать информацию между различными разделами и главами. Дороги с двойным смыслом указывают на то, что информация входит и выходит между разделами и некоторыми главами.

    В этой книге мы приняли стратегию обучения принципам посредством задания дизайн-проекта. По этой причине в конце глав нет проблем.Вместо этого студенты будут обучаться, применяя теоретические концепции в своих собственных проектах.

    Руководящие примеры можно найти в книге, опубликованной Димианом и Билдеа (2008), содержащей 11 подробных компьютерных тематических исследований.

    Если смотреть сверху, правая сторона проспекта касается проблем, связанных с инструментами, а левая сторона - принципами IPD. В быстром туре представлены ключевые темы каждой главы.

    Путешествие начинается с вводной главы, посвященной интегрированному процессу и дизайну продукта .Это можно описать как объединение двух видов деятельности: Синтез процессов , как архитектурное проектирование, и Интеграция процессов, как разработка и оптимизация подсистем. Ключевые темы: системный подход , устойчивое развитие и производственно-интегрированная охрана окружающей среды .

    В первом разделе рассказывается, как эффективно использовать мощные возможности Process Simulation . Лечение является общим, не предназначенным для конкретного коммерческого программного обеспечения.

    Глава 2 служит введением в моделирование процессов . Особое внимание уделяется системному анализу с помощью моделирования, обычно называемому технологической схемой . В этой главе представлен обзор компьютерного моделирования в технологическом проектировании, включая ключевые этапы подхода к моделированию, архитектуру программного обеспечения для создания технологических схем и интеграцию инструментов моделирования.

    В главе 3 представлены основные принципы Steady-State Flowsheeting , такие как анализ степеней свободы, эффективное использование последовательно-модульного подхода, подход к решению уравнений, термодинамические инструменты и рассмотрение сходимости и оптимизации.Освоение методов построения схем позволяет пользователю получить ценную информацию о более тонких аспектах, таких как управление в масштабах всего предприятия.

    Глава 4 посвящена Dynamic Flowsheeting , в настоящее время являющемуся основным инструментом исследования в работе и управлении технологическими процессами. Ключевые темы: настройка модели динамического моделирования, инструменты динамического моделирования, численные задачи, динамическое моделирование ключевых узлов и инструменты управления технологическим процессом.

    Второй раздел посвящен термодинамическим методам , используемым в автоматизированном проектировании процессов.Широко признано, что неправильное термодинамическое моделирование является наиболее частой причиной отказа при использовании компьютерного моделирования для прогнозирования поведения реальных систем. Поэтому этот раздел настоятельно рекомендуется в качестве самостоятельного изучения для повышения уровня знаний в области термодинамики.

    Глава 5 описывает обобщенные вычислительные методы , а именно поведение PVT (давление / объем / температура) флюидов, термодинамические свойства, обобщенные вычислительные методы с использованием зависимости PVT и оценку физических свойств.

    Глава 6 развивает вычисление фазовых равновесий с помощью различных термодинамических моделей, таких как уравнения состояния и активности жидкости. Особое внимание уделяется регрессии параметров из экспериментальных данных.

    Третья часть, Process Synthesis , входит в суть концептуального дизайна и учит, как создавать технологические схемы с помощью общего подхода, основанного на системном анализе и систематических методах.

    В главе 7 представлена ​​разработка схем с применением иерархического подхода .Анализ входных / выходных данных расширен, чтобы охватить существенные аспекты экологического анализа. Акцент делается на оболочке материального баланса, образованной подсистемами реакций и разделений, связанных рециклами. Здесь структура под названием Reactor-Separation-Recycle доминирует в концептуальной структуре всей технологической схемы. Это основа для организации общесистемного контроля материального баланса, который, в свою очередь, определяет операционные расходы. В отдельных главах представлен более глубокий анализ синтеза подсистем.

    Поскольку синтез технологической схемы начинается с реактора, Глава 8, посвященная Синтезу реакционных систем , особенно важна. Ключевой проблемой является химия, включая образование побочных продуктов и примесей. Еще одна центральная тема - выбор реактора и его интеграция с энергосистемой.

    Глава 9 представляет Синтез систем разделения . В этой главе разрабатывается общая основа, основанная на знаниях. Подход основан на создании альтернативных задач с учетом взаимосвязи между характеристическими свойствами компонентов и целевым показателем, назначенным для разделения, а также на оценке соответствующих методов разделения.

    Глава 10, Интенсификация процесса , представляет современные методы повышения экологической эффективности химического оборудования за счет более низких капитальных затрат, значительной экономии энергии, уменьшения занимаемой площади и безопасности благодаря конструкции. Центральными темами являются устройства для реактивного разделения (например, реактивная дистилляция, реактивная абсорбция) и более совершенные технологии дистилляции, такие как колонна с перегородкой (Kiss, 2013).

    Глава 11, Дизайн химической продукции , представляет подход, который объединяет дизайн продукта и процесса.Мы разделяем мнение, что все технологические разработки посвящены продукции. В случае сырьевых товаров упор делается на разработку технологической схемы, которая обеспечивает наименьшие капитальные и эксплуатационные затраты, в то время как для промышленных товаров и товаров потребительского назначения упор делается на спецификации, удовлетворяющие потребности клиентов, для которых во многих случаях необходимо найти схему технологического процесса. с использованием многофункционального оборудования.

    Глава 12, Пакетные процессы , описывает разработку процессов, обычно используемых для производства специальных химикатов.Ключевые темы - периодическая дистилляция и реакторы периодического действия. Здесь важны вопросы эксплуатации процесса, а не синтез технологической схемы, например повышение производительности, энергосбережение и сохранение безопасности.

    Четвертый раздел книги, посвященный интеграции процессов (PI), посвящен объединению отдельных блоков в оптимальную систему с точки зрения низкого энергопотребления, хорошей управляемости и превосходных экологических характеристик.

    Глава 13, посвященная Pinch Analysis , посвящена принципам достижения оптимального использования энергии.Принцип заключается в том, что анализ процесса как системы приводит к гораздо более эффективным решениям для экономии энергии, чем просто оптимизация автономных устройств. А именно, этот метод может установить оптимальные энергетические цели задолго до детального проектирования теплообменников. Правильное размещение подразделений по отношению к Pinch дает ценную информацию для повышения энергетической и экологической эффективности всего процесса.

    Глава 14 посвящена интеграции прикладной энергии в перерабатывающих отраслях, в частности, комбинированному производству тепла и электроэнергии, новым хладагентам, утилизации отработанного тепла, энергосбережению при дистилляции, интеграции химических реакторов и инженерных систем на объекте.

    Глава 15 посвящена Plantwide Control как целостному подходу к интеграции проектирования процессов с управлением процессами на уровне всего предприятия. В частности, в этой главе рассматривается стабильность и гибкость эксплуатации, связанная с конструкцией реакторов и сепараторов. Ключевой темой является бифуркационный анализ системы реактор / сепаратор / рецикл, характеризующий процесс.

    Глава 16 описывает основы деятельности в области охраны труда, техники безопасности и окружающей среды (HSE) в концептуальном проектировании процессов.В первом разделе описаны факторы воздействия на здоровье, а также методы оценки с помощью компьютерного моделирования. Безопасность в лучшем случае достигается за счет более безопасной конструкции. Кратко рассматривается защита оборудования с помощью предохранительных клапанов. Глава завершается методами оценки и предотвращения технологических рисков.

    Глава 17 посвящена анализу устойчивости , важному предмету сегодня как для общества, так и для промышленности. Центральными вопросами являются концепция оценки жизненного цикла (ОЖЦ), соотношение экологической стоимости, анализ экологической эффективности и показатели устойчивости.

    Последняя часть книги посвящена темам, помогающим в планировании и выполнении проекта концептуального дизайна .

    Глава 18 проекта Process Design Project обсуждает образовательные аспекты. Предоставляются рекомендации для разработки курсов и проектов на уровне магистра наук, адаптированных к Европейской системе перевода зачетных единиц, а также для последипломного и непрерывного образования.

    Глава 19 обрабатывает Экономическая оценка проекта концептуального дизайна.Центральными темами являются временная стоимость денег, оценка капитальных и эксплуатационных затрат и анализ рентабельности.

    В главе 20 представлены рекомендации по выбору и определению размеров оборудования , а именно сокращенные методы быстрой оценки реакционных сосудов, разделительных колонн, теплообменников и устройств для транспортировки жидкостей, которые могут быть использованы с возможностями определения размеров пакета моделирования. для оценки общей инвестиционной стоимости.

    Глава 21 представляет Примеры из практики , более подробно иллюстрирующие некоторые примеры, включая полное динамическое моделирование с реализацией управления.

    Полезные технические данные для дизайн-проектов приведены в Приложениях, такие как оценка затрат на оборудование и инженерные сети, материалы конструкции, таблицы пара, давление пара некоторых ключевых жидкостей и коэффициенты пересчета.

    Материал этой книги подходит для организации курсов по химическим процессам и дизайну продуктов для получения степени магистра в области химического машиностроения. Материал должен быть адаптирован к конкретной учебной среде, а именно к базовым знаниям в области химического машиностроения, а также к распределению времени в учебной программе.Расширенные функции представляют интерес для аспирантов и аспирантов, участвующих в дизайнерских или исследовательских проектах. Наконец, книга будет полезна профессиональным инженерам как обновленная информация о последних концептуальных разработках в области проектирования устойчивых процессов, а также об эффективном использовании инструментов компьютерного моделирования.

    Лучший способ закрепить творческие навыки, приобретенные во время концептуального дизайн-проекта, - это разработать комплексный проектный проект завода , который подходит для развития профессиональных дизайнерских знаний, необходимых в инжиниринговых компаниях.В качестве дополнительного материала мы рекомендуем недавнюю книгу Таулера и Синнотта (2013).

    Проектирование, разработка и контроль работоспособности фотоэлектрического-теплового (PVT) воздушного коллектора

    Реферат Солнечная энергия является одним из наиболее важных возобновляемых источников энергии, как в тепловых, так и в фотоэлектрических приложениях, которые необходимы миру. В фотоэлектрических приложениях температура окружающей среды является важным параметром работы системы солнечных элементов. В настоящей работе, на первом этапе, эффективность хорошо известных коммерческих солнечных модулей (MCM, SHARP и SANYO) оценивалась под влиянием реальных внешних условий в окружающей среде Багдада.Результаты показали, что окружающая температура вызвала повышение температуры поверхности модуля примерно вдвое по сравнению с ее значением. Результаты также показали, что выходное напряжение модуля, выходная мощность и, следовательно, электрический КПД ухудшались с увеличением температуры модуля. Процент снижения напряжения холостого хода для модулей MCM и SHARP составил 24,8% и 24,1% соответственно, в то время как для модуля SANYO это был наименьший процент (16,5%) из-за свойств геометрии соединения.Процентное снижение выходной мощности и, следовательно, КПД по сравнению с увеличением температуры модуля (ΔT = 67 ° C) составило 32,6%, 32,2% и 19,84% для MCM, SHARP и SANYO соответственно. Из-за снижения выходной мощности и электрического КПД солнечных модулей при повышении их температуры, решение этой проблемы, особенно в условиях Багдада, было вторым этапом данной работы; в котором система охлаждения была разработана для снижения температуры модуля для восстановления части потерянной мощности и сохранения длительного срока службы солнечного модуля.Два типа солнечных модулей, MCM1 и SHARP, были подвергнуты оценочным измерениям под воздействием двух типов систем охлаждения, систем охлаждения открытого и закрытого цикла в течение летнего сезона. Результаты показали, что оптимальная скорость потока теплоносителя в обеих системах составляла 6 л / мин. Результаты также показали, что система охлаждения с открытым циклом была немного более высокой. эффективнее, чем система с замкнутым циклом, но изначально стоит дороже и потребляет больше электроэнергии при эксплуатации. Эти системы работали для снижения потерь мощности до низкого процента, который составлял около 5%, таким образом, более 82% потерянной мощности было возвращено.Электрический КПД солнечного модуля MCM1 в системе охлаждения с открытым циклом стал 12,1% после охлаждения и 13,12% для солнечного модуля SHARP. Тепловая эффективность была рассчитана для существующей системы охлаждения, которая составила 51,3 для солнечных модулей MCM1 и 53,25% SHARP соответственно. Таким образом, общий КПД солнечных модулей MCM1 и SHARP составил 63,4% и 66,37% соответственно. «В системе охлаждения с замкнутым циклом электрический КПД солнечного модуля MCM1 после охлаждения стал 11,63%, а для солнечного модуля SHARP - 13,02%.Тепловой КПД составил 50,05% для солнечных модулей MCM1 и 51,54 для солнечных модулей SHARP соответственно, а общий КПД составил 61,68% и 64,65% для солнечных модулей MCM1 и SHARP соответственно.

    Стратегия назначения ставок и аукционов в Linkedin Ads: окончательное руководство на 2021 год

    Вы слишком много платите за свою рекламу в Linkedin? Вы используете правильную стратегию назначения ставок для рекламы? Знаете ли вы, что каждая маркетинговая цель Linkedin имеет разные способы взимания платы с рекламодателей?

    Система ставок Linkedin - наименее понятный, но самый важный момент при размещении рекламы на Linkedin.

    Способ взимания платы с рекламодателей сильно отличается от других социальных сетей.

    Если вы не знаете, сколько с вас взимается, вы не можете контролировать свои расходы на рекламу.

    В этом руководстве вы узнаете:

    • Что такое система целевой рекламы Linkedin
    • Какие существуют платные клики в зависимости от целей
    • Как выбрать правильную стратегию назначения ставок для своих объявлений

    Связанные : Как запустить рекламу в Linkedin в 2021 году - подробное руководство по рекламе в Linkedin

    Что такое система целевой рекламы Linkedin?

    Целевая реклама Linkedin

    Если вы размещали рекламу на Linkedin в последние годы, это изображение будет вам знакомо.

    Linkedin зашла очень далеко, и это серьезная переработка его инструмента управления кампаниями.

    Объективная реклама (OBA) предназначена для обеспечения «более качественных» кликов. Что ж, только если вы знаете, как это работает и как им пользоваться!

    Когда Linkedin знает вашу цель, он позволяет рекламодателям делать 3 вещи:

    1. Легко создавать кампании и отчеты
    2. Настраивать параметры оптимизации и ставок в соответствии с вашими целями
    3. Платить только за клики, которые хотят рекламодатели.

    Прежде чем продолжить, подумайте о том, чего вы пытаетесь достичь. Вы собираетесь искать потенциальных клиентов? Предоставляете воздушное прикрытие для своих торговых представителей? Вы хотите увеличить долю голоса?

    Linkedin разбивает эти цели на 3 категории:

    1. Осведомленность
    2. Рассмотрение
    3. Конверсия

    Не все сводится к конверсиям. В большинстве случаев имеет смысл повысить узнаваемость бренда и заинтересовать его, прежде чем привлекать потенциальных клиентов.

    Подумайте об этом, мог бы кто-нибудь сказать «да» и жениться на вас, даже не узнав вас? Шансы невелики. То же самое и с рекламой.

    Люди должны знать вас и доверять вам, прежде чем покупать у вас.

    Что такое ставки в Linkedin и как они влияют на ваши кампании?

    Знаете ли вы, что ваша оплата в Linkedin отличается по сравнению с другими платформами социальных сетей? Платежность влияет на то, как вы платите и делаете ставки за свои объявления. Теперь он соответствует достижению целей вашей кампании.

    Узнаваемость бренда

    Все кампании по повышению узнаваемости бренда в категории узнаваемости будут тарифицироваться только за показы. Плата за клики не взимается, потому что вы платите за показы. Основная цель этой задачи - познакомить аудиторию с вашим брендом, услугами и продуктами.

    Пример спонсируемого контента на Linkedin

    Чтобы измерить это, показатель «клики» показывает всех кликов, , включая взаимодействия по объявлению.

    Clicks on Linkedin Campaign Manager Tool

    Как видите, не имеет значения, нажимает ли кто-то на ваше объявление, потому что плата взимается за показы.

    Посещений веб-сайта

    С вас будет взиматься отдельная плата в зависимости от того, какую систему ставок вы выберете. Есть 2 варианта.

    Пока не вдавайтесь в технические подробности, так как мы поговорим об этом позже. Под ценой за клик у вас есть максимальная цена за клик и Оптимизированная цена за клик. Вы по-прежнему платите кликами, отличается только процесс оптимизации.

    Пример рекламного контента

    Отличные новости! Теперь вы будете платить только тогда, когда кто-то нажимает на ссылки, которые приводят участников на ваш сайт. Вы не платите за клики, которые не связаны с вашими целями, например за клики по взаимодействию или переходу на страницу компании.

    Переходы на ваш веб-сайт могут происходить в результате щелчков по определенным URL-адресам, встроенным во вводный текст, изображение сообщения, заголовок или CTA. Как правило, платными будут только те клики, которые приводят к увеличению трафика на ваш сайт.

    Под CPM у вас есть максимальная цена за тысячу показов и автоматическая ставка. Оба эти обвинения вас по впечатлениям еще. Таким образом, не имеет значения, нажимает кто-то или не нажимает, вы все равно будете платить за каждую тысячу просмотров вашего объявления.

    Вовлеченность

    У вас есть схожие модели закупок по цене за клик и за тысячу показов для взаимодействия.

    Цель взаимодействия - заставить участников взаимодействовать с вашим брендом. Таким образом, каждое взаимодействие будет платным. Взаимодействия означают все виды кликов по объявлению.

    Образец спонсируемого контента Linkedin

    Эти платные клики включают

    • переходов на страницу участника
    • переходов на страницу Linkedin
    • переходов на целевую страницу (внутри вводного текста)
    • на кнопку перехода
    • на переходы на целевую страницу (на изображение публикации)
    • (Заголовок)
    • Социальная таблетка
    • Социальные действия (лайки, комментарии и публикация)
    Совет профессионала:

    Цель взаимодействия приведет к более низкой цене за клик, тем более, что другие рекламодатели соревнуются друг с другом в предложении цены за большее популярные цели.Но у аудитории может быть меньшее намерение взаимодействовать с вашим брендом. Вопрос качества против количества.

    Просмотры видео

    Просмотры просмотров Цели оплачиваются по цене за просмотр (CPV). Это означает, что вам нужно точно знать, как Linkedin определяет представление.

    Вид основан на 2 или более непрерывных просмотрах при 50% отображаемого на экране момента.

    Панель мониторинга Менеджера кампаний Linkedin

    Показателем, который следует отслеживать на панели управления, будет эффективная цена за просмотр, которая представляет собой ориентировочную стоимость просмотра.

    Почему это «оценка»? Это потому, что некоторые из ваших видео просматриваются бесплатно из-за обычного охвата. eCPV стремится дать вам только платные просмотры видео.

    Хотя просмотры видео подходят для этапа «Рассмотрение», я счел его более полезным, если вы пытаетесь повысить узнаваемость своего бренда.

    Нет, если только вы не перенаправляете на теплую аудиторию видео с более низкой воронкой.

    Привлечение клиентов

    Здесь вы можете делать ставки по модели CPC или CPM.Автоматическое назначение ставок также производится по показам, поэтому мы сгруппируем их вместе по модели CPM.

    Это изображение для платных кликов применимо только к ценам за клик. При цене за тысячу показов вы будете платить только за показы.

    Платные клики в этом формате включают:

    • Щелчок на странице компании Linkedin
    • Клики по форме лидогенерации
    • Клики по социальной таблетке

    Конверсии веб-сайта

    Как и в случае с лидогенерацией, у вас есть варианты CPC и CPM .

    Клики, которые приводят потенциальных клиентов на целевую страницу, являются платными. Если вы используете здесь видео, при нажатии в любом месте заголовка (призыв к действию или видео) будет открыта целевая страница рекламодателя ниже.

    Общие сведения об аукционе объявлений Linkedin

    На аукцион объявлений влияют четыре основных фактора. Каждый уникальный фактор принадлежит 3 различным заинтересованным сторонам (рекламодателю, участнику и самим Linkedin). Он проходит в линейной последовательности ниже

    1. Таргетинг
    2. Ставки для объявлений, ограничение частоты показов и время размещения бюджета
    3. Релевантность рекламы
    4. Рейтинг рекламы

    Вот подробное описание того, как работает аукцион объявлений Linkedin.

    Как работает рекламный аукцион linkedin
    Таргетинг

    Когда участник в Linkedin просматривает свой канал, он видит как обычный, так и платный контент. Платный контент (реклама) размещается между каждыми несколькими органическими материалами. Как только маркетологи запускают рекламные кампании, нацеленные на конкретного участника, на аукцион Linkedin отправляется запрос объявления, и для этого конкретного участника размещается ставка.

    Ставки, ограничение частоты показов и расходование бюджета

    Ставка рекламодателя конкурирует с другими ставками на аналогичную аудиторию с таргетингом с использованием того же формата рекламы. Если вы показываете видеообъявление, вы не будете делать ставки против других, использующих объявления с одним изображением, хотя аудитория такая же.

    Linkedin использует модель аукциона второй цены для процесса торгов. Это означает, что рекламодателям нужно заплатить всего лишь на 1 цент выше, чем следующая наивысшая ставка, чтобы выиграть ставку. Это будет более справедливо по отношению к рекламодателям, поскольку они всегда будут платить меньше.

    Все типы ставок стандартизированы для модели eCPI, чтобы работать с одним и тем же значением.

    • CPC = pCTR x bid = eCPI
    • CPM = CPM Bid x 1000 = eCPI
    • CPV = eCPV x Bid = eCPI

    Когда ставка выиграна, Linkedin проверит, что участник не превысил ограничение частоты показов и бюджет до показа объявления.

    Имейте в виду, что Linkedin также ставит опыт участника на первое место. Таким образом, если объявление показывалось этому участнику слишком много раз повторно (превышено ограничение частоты показов), оно не будет отображаться, чтобы предотвратить раздражение участников.

    Релевантность

    Победитель аукциона получает слот запроса объявления на основе совокупного значения показателя eCPI и высокой оценки релевантности.

    Что такое оценка релевантности?

    Оценка релевантности - это прогноз, сделанный машинным обучением Linkedin AI, в отношении того, будет ли участник действовать над объявлением.

    • В кампаниях Linkedin CPC / CPM используется pCTR. pCTR означает прогнозируемый CTR участника.
    • Linkedin Лид-кампании используют pLTR. pLTR относится к прогнозируемой процентной ставке участника.
    • Видеокампании Linkedin использовали pVTR. pVTR используется для определения релевантности видеокампаний, рассчитываемой как количество просмотров> 2 секунд / количество показов.
    Рейтинг

    Рейтинг будет присвоен объявлению на основе указанной выше оценки релевантности.Высокая ставка в долларах не означает, что вы ее выиграете.

    На самом деле вы могли бы потратить меньше и выиграть больше аукционов, имея хорошие показатели релевантности. Оценка релевантности может быть достигнута за счет показа хорошей рекламы нужной аудитории.

    Показатель качества кампании Linkedin и его влияние на релевантность рекламы?

    Показатель качества кампании Linkedin является прокси для показателя релевантности рекламы, как указано выше. Фактическая оценка релевантности рекламы не передается, передается только оценка качества кампании (CQS).

    CQS относится к релевантности кампании по сравнению с ее конкурентами на всех аукционах, в которых они участвуют.

    Что такое диапазон оценки качества Linkedin?

    Каждой кампании присваивается нормализованный балл от 1 до 10 на основе сравнения всех аукционов, в которых участвует данная кампания.

    Как рассчитывается показатель качества кампании?

    В качестве прокси для оценки релевантности рекламы система использует каждый аукцион, в котором участвовала кампания: pCTR для 1-го рекламного места / pCTR * кампании, исходя из той же аудитории и форматов рекламы.

    Используйте показатель качества кампании Linkedin только как ориентир. Это должен быть только второстепенный показатель.

    Как улучшить показатель качества вашей кампании в Linkedin?

    Чтобы увидеть улучшение вашего показателя качества, я рекомендую поэкспериментировать со следующим:

    • Различные типы ставок
    • Разные рекламные объявления
    • Разные рекламные таргетинги

    Показатель качества кампании, вероятно, будет хорошим индикатором того, насколько вы повторно запустить эффективную рекламную кампанию в Linkedin

    Как выбрать правильный тип ставок в Linkedin? [Обновление за декабрь 2020 г.]

    Правильная стратегия назначения ставок - ключ к успеху вашей кампании.Интеллектуальное назначение ставок помогает рекламодателям быть более конкурентоспособными и получать лучшие результаты от своих объявлений.

    Рекламные объявления и таргетинг на аудиторию тоже имеют значение, но назначение ставок - это самый быстрый способ оптимизации из всех возможных. Поэтому понимание структуры торгов в Linkedin является ключевым моментом.

    Стратегии назначения ставок всегда должны различаться в зависимости от целей рекламодателя.

    Вот карта, на которой показан правильный тип назначения ставок в Linkedin.

    Типы ставок и стратегия Linkedin

    Бюджет

    Это относится к сумме бюджета, которую вы готовы потратить.Прежде чем вы сможете выбрать тип ставки в инструменте управления кампанией, необходимо выбрать бюджет и расписание.

    Что влияет на использование вашего бюджета?

    1. Ad Auction (Ваша ставка и текущая рыночная конкуренция будут влиять на аукцион)
    2. Pacing
    3. Оценка релевантности и оценка качества кампании

    Расписание

    Установленное вами расписание определит продолжительность кампании. Вы можете установить дневной бюджет, дневной и пожизненный бюджет или пожизненный бюджет.

    Если вы выберете дневной бюджет, вы сможете запустить кампанию непрерывно. Вы можете выбрать дату начала и окончания кампании. Обратите внимание, что не существует ограничения бюджета , если только вы не ограничили бюджет на уровне группы кампании.

    Я бы порекомендовал добавить дату окончания кампании на всякий случай.

    Выбор дневного бюджета

    Если вам интересно, сколько вы потратите в целом с учетом дневного бюджета, продолжительности кампании (если таковая имеется) и размера аудитории, вы можете использовать инструмент прогнозирования.

    Инструмент прогнозирования дневного бюджета

    В приведенном выше примере вы потратите в общей сложности от 940 до 1600 долларов примерно за 30 дней для целевой аудитории 2 900 000+

    Другой вариант - вариант бюджета «Ежедневный и пожизненный». Хотя вы можете установить ограничение на весь срок действия бюджета, вы не сможете выбрать дату окончания кампании. Кампания продолжается до тех пор, пока не будет исчерпан общий бюджет.

    Я бы рекомендовал использовать эту опцию только в том случае, если у вас нет кампаний, чувствительных ко времени.

    Установите пожизненный и дневной бюджет

    Может быть неприятно, что невозможно установить дату окончания кампании.Однако это связано с темпами работы алгоритма. Я объясню позже.

    Последний вариант - выбор только пожизненного бюджета. Выбор этого позволяет определить дату начала и окончания кампании.

    Примечание. Это мой рекомендуемый выбор для большинства кампаний.

    Но вам может быть интересно: «Что произойдет, если Linkedin исчерпает весь мой бюджет за 1 день? Я не могу контролировать дневной бюджет? "

    Этого НЕ произойдет.

    Алгоритм Linkedin равномерно распределяет бюджет в зависимости от наличия инвентаря на протяжении всей кампании.

    Все еще не уверены? Подожди, я скоро расскажу о том, как ходить. Но вот как выглядит выбор пожизненного бюджета.

    Вариант пожизненного бюджета

    Время размещения

    Время размещения - это скорость и постоянство расходов на протяжении кампании (если таковые имеются).

    В настоящее время существует 2 типа стимуляции: ежедневная и пожизненная. Linkedin, похоже, движется только к пожизненному ритму.

    Daily Pacing

    Если вы выберете Ежедневное регулирование скорости и Непрерывное расписание, алгоритм рекламы оптимизируется с использованием ежедневного регулирования скорости.

    Ваши кампании будут эффективно расходоваться в течение 24 часов. Кампании оптимизированы на ежедневный прогнозируемый трафик.

    Дневной бюджет и кампания постоянно
    Время размещения

    Время размещения оптимизирует расходы на протяжении всей кампании. Время размещения будет расходовать ваш бюджет на предсказание и прогнозирование переменного объема трафика на протяжении вашей кампании.

    Это означает, что в некоторые дни ваши кампании могут тратить больше.Если Linkedin прогнозирует, что в предстоящие выходные будет мало членского трафика, они будут тратить меньше и тратить больше в будние дни, когда посещаемости больше.

    Вам больше не нужно вручную ежедневно просматривать свою кампанию для корректировки бюджета, Linkedin оптимизирует время размещения.

    Я настоятельно рекомендую использовать это. Если Linkedin подписан на Facebook, то в будущем, вероятно, будет единственным вариантом по умолчанию будет время жизни.

    Хотя это новинка и алгоритм все еще дорабатывается, ожидайте, что этот вариант станет только лучше.

    Вот преимущества Lifetime Pacing и почему Linkedin, вероятно, сделает его по умолчанию.

    1. Повышение рентабельности инвестиций за счет повышения эффективности бюджета
    2. Экономит ваше время при управлении кампанией. Больше никаких ежедневных изменений
    3. Не нужно приостанавливать и корректировать кампании по дням / часам, когда вы чувствуете, что посещаемость участников низкая.
    4. С этой опцией цена за результат должна со временем стабилизироваться.

    Какие комбинации расписания бюджета активируют алгоритм Lifetime Pacing?

    • Ежедневный бюджет и фиксированное расписание.
      • После установки конечной даты используется время жизни.
      • Этот параметр оптимизирует показ на протяжении всего срока действия кампании с ограничением дневного бюджета.
    • Пожизненный бюджет и фиксированный график.
      • Этот параметр оптимизирует эффективную доставку на протяжении всей кампании
    • Ежедневный и пожизненный бюджет и непрерывный график только с датой начала
      • Этот параметр оптимизирует доставку на протяжении всей кампании.
      • Если вы хотите провести кампанию в определенные даты, этот вариант вам не подходит.

    Ставки

    Ставка - это сумма, которую вы готовы платить за каждое действие или результат вашей кампании. Выбор ставки должен основываться на вашей цели.

    После запуска вашей кампании вы будете участвовать в аукционе объявлений с другими кампаниями. Ваша ставка играет важную роль в обеспечении успеха вашей кампании. Если ваши ставки слишком низкие, вы не достигнете своего клиента, даже если у вас есть крутой контент или предложение.

    Вот подробное описание того, что такое ручное, повышение цены за клик и автоматическое назначение ставок.

    Назначение ставок вручную

    Это также известно как назначение ставок с максимальной стоимостью. Это дает вам больше контроля над своими расходами. Однако вам потребуется гораздо больше усилий, чтобы управлять ставками. На мониторинг, настройку и оптимизацию требуется больше времени. Вот несколько полезных тактик.

    • Linkedin предлагает рекомендации по уровням ставок при использовании этого типа ставок. Если это новая кампания, всегда загружайте объявление заранее, чтобы получать данные как можно раньше.Ставка на 20% выше рекомендованной. Почему? Это гарантирует, что вы выиграете больше на аукционе и ваша реклама будет больше показываться. Вы сможете увидеть, работают ли ваши кампании, и заранее найти стратегии оптимизации.
    • Если дневной бюджет расходуется полностью, можно попробовать снизить ставку на 10%. Посмотрите, сможете ли вы по-прежнему добиться того же уровня результатов с более низкой ставкой. Кроме того, вы можете найти среднюю цену за клик на панели управления кампании и скорректировать ставку до этого уровня.Linkedin работает на аукционе второй цены. Скорее всего, вы заплатите меньше, чем вы предлагаете.
    • Однако, если вы не израсходуете хотя бы 80–85% дневного бюджета, это означает, что у вас проблемы с доставкой. Одной из причин может быть низкий уровень ставок. Когда вы ставите слишком низкую ставку, ваше объявление проигрывает конкурентам на аукционе. В этом случае вам нужно будет увеличить дневной бюджет ставок. Выигрывайте больше аукционов, показывайте рекламу и получайте трафик. Контролируйте и убедитесь, что вы израсходуете минимум 80–85% дневного бюджета.
    • CPC (Стоимость за клик)
    • CPM (Стоимость за показ)
    • CPV (Стоимость за просмотр)
    • CPS (Стоимость за отправку) - это относится к рекламным сообщениям.
    Ставка целевой цены

    Это относится к ценам за клик, за тысячу показов и за просмотр. Думаю, скоро будет доступен целевой CPL. Это имеет смысл, правда?

    Целевая стоимость позволяет установить целевую стоимость. Linkedin автоматически назначит ставки и оптимизирует ваши кампании, чтобы обеспечить максимальные результаты, оставаясь в диапазоне ваших целевых затрат.Ваша ставка может быть увеличена до 1,3-кратной целевой цены.

    Этот вариант отлично подходит, если у вас целевая рентабельность инвестиций.

    Среднесуточная стоимость результата будет оптимизирована, чтобы быть близкой к вашей цели. Фактическая стоимость никогда не будет превышать 30% плановой стоимости в день.

    Оптимизированная ставка CPC

    Считайте это полуавтоматическим способом назначения ставок.

    Установив этот флажок, вы включите Оптимизированную цену за клик. Этот вариант ставок будет автоматически оптимизирован для людей, которые, скорее всего, выполнят желаемое вами действие.

    Linkedin повысит или снизит ставку, чтобы охватить наиболее подходящих людей, которые предпримут действия.

    В eCPC вы по-прежнему можете выбрать сумму ставки, и отклонение будет недалеко от выбранной ставки.

    Оптимизатор цены за клик доступен только для посещений веб-сайтов, взаимодействия, привлечения потенциальных клиентов и целей конверсии веб-сайтов.

    При автоматическом назначении ставки вы не сможете указать цену ставки. Управление ставками передано Linkedin.

    Это хорошо? Читать дальше.

    Автоматические торги

    В этой модели назначения ставок используется машинное обучение Linkedin.Цель состоит в том, чтобы получить как можно больше результатов, полностью расходуя дневной бюджет. Это также делает доставку приоритетной. Это означает, что если вы чрезвычайно экономны, это может быть не лучшая модель для начала. Установка ставок не требуется.

    Хорошие новости с автоматическим назначением ставок: вам не нужно вручную управлять аккаунтом. Вы по-прежнему можете выигрывать аукционы без оптимизации ставок через день - без помощи рук. Вы не попадете в ситуации, когда вы проиграете конкурентную ставку.Это предотвращает любое ограничение доставки.

    • Важно отметить, что автоматическое назначение ставок работает по модели CPM.
    • Бывают случаи, когда ставки устанавливаются слишком высокими при ручном назначении ставок. Это приводит к тому, что кампании выполняются слишком быстро. Есть вероятность, что эти заявки выиграли бы при более низкой ставке и достигли бы тех же результатов. Вы не можете узнать. Здесь может помочь автоматическое назначение ставок.
    • Кроме того, рекламодатель может установить слишком низкую ставку, и кампания не принесет результатов.Этим клиентам следовало бы повысить ставку для получения лучших результатов, но у них нет возможности узнать. Устранение этих потенциальных проблем с помощью autobid утверждает время размещения объявления

    Итак, что лучше для вас? Ручные или автоматические торги?

    Рекламодатели в основном сидят в 2 лагерях. Один из них посвящен управлению затратами, а другой - доставке.

    Где ты?

    Стоимость как приоритет

    Используйте для начала модель назначения ставок вручную (CPC, CPM, CPV). Это означает, что вы не будете платить больше установленной вами максимальной стоимости.

    Дайте этому поработать примерно 1 неделю. Проверьте, работает ли ваша кампания через 1 неделю. Если вы используете не менее 80% дневного бюджета с назначением ставок вручную, ваши кампании работают!

    Если общая эффективность кампании, такая как CTR, CPL, VTR и т. Д., Тоже высока, то рекламодатели могут переключиться на автоматическое назначение ставок.

    При наличии некоторых исходных согласованных данных Linkedin сможет дополнительно оптимизировать ваши расходы с помощью автоматического назначения ставок.

    Однако их рекламный алгоритм не кажется таким сложным, как у Facebook.Так что будьте внимательны при переключении. Если результаты начинают ухудшаться, вернитесь к ручной цене за клик.

    Доставка и результаты в качестве приоритета

    Если доставка и доставка вашего сообщения является приоритетом, начните с автоматического назначения ставок. Автоматическое назначение ставок позволит получить как можно больше результатов при полном расходе дневного бюджета.

    Автоматическое назначение ставок исключает возможность догадок при проведении торгов и обеспечивает максимальные результаты.

    Autobid обеспечивает бесперебойную доставку. Однако использование этого слишком рано приведет к увеличению ваших затрат.Если вы очень чувствительны к затратам, то начинать с автоматической ставки - плохая идея.

    Вот хорошая диаграмма от Linkedin о том, когда использовать автоматические ставки.

    Процесс утверждения алгоритмов и содержания Linkedin

    Другие функции назначения ставок

    Предложения ставок и рекомендации

    Вы столкнетесь с предложениями при создании объявлений Linkedin и в середине своих кампаний.

    Linkedin использует исторические данные аукционов и обновляет рекомендации каждый день.Если ваши кампании могут извлечь из этого выгоду, Linkedin сообщит вам об этом в вашем инструменте Менеджера кампаний.

    Последние мысли

    Не существует единой правильной стратегии назначения ставок. Все зависит от того, чего вы пытаетесь достичь. Я рекомендую начать с eCPC в течение первых 1-2 недель. Это полуавтоматический режим, но он дает Linkedin некоторую гибкость в увеличении ставки для участников, которые, по их мнению, могут конвертироваться.

    Если результаты стабильны, протестируйте 1-2 недели с автобидом. Вернитесь к ручному режиму, если затраты выйдут из-под контроля.

    Освоения торгов недостаточно. Рекламные креативы так же, если не больше, важны для достижения результатов.

    Если вы готовы погрузиться глубже, ознакомьтесь с собранными ресурсами для запуска рекламы в Linkedin

    SEC.gov | Превышен порог скорости запросов

    Чтобы обеспечить равный доступ для всех пользователей, SEC оставляет за собой право ограничивать запросы, исходящие от необъявленных автоматизированных инструментов. Ваш запрос был идентифицирован как часть сети автоматизированных инструментов за пределами допустимой политики и будет обрабатываться до тех пор, пока не будут приняты меры по объявлению вашего трафика.

    Пожалуйста, объявите свой трафик, обновив свой пользовательский агент, чтобы включить в него информацию о компании.

    Чтобы узнать о передовых методах эффективной загрузки информации с SEC.gov, в том числе о последних документах EDGAR, посетите sec.gov/developer. Вы также можете подписаться на рассылку обновлений по электронной почте о программе открытых данных SEC, включая передовые методы, которые делают загрузку данных более эффективной, и улучшения SEC.gov, которые могут повлиять на процессы загрузки по сценариям. Для получения дополнительной информации свяжитесь с opendata @ sec.губ.

    Для получения дополнительной информации см. Политику конфиденциальности и безопасности веб-сайта SEC. Благодарим вас за интерес к Комиссии по ценным бумагам и биржам США.

    Код ссылки: 0.67fd733e.1629397539.4fae0039

    Дополнительная информация

    Политика безопасности в Интернете

    Используя этот сайт, вы соглашаетесь на мониторинг и аудит безопасности. В целях безопасности и для обеспечения того, чтобы общедоступная услуга оставалась доступной для пользователей, эта правительственная компьютерная система использует программы для мониторинга сетевого трафика для выявления несанкционированных попыток загрузки или изменения информации или иного причинения ущерба, включая попытки отказать пользователям в обслуживании.

    Несанкционированные попытки загрузить информацию и / или изменить информацию в любой части этого сайта строго запрещены и подлежат судебному преследованию в соответствии с Законом о компьютерном мошенничестве и злоупотреблениях 1986 года и Законом о защите национальной информационной инфраструктуры 1996 года (см. Раздел 18 USC §§ 1001 и 1030).

    Чтобы обеспечить хорошую работу нашего веб-сайта для всех пользователей, SEC отслеживает частоту запросов на контент SEC.gov, чтобы гарантировать, что автоматический поиск не влияет на возможность доступа других пользователей к SEC.содержание правительства. Мы оставляем за собой право блокировать IP-адреса, которые отправляют чрезмерное количество запросов. Текущие правила ограничивают пользователей до 10 запросов в секунду, независимо от количества машин, используемых для отправки запросов.

    Если пользователь или приложение отправляет более 10 запросов в секунду, дальнейшие запросы с IP-адреса (-ов) могут быть ограничены на короткий период. Как только количество запросов упадет ниже порогового значения на 10 минут, пользователь может возобновить доступ к контенту на SEC.губ. Эта практика SEC предназначена для ограничения чрезмерного автоматического поиска на SEC.gov и не предназначена и не ожидается, чтобы повлиять на людей, просматривающих веб-сайт SEC.gov.

    Обратите внимание, что эта политика может измениться, поскольку SEC управляет SEC.gov, чтобы гарантировать, что веб-сайт работает эффективно и остается доступным для всех пользователей.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *