Содержание

Единый расчет по страховым взносам-2019 (бланк)

Единый расчет по страховым взносам-2019, форма которого является унифицированной, подается работодателями в ФНС. До 2017 года функции администратора страховых отчислений выполняли страховые фонды, после реформирования этого сегмента государственного мониторинга контроль взносов стал частью работы налоговых инспекций. Исключение было сделано только в отношении взносов на травматизм, по ним отчетность по-прежнему собирается Фондом соцстрахования.

Когда был введен расчет по страховым взносам (форма для сдачи в ИФНС)

После изменения администратора страховых отчислений потребовалось обновление отчетных форм. Налоговики преобразовали отчетность по разным видам взносов в один документ, приблизив его формат к налоговым декларациям. Измененный «Расчет по страховым взносам», бланк которого был утвержден отдельным приказом ФНС (документ датирован 10 октября 2016 г., ему присвоен регистрационный номер ММВ-7-11/[email protected]), подается работодателями с 1 квартала 2017 года.

Одновременно с введением такого формата отчетности по страховым отчислениям были выведены из системы документооборота РСВ-1, РСВ-2 и РВ-3.

В ФНС нанимателями «Расчет по страховым взносам» (форма 1151111) должен представляться ежеквартально (по итогам квартала, полугодия, девятимесячного интервала и за год). Разработанный налоговиками действующий «Расчет по страховым взносам» (скачать бланк можно ниже) в полном формате включает 24 листа. Сдаче подлежат только те страницы, в которые введены данные. Если для внесения сведений в отдельные листы у работодателя нет оснований, такие блоки отчета не надо включать в комплект документов, отправляемых в контролирующую структуру.

Единый расчет по страховым взносам 2019 – бланк изменят или нет?

С начала 2019 года предполагается актуализировать форму отчетности по страховым перечислениям работодателей. Об этом свидетельствует находящийся на обсуждении ]]>проект Приказа ФНС]]>. Форма «Расчет страховых взносов» в 2019 году будет отличаться от текущей версии отчета несколькими параметрами:

  • титульный лист обновится за счет добавления в него полей для отображения сведений по обособленным подразделениям, которые были закрыты;

  • содержание приложений приведут в соответствие с изменившимися нормами применения пониженных тарифов по страховым взносам;

  • сократится перечень приложений, которыми дополнялся Раздел 1;

  • раздел 3 в обновленном варианте отчета будет занимать одну страницу вместо двух.

Как будет выглядеть «Расчет по страховым взносам» 2019? Скачать бланк, который предполагается использовать в 2019 году, из проекта приказа ФНС можно ниже, но при этом нужно учитывать, что представленный в проекте образец может подвергаться изменениям, так как правовой акт находится на стадии рассмотрения.

Внутри разделов и приложений планируется изменить некоторые детали. Например, в разделе 1

добавится поле, идентифицирующее тип плательщика посредством проставления кода. Если работодатель за последний трехмесячный интервал не осуществлял выплат по оплате труда, он должен обозначить этот факт шифром «3», если выплаты имели место, ставится код «1». Также раздел 1 будет содержать данные о взносах лишь за последние три месяца (без нарастания с начала года).

Приложение 2, дополняющее данные раздела 1, обновлено за счет введения в него новой строки, показывающей численность работников, с чьих доходов в рассматриваемом временном диапазоне были исчислены страховые взносы.

В Разделе 3 данные о номере корректирующей формы по застрахованному лицу будут заменены строкой с признаком аннулирования информации.

В подразделы 1.1 и 1.2 включат сведения о вычетах из облагаемой страхвзносами базы по п. 8 ст. 421 НК РФ.

«Расчет по страховым взносам»-2019, бланк из непринятого пока проекта приказа ФНС, не будет содержать приложений, посвященных пониженным тарифам страховых отчислений. В текущем отчете для их фиксации предназначено два приложения – 8 и 9.

Подраздел 1.4, посвященный суммам дополнительного соцобеспечения физическим лицам, являющимся членами летных экипажей в сфере гражданской авиации, и некоторым работникам угольной промышленности, стал отдельным приложением, ему присвоен номер 1.1.

После завершения этапа обсуждения и рассмотрения проекта приказа ФНС об изменении формы отчетности по взносам действующий Приказ № ММВ-7-11/[email protected] утратит актуальность. Предполагается, что обновленный вариант отчетного документа будет введен в систему документооборота работодателей и ФНС с отчетности за 1 квартал 2019 года.

Как заполнить расчет по страховым взносам за 2018 год, читайте здесь.

Зарплатная отчетность за 2019 год. Новое в отчетности за 1 квартал 2020 года

Зарплатная отчетность за 2019 год. Новое в отчетности за 1 квартал 2020 года

С 2020 года нововведений в порядке и правилах предоставления зарплатных отчетов довольно много. Чиновники ввели новые формы, например, обновили бланк РСВ за 1 квартал и последующие периоды 2020 года. Обновлены и некоторые сроки сдачи отчетности по заработной плате (годовые 6-НДФЛ и 2-НДФЛ). Корректировок коснулся и порядок предоставления отчетности. Отдельные отчеты вовсе будут объединены. Например, принят закон о слиянии 6-НДФЛ и 2-НДФЛ, РСВ и сведений о среднесписочной численности. Следовательно, утвердят и новые формы.

Что стоит учитывать, сдавая отчетность в 2020 году:

  • Новый порядок сдачи отчетности в ФНС. Если в компании 10 и более работников, отчитываться нужно электронно. Новшества коснулись отчетности по НДФЛ и страховым взносам. Кроме того, есть новшества для организаций с обособленными подразделениями.
  • Срок подачи 2-НДФЛ сократили на целый месяц. Раньше отчетность по доходам, с которых удержали НДФЛ, сдавали до 1 апреля. Теперь справки 2-НДФЛ со всеми признаками налогоплательщика подают до 1 марта года, следующего за отчетным. За 2019 год — до 02.03.2020, так как 1 марта — воскресный день.
  • Новый срок установлен и для 6-НДФЛ. С отчетности за 2019 год подать расчет придется до 02.03.2020 (1 марта — воскресенье).
  • Обновлен бланк отчета РСВ. Применять новый бланк придется при заполнении сведений за 1 квартал 2020 г. Старый бланк не примут. Изменения в форме незначительные и больше носят технический характер.

Для удобства в работе все документы сгруппированы в папки по следующим разделам:

– Отчетность за 2019 год.

  • Декабрьская зарплата и годовые премии в зарплатной отчетности;
  • 6-НДФЛ за год;
  • 2-НДФЛ за год;
  • РСВ за год.

– Изменения 2020.

– Отчетность за I квартал 2020 года.

  • 6-НДФЛ за I квартал 2020 года;
  • РСВ за I квартал 2020 года.

– Особенности исчисления страховых взносов.

– Особенности исчисления НДФЛ.

Наиболее важные и интересные моменты вынесены в закладки.

Тематическая подборка «Зарплатная отчетность за 2019 год. Новое в отчетности за 1 кварта 2020 года» позволит:

– значительно сэкономит время специалиста на изучение изменений, касающихся обложения НДФЛ и страховых взносов различных выплат работникам;

– поможет учесть требования налогового законодательства и сдать отчетность в соответствие с ними, а значит – избежать штрафов.

– поможет грамотно организовать работу на участке «зарплатные налоги» и тогда внеплановая проверка налогового органа будет не страшна.

 

 

 


ФСС – Прямые выплаты

Получить справку о выплаченных пособиях

Опубликован приказ Фонда социального страхования Российской Федерации от 04.02.2021 № 26 «Об утверждении форм документов, применяемых для назначения и выплаты в 2021 году территориальными органами Фонда социального страхования Российской Федерации застрахованным лицам страхового обеспечения по обязательному социальному страхованию на случай временной нетрудоспособности и в связи с материнством и по обязательному социальному страхованию от несчастных случаев на производстве и профессиональных заболеваний, осуществления иных выплат и возмещения расходов страхователей    в 2021 году на предупредительные меры по сокращению производственного травматизма и профессиональных заболеваний работников и санаторно-курортное лечение работников, занятых на работах с вредными и (или) опасными производственными факторами».

Приказы Фонда социального страхования Российской Федерации от 24.11.2017 N 578 “Об утверждении форм документов, применяемых для выплаты в 2012 – 2019 годах страхового обеспечения и иных выплат в субъектах Российской Федерации, участвующих в реализации пилотного проекта, предусматривающего назначение и выплату застрахованным лицам страхового обеспечения по обязательному социальному страхованию на случай временной нетрудоспособности и в связи с материнством и по обязательному социальному страхованию от несчастных случаев на производстве и профессиональных заболеваний, иных выплат и расходов территориальными органами Фонда социального страхования Российской Федерации” и от 24.11.2017 N 579 “Об утверждении форм реестров сведений, необходимых для назначения и выплаты соответствующего вида пособия, и порядков их заполнения” (вместе с “Порядком заполнения Реестра сведений, необходимых для назначения и выплаты пособий по временной нетрудоспособности, по беременности и родам, единовременного пособия женщинам, вставшим на учет в медицинских организациях в ранние сроки беременности”, “Порядком заполнения Реестра сведений, необходимых для назначения и выплаты единовременного пособия при рождении ребенка”, “Порядком заполнения Реестра сведений, необходимых для назначения и выплаты ежемесячного пособия по уходу за ребенком”) признаны утратившими силу.

 

О реализации на территории Российской Федерации пилотного проекта по выплатам пособий органами Фонда социального страхования Российской Федерации (пилотный проект «Прямые выплаты»)

 

С 2011 года на территории Российской Федерации Фонд социального страхования Российской Федерации (далее – Фонд) реализует пилотный проект, направленный на осуществление страховых выплат по обязательному социальному страхованию застрахованным лицам непосредственно территориальными органами Фонда (пилотный проект «Прямые выплаты»).

Целью пилотного проекта «Прямые выплаты» является улучшение положения застрахованных граждан и страхователей при осуществлении мероприятий, связанных с назначением и получением пособий в рамках обязательного социального страхования.

Пособия в рамках механизма прямых выплат рассчитываются и выплачиваются застрахованным лицам непосредственно территориальными органами Фонда в жестко установленные законодательством сроки.

Особенности финансового обеспечения, назначения и выплаты:
в 2012 – 2020 годах территориальными органами Фонда застрахованным лицам страхового обеспечения по обязательному социальному страхованию на случай временной нетрудоспособности и в связи с материнством и по обязательному социальному страхованию от несчастных случаев на производстве и профессиональных заболеваний, осуществления иных выплат и возмещения расходов страхователя на предупредительные меры по сокращению производственного травматизма и профессиональных заболеваний работников определены постановлением Правительства Российской Федерации от 21.04.2011 № 294 (далее – Постановление № 294).

В настоящее время в пилотном проекте «Прямые выплаты» участвует 69 субъектов Российской Федерации. С 1 июля 2020 года в пилотном проекте будет участвовать еще 8 субъектов Российской Федерации.

С 1 июля 2011 года в пилотном проекте участвуют Карачаево-Черкесская Республика и Нижегородская область, 1 июля 2012 в пилотный проект вошли Астраханская, Курганская, Новгородская, Новосибирская, Тамбовская области и Хабаровский край, с 1 января 2015  – Республика Крым, г. Севастополь, 1 июля 2015 – Республика Татарстан, Белгородская, Ростовская и Самарская области.

С 1 июля 2016 года к составу участников пилотного проекта присоединились еще 6 субъектов Российской Федерации – Республика Мордовия, Брянская, Калининградская, Калужская, Липецкая и Ульяновская области.

С 1 июля 2017 года в пилотном проекте по выплате пособий в рамках обязательного социального страхования непосредственно территориальным органом Фонда участвуют: Республика Адыгея, Республика Алтай, Республика Бурятия, Республика Калмыкия,  Алтайский край, Приморский край, Амурская область, Вологодская область, Омская область, Орловская область, Магаданская область, Томская область, Еврейская автономная область.

С 1 июля 2018 года механизм прямых выплат реализован еще в 6 субъектах Российской Федерации: Кабардино-Балкарской Республике, Республиках Карелия, Северная Осетия – Алания, Тыва, Костромской и Курской областях.

С 1 января 2019 года в пилотном проекте приняли участие следующие регионы: Республика Ингушетия, Республика Марий Эл, Республика Хакасия, Чеченская Республика, Чувашская Республика, Камчатский край, Владимирская, Псковская и Смоленская области, Ненецкий и Чукотский автономные округа.

С 1 июля 2019 года на механизм прямых выплат перешли еще 9 субъектов Российской Федерации: Архангельская, Воронежская, Ивановская, Мурманская, Пензенская, Рязанская, Сахалинская и Тульская области.

С 1 января 2020 года на механизм прямых выплат перешли следующие регионы: Республики Коми, Саха (Якутия), Удмуртская; Кировская, Кемеровская, Оренбургская, Саратовская, Иркутская и Тверская области; Ямало-Ненецкий автономный округ.

С 1 июля 2020 года в пилотном проекте примут участие: Республика Башкортостан, Республика Дагестан, Красноярский и Ставропольский края, Волгоградская, Ленинградская, Тюменская и Ярославская области.

С 1 января 2021 года механизм прямых выплат реализован в следующих регионах: Краснодарский край, Пермский край, Московская, Свердловская, Челябинская области, Ханты-Мансийский автономный округ, города федерального значения Москва и Санкт-Петербург.

Форма заявления, необходимого для назначения пособий, утверждается приказом Фонда социального страхования Российской Федерации от 24.11.2017 № 578 (зарег. в Минюсте России от 15 декабря 2017 г. № 49265) «Об утверждении форм документов, применяемых для выплаты в 2012-2019 годах страхового обеспечения и иных выплат в субъектах Российской Федерации, участвующих в реализации пилотного проекта, предусматривающего назначение и выплату застрахованным лицам страхового обеспечения по обязательному социальному страхованию на случай временной нетрудоспособности и в связи с материнством и по обязательному социальному страхованию от несчастных случаев на производстве и профессиональных заболеваний, иных выплат и расходов территориальными органами Фонда социального страхования Российской Федерации».

Форма электронного реестра сведений утверждена приказом Фонда социального страхования Российской Федерации от 24.11.2017 № 579 (зарег. в Минюсте России от 17 января 2018 г. № 49665) «Об утверждении форм реестров сведений, необходимых для назначения и выплаты соответствующего вида пособия, и порядков их заполнения».

В соответствии с Постановлением № 294 после получения от застрахованного лица (его уполномоченным представителем) заявления и необходимых для назначения и выплаты соответствующего вида пособия страхователь не позднее 5 календарных дней со дня их представления направляет в территориальный орган Фонда сведения для назначения и выплаты соответствующего вида пособия (в виде электронного реестра).

Страхователю, представившему в территориальный орган Фонда документы или сведения не в полном объеме, территориальный орган Фонда в течение 5 рабочих дней со дня их получения направляет извещение о представлении недостающих сведений по форме, утверждаемой Фондом.

Недостающие документы или сведения представляются страхователем в территориальный орган Фонда в течение 5 рабочих дней со дня получения извещения.

Выплата пособия по временной нетрудоспособности, пособия по беременности и родам, единовременного пособия женщинам, вставшим на учет в медицинских учреждениях в ранние сроки беременности, единовременного пособия при рождении ребенка застрахованному лицу осуществляется территориальным органом Фонда путем перечисления пособия на банковский счет застрахованного лица, указанный в заявлении либо в реестре сведений, или через организацию федеральной почтовой связи, или иную организацию по заявлению застрахованного лица (его уполномоченного представителя) в течение 10 календарных дней со дня получения заявления и документов или сведений, которые необходимы для назначения и выплаты соответствующего вида пособия.

Первоначальная выплата ежемесячного пособия по уходу за ребенком осуществляется в порядке и сроки, которые указаны выше. Последующая выплата ежемесячного пособия по уходу за ребенком застрахованному лицу осуществляется территориальным органом Фонда с 1 по 15 число месяца, следующего за месяцем, за который выплачивается такое пособие.

Страхователи, у которых среднесписочная численность физических лиц, в пользу которых производятся выплаты и иные вознаграждения, за предшествующий расчетный период превышает 25 человек, а также вновь созданные (в том числе при реорганизации) организации, у которых численность указанных физических лиц превышает данный предел, представляют в вышеназванные сроки в территориальный орган Фонда по месту регистрации сведения, необходимые для назначения и выплаты соответствующего вида пособия (далее – реестр сведений), в электронной форме по форматам, установленным Фондом.

Страхователи, у которых среднесписочная численность физических лиц, в пользу которых производятся выплаты и иные вознаграждения, за предшествующий расчетный период составляет 25 человек и менее, а также вновь созданные (в том числе при реорганизации) организации с указанной численностью физических лиц вправе представлять в территориальный орган Фонда сведения, необходимые для назначения и выплаты соответствующего вида пособия, в порядке, установленном Постановлением – т. е. в электронной форме. Таким образом, страхователи с численностью 25 человек и меньше вправе предоставлять в территориальный орган Фонда сведения на бумажных носителях.

В случае прекращения страхователем деятельности, в том числе при невозможности установления его фактического местонахождения, на день обращения застрахованного лица в целях получения пособия застрахованное лицо (его уполномоченный представитель) вправе самостоятельно представить в территориальный орган Фонда по месту регистрации его работодателя в качестве страхователя заявление и документы, необходимые для назначения и выплаты соответствующего вида пособия.

 

 

Программа по подготовке отчетности в ПФ РФ по персонифицированному учету и страховым взносам с 2010г. (ПД СПУ 2010) г Смоленск

Версия 6.6.9 от 14.09.2021. Размер ~65Mb.

Описание и вложение

  • Бесплатная (Freeware).

Характеристики программы

  • Программа ориентирована для использования на любых локальных компьютерах под управлением ОС Windows 2000/XP/Vista/7/8/10.
  • Печать всех документов на любых принтерах (русифицированных и не русифицированных, на сетевых и локальных).
  • Простой переход на более поздние версии путем повторной инсталляции поверх устаревшей версии программы.
  • Возможность работы с несколькими предприятиями в одной базе данных.
  • Возможность организации как локальной однопользовательской базы данных, не требующей установки СУБД (по умолчанию), так и сетевой многопользовательской базы данных, размещенной на удаленном сервере (СУБД FireBird).
  • Не требует от пользователя знаний кодов персонифицированного учета, формата выходных файлов, правил заполнения индивидуальных сведений и анкетных данных

Функциональные возможности

  • Программный комплекс ПД СПУ предназначен для заполнения, вывода на печать и перевода в электронную форму документов:

– СЗВ-СТАЖ. Сведения о страховом стаже застрахованных лиц;
– СЗВ-КОРР. Данные о корректировке сведений, учтенных на индивидуальном лицевом счете застрахованного лица;
– СЗВ-ИСХ.  Сведения о заработке (вознаграждении),  доходе, сумме выплат и иных вознаграждений, начисленных и уплаченных страховых взносах, о периодах трудовой и иной деятельности, засчитываемых в страховой стаж застрахованного лица;
– ОДВ-1.  Сведения по страхователю, передаваемые в ПФР для ведения индивидуального (персонифицированного) учета
– СЗВ-М. Сведения о застрахованных лицах;
– РСВ-1. Расчет по начисленным и уплаченным страховым взносам на обязательное пенсионное страхование в Пенсионный фонд Российской Федерации и на обязательное медицинское страхование в Федеральный фонд обязательного медицинского страхования плательщиками страховых взносов, производящими выплаты и иные вознаграждения физическим лицам;
– РСВ-2. Расчет по начисленным и уплаченным страховым взносам на обязательное пенсионное страхование в Пенсионный фонд Российской Федерации и страховым взносам на обязательное медицинское страхование в Федеральный фонд обязательного медицинского страхования главами крестьянских (фермерских) хозяйств;
– РВ-3. Расчет по начисленным и уплаченным взносам в Пенсионный фонд Российской Федерации, применяемый при осуществлении контроля за уплатой взносов для работодателей, уплачивающих взносы на дополнительное социальное обеспечение;
– СЗВ-6-1. Сведения о начисленных и уплаченных страховых взносах на обязательное пенсионное страхование и страховом стаже застрахованного лица;
– СЗВ-6-2. Реестр сведений о начисленных и уплаченных страховых взносах на обязательное пенсионное страхование и страховом стаже застрахованных лиц
– СЗВ-6-3. Сведения о сумме выплат и иных вознаграждений, начисляемых плательщиком страховых взносов – страхователями в пользу физического лица.
– СЗВ-6-4. Сведения о сумме выплат и иных вознаграждений, о начисленных и уплаченных страховых взносах на обязательное пенсионное страхование и страховом стаже застрахованного лица.
– СЗВ-1. Индивидуальные сведения о трудовом стаже, заработке (вознаграждении), доходе и начисленных страховых взносах застрахованного лица.
– СЗВ-3. Индивидуальные сведения о трудовом стаже, заработке (вознаграждении), доходе и начисленных страховых взносах застрахованного лица.
– СЗВ-4-1. Индивидуальные сведения о страховом стаже и начисленных страховых взносах на обязательное пенсионное страхование застрахованного лица.
– СЗВ-4-2. Индивидуальные сведения о страховом стаже и начисленных страховых взносах на обязательное пенсионное страхование застрахованного лица (списочная форма).
– АДВ-10. Сводная ведомость форм документов СЗВ-3, передаваемых работодателем в ПФР.
– АДВ-11. Ведомость уплаты страховых взносов на обязательное пенсионное страхование.
– АДВ-6-1. Опись документов, передаваемых страхователем в ПФР.
– АДВ-6-2. Опись сведений, передаваемых страхователем в ПФР.
– АДВ-1. Анкета застрахованного лица.
– АДВ-2. Заявление об обмене страхового свидетельства.
– АДВ-3. Заявление о выдаче дубликата страхового свидетельства.
– ДСВ-1. Заявление о добровольном вступлении в правоотношения по обязательному пенсионному страхованию в целях уплаты дополнительных страховых взносов на накопительную часть трудовой пенсии.
– ДСВ-3. Реестр застрахованных лиц, за которых перечислены дополнительные страховые взносы на накопительную часть трудовой пенсии и уплачены взносы работодателя.
– СЗВ-К. Сведения о трудовом стаже застрахованного лица за период до регистрации в системе обязательного пенсионного страхования.
– СЗВ-СП. Сведения об иных периодах деятельности застрахованного лица, засчитываемых в страховой стаж.
– СПВ-1. Сведения о начисленных, уплаченных страховых взносах на обязательное пенсионное страхование и страховом стаже застрахованного лица для установления трудовой пенсии.
– СПВ-2. Сведения о страховом стаже застрахованного лица для установления трудовой пенсии.Имеет простой, интуитивно понятный пользовательский интерфейс и позволяет в удобном для пользователя режиме ввести все необходимые данные, произвести их обработку и сформировать выходные документы как в электронном, так и в печатном виде.
– СЗВ-ТД. Сведения о трудовой деятельности зарегистрированного лица

 

  • Помогает пользователю произвести расчет страховых взносов по тарифу и по дополнительному тарифу, расчет по начисленным и уплаченным страховым взносам и другие расчеты.
  • Осуществляет предварительную проверку введенных данных в соответствии с Правилами проверки сведений представляемых в ПФР.
  • Позволяет осуществлять проверку электронных форм документов напрямую из программы с помощью внешних программ проверки отчетности CheckXML и CheckPFR с выводом протокола проверки на экран.
  • Имеет возможность создавать как пакет форм за отчетный период, так и выгружать в XML-файлы формата ПФР отдельные пачки.
  • Позволяет загружать в базу данных программы пачки сведений из XML-файлов по формату ПФР.
  • Имеет возможность импортировать пользовательские данные из файлов формата dBase III (dbf-файлов) содержащих анкетные данные, сведения о заработке, взносах и стаже в поддерживаемые программой виды документов или во встроенный справочник застрахованных лиц.
  • Позволяет осуществлять преобразование (конвертацию) следующих видов форм: форм СЗВ-6-1, СЗВ-6-2 и СЗВ-6-3 в форму СЗВ-6-4, форму СЗВ-6-4 в Раздел 6 формы РСВ-1 с 2014 года, форму РСВ-1 с 2014 года в форму РСВ-1 с 2015 года, а также имеет отдельный пакетный режим преобразования (конвертации) файлов с пачками сведений по форме РСВ-1 с 2014 года в форму РСВ-1 с 2015 года без загрузки сведений в базу данных программы.
  • Позволяет импортировать справочник адресов из унифицированного классификатора адресов России (КЛАДР) и использовать его для подстановки при вводе адресов в сведениях о застрахованных лицах.
  • Позволяет осуществлять печать пустых бланков форм ПФР.
  • В программе ведется журнал по загруженным, выгруженным и проверенным пачкам.
  • Программа снабжена справкой по работе с программой.

 

Версия 6.6.9 от 14.09.2021

Параметры запуска
=================

* Добавлен параметр запуска
/backup

Происходит “тихий” запуск резервного копирования базы данных.
После создания архива программа закрывается, не входя в основной режим работы.
Имя файла резервной копии имеет вид:
[Common][BackupDir]\RSV_ГГГГММДД_ЧЧММ.FBK

Запуск с параметром /backup можно использовать в планировщике заданий (Windows или ином).

Раздел Настройки
================

* Добавлен параметр (строка)
Папка для резервного копирования

Создание резервных копий будет производиться в эту папку.
Параметр хранится в файле настроек PD_SPU_2010.ini
[Common][BackupDir]

* Добавлен параметр (галочка)
Резервное копирование базы данных при завершении программы

Имя файла резервной копии имеет вид:
[Common][BackupDir]RSV_ГГГГММДД_ЧЧММ.FBK

Параметр хранится в файле настроек PD_SPU_2010.ini
[Options][AutoBackupDatabaseOnExit]
По умолчанию установлен.

* Добавлен параметр (галочка)
Сжатие резервных копий базы данных (zip)

После создания резервной копии базы данных (пользователем или автоматическим формированием при закрытии программы)
будет произведено её перемещение в zip-архив.

Имя zip-архива имеет вид:
[Common][BackupDir]RSV_ГГГГММДД_ЧЧММ.ZIP

Параметр хранитсяв файле настроек PD_SPU_2010.ini
[Options][ZipBackupFile]
По умолчанию установлен.

 

 

Для установки программы скачайте приложенный архив на свой компьютер. Распакуйте скачанный архив и запустите файл установки PD_SPU_2010_xxx.EXE (где XXX – номер версии)

Перечень файлов, содержащихся в архиве:


1. PD_SPU_2010_xxx.EXE (инсталятор программы)

2. History.txt (вся история изменений)

3. Руководство пользователя.pdf (Руководство пользователя)

4. Руководство администратора.pdf (Руководство администратора)

5. PD_SPU_2010.chm (Руководство пользователя в chm формате)

Скачать архив с программой pd_spu_2010_669.zip

Расчёт по форме РСВ-1. Как правильно составить расчёт

Заполните бланк без ошибок за 1 минуту!

Бесплатная программа для автоматического заполнения всех документов для торговли и склада.

  • Счета на оплату
  • Счета-фактуры
  • Накладные
  • Путевые листы
  • Доверенности
  • Акты выполненных работ
  • Акты приемки, инвентаризации
  • Коммерческие предложения
  • Кассовые ордеры

Класс365 – быстрое и удобное заполнение всех первичных документов

Расчёт по начисленным и уплаченным страховым взносам на обязательное пенсионное страхование в ПФР, страховым взносам на обязательное медицинское страхование в Федеральный фонд обязательного медицинского страхования  плательщиками страховых взносов, производящими выплаты и иные вознаграждения физическим лицам.

Как упростить работу с документами и вести учет легко и непринужденно

«Класс365» — онлайн программа для всех:

  • 50 актуальных бланков документов
  • Торговый и Складской учёт
  • CRM-система для работы с клиентами
  • Банк и Касса
  • Интеграция с интернет-магазинами
  • Встроенная почта и отправка SMS

Бесплатно для одного пользователя

Как правильно заполнить форму РСВ-1

Расчетным периодом по взносам на обязательное пенсионное и медицинское страхование является календарный год. Он включает в себя четыре отчетных периода: I квартал, полугодие, девять месяцев и год (ст. 10 Федерального закона от 24 июля 2009 г. № 212-ФЗ). По итогам каждого отчетного периода организации должны составить и сдать расчет по взносам. С 2014 года действует новая форма расчета (утверждена постановлением Правления ПФР от 16 января 2014 г. № 2п.) Этим же постановлением утвержден официальный порядок заполнения расчета.

Скачать Порядок заполнения РСВ-1 >>
(Приложение № 2 к Постановлению Правления ПФР от 16 января 2014 г.)

Разделы, из которых состоит РСВ-1 ПФР

Форма РСВ-1 ПФР включает в себя титульный лист и шесть разделов:

  • Раздел 1 «Расчет по начисленным и уплаченным страховым взносам»;
  • Раздел 2 «Расчет страховых взносов по тарифу и дополнительному тарифу»;
  • Раздел 3 «Расчет соответствия условий на право применения пониженного тарифа для уплаты страховых взносов»;
  • Раздел 4 «Сумма доначисленных страховых взносов с начала расчетного периода»;
  • Раздел 5 «Сведения, необходимые для применения положений пункта 1 части 3 статьи 9 Федерального закона от 24 июля 2009 г. № 212-ФЗ…»;
  • Раздел 6 «Сведения о сумме выплат и иных вознаграждений и страховом стаже застрахованного лица».

Титульный лист, а также разделы 1 и 2 оформляются независимо от наличия расчетной базы и обязанности по уплате страховых взносов. Это относится и к тем организациям, которые в течение квартала не начисляли выплаты и взносы.

Раздел 3 заполняется, если компания применяет пониженные тарифы страховых взносов.

Раздел 4 заполняется, если в текущем отчетном периоде были доначисления взносов за предыдущие отчетные (расчетные) периоды.

Раздел 5 заполняется теми компаниями, которые производят выплаты и иные вознаграждения в пользу обучающихся в образовательных учреждениях среднего профессионального, высшего профессионального образования по очной форме обучения за деятельность в студенческом отряде (включенном в федеральный или региональный реестр молодежных и детских объединений, пользующихся государственной поддержкой).

Как автоматизировать работу с документами и не заполнять бланки вручную

Автоматическое заполнение бланков документов. Сэкономьте свое время. Избавьтесь от ошибок.

Подключитесь к КЛАСС365 и пользуйтесь полным спектром возможностей:

  • Автоматически заполнять актуальные типовые формы документов
  • Печатать документы с изображением подписи и печати
  • Создавать фирменные бланки с вашим логотипом и реквизитами
  • Составлять лучшие коммерческие предложения (в том числе по собственным шаблонам)
  • Выгружать документы в форматах Excel, PDF, CSV
  • Рассылать документы по email прямо из системы

С КЛАСС365 вы сможете не только автоматически готовить документы. КЛАСС365 позволяет управлять целой компанией в одной системе, с любого устройства, подключенного к интернету. Легко организовать эффективную работу с клиентами, партнерами и персоналом, вести торговый, складской и финансовый учет. КЛАСС365 автоматизирует всё предприятие.

“Россия – страна возможностей” проведет мероприятия в регионах СКФО в 2022 году – Общество

ЖЕЛЕЗНОВОДСК, 20 октября. /ТАСС/. АНО “Россия – страна возможностей” (РСВ) планирует в 2022 году провести ряд мероприятий в регионах Северного Кавказа, сообщил в среду заместитель генерального директора РСВ Антон Сериков.

“Я уверен, что 2022 год будет активным с точки зрения проведения и очных, и заочных мероприятий [в СКФО]. Потому что сама молодежь тянется к этим мероприятиям. И приятно приезжать в тот регион, где молодежь активная, ждет и готова принять любую инициативу”, – сказал Сериков журналистам на полуфинале конкурса “Мастера гостеприимства. Студенты”, который 20-21 октября проходит в Железноводске.

По его словам, на данный момент Северный Кавказ, в первую очередь Ставропольский край, в этом году стал одной из самых активных площадок. “Десанты наших разных проектов последнее время очень часто приезжают на самые разные территории, чтобы организовать мероприятия”, – добавил заместитель гендиректора РСВ.

По его словам. СКФО – это один из самых “молодых” округов. “Каждый раз, начиная от конкурса “Лидеры России”, студенческих олимпиад, мы видим, какое количество людей регистрируется там и хочет принять в них участие. То есть количество молодежи, помноженное на их активность, дает огромный срез наших участников в самых разных проектах. Мы видим уникальных победителей и участников конкурса “Лидеры России”, учителей для конкурса “Учителя будущего” и “Флагманы образования”, IT-специалистов, которые выигрывают конкурс “Цифровой прорыв” и другие хакатоны, которые мы организуем, и, конечно, “Мастера гостеприимства”, – добавил Сериков.

О конкурсе

Всероссийский профессиональный конкурс “Мастера гостеприимства” стартовал 13 ноября 2019 года. Его цель – раскрытие потенциала профессионалов, формирование новых традиций, повышение стандартов сервиса и престижа профессий в сферах туризма и гостеприимства. Во втором сезоне создано новое направление конкурса – “Мастера гостеприимства. Студенты”, реализуемое совместно с Федеральным агентством по делам молодежи. Студенческий конкурс призван выявлять лучшие инициативы, раскрывать потенциал молодежи в сфере туризма и гостеприимства в России, а также стимулировать студентов к развитию внутреннего и въездного туризма страны.

Автономная некоммерческая организация (АНО) “Россия – страна возможностей” была создана по инициативе президента РФ Владимира Путина. Ключевые цели организации – создание условий для повышения социальной мобильности, обеспечения личностной и профессиональной самореализации граждан, а также создание эффективных социальных лифтов в России. АНО “Россия – страна возможностей” развивает одноименную платформу, объединяющую 26 проектов.

RSV | Данные

Дом FAQs Составление отчетов Ресурсы

Данные RSV по регионам службы здравоохранения, сезон 2021-2022 гг. (формат PDF)
19.10.21, 12.10.21, 10.05.21, 28.09.21, 21.09.21, 09 / 14/21, 09.07.21, 09.01.21

Данные RSV по регионам службы здравоохранения, сезон 2020-2021 гг. (Формат PDF)
26.08.21, 17.08.21, 21.08.21, 03.08.21, 28.07.21, 21.07.21, 14.07.21, 21.07.21, 06 / 29/21, 22.06.21, 15.06.21, 06.08.21,
01.06.21, 25.05.21, 18.05.21, 11.05.21, 05 / 21.04, 27.04.21, г. 20.04.21, 13.04.21, 21.04.21, 30.03.21, 23.03.21, 16.03.21, 09.03.21, 03.03.21, 23.02.21, 16.02.21, 09.02.21, 02.02.21, 26.01.21, 20.01.21, 12.01.21, 01.05.21, 29.12.20, 22.12.20, 15.12.20, 08.12.20, 01.12.20, 24.11.20, 17.11.20, 10.11.20, 04.11.20, 29.10.20, 21.10.20, 14.10.20, 06.10.20, 29.09.20, 23.09.20

Данные RSV по регионам службы здравоохранения, сезон 2019-2020 (формат PDF)
26.05.20, г. 20.05.20, 12.05.20, 05.05.20, 29.04.20, 21.04.20, 15.04.20, 07.04.20, 31.03.20, 24.03.20, 17.03.20, 10.03.20, 03.03.20, 25.02.20, 18.02.20, 11.02.20, 04.02.20, 28.01.20, 21.01.20, 14.01.20, 01.07.20, 01.03.20, 17.12.19, 10.12.19, 03.12.19, 26.11.19, 19.11.19, 05.11.19, 29.10.19, г. 22.10.19, г. 15.10.19, г. 08.10.19, г. 01.10.19, 24.09.19, г. 17.09.19, г. 10.09.19

Данные RSV по регионам службы здравоохранения, сезон 2018-2019 гг. (Формат PDF)
28.05.19, г. 21.05.19, г. 14.05.19, г. 07.05.19, г. 30.04.19, 23.04.19, 16.04.19, 09.04.19, 02.04.19, 26.03.19, 19.03.19, 12.03.19,
05.03.19, г. 26.02.19, 19.02.19, г. 12.02.19, 05.02.19, 29.01.19, 22.01.19, 15.01.19, 10.01.19, 18.12.18, 14.12.18, 12.04.18,
27.11.18, 20.11.18, 13.11.18, 06.11.18, 30.10.18 г., 23.10.18 г. 16.10.18, 09.10.18, 02.10.18 г. 25.09.18, г. 20.09.18

Данные RSV по регионам службы здравоохранения, сезон 2017-2018 гг. (Формат PDF)
22.05.18, г. 15.05.18 г. 08.05.18, г. 01.05.18 г., 24.04.18 г., 17.04.18, 10.04.18, 03.04.18, 27.03.18, 20.03.18, 13.03.18, 06.03.18, 27.02.18, г. 20.02.18, 13.02.18 г., 06.02.18, 30.01.18, 23.01.18, 17.01.18, 01.09.18, 01.03.18, 27.12.17, 19.12.17, 12.12.17, 05.12.17, 28.11.17, 21.11.17, 14.11.17, 07.11.17, 31.10.17, 24.10.17, 17.10.17, 10.10.17, 03.10.17, 26.09.17, г. 19.09.17, г.
13.09.17, г. 06.09.17

Данные RSV по регионам службы здравоохранения, 2016-2017 гг. Сезон (формат PDF)

05.07.17, 27.06.17, 20.06.17, 13.06.17, 07.06.17, 31.05.17, г. 23.05.17, г. 16.05.17, 09.05.17, г. 02.05.17, г. 25.04.17, 18.04.17, 11.04.17, 04.04.17, 28.03.17, 21.03.17, 14.03.17, 07.03.17, 28.02.17, 21.02.17, 14.02.17, 07.02.17, 31.01.17, 24.01.17, 17.01.17, 01.10.17, 01.03.17, 27.12.16, 20.12.16, 13.12.16, 06.12.16, 29.11.16, 22.11.16, 15.11.16, 08.11.16, г. 01.11.16, 25.10.16 г. 18.10.16 г. 11.10.16 г. 04.10.16 г. 27.09.16, г. 20.09.16, г. 13.09.16

Данные RSV по регионам здравоохранения, 2015-2016 (формат PDF)
24.05.16, г. 17.05.16, г. 10.05.16, г. 03.05.16 г. 26.04.16, 19.04.16, 12.04.16, 05.04.16, 29.03.16, г. 22.03.16, 15.03.16 г. 08.03.16,
01.03.16, 23.02.16 г. 16.02.16 г. 09.02.16, 02.02.16, 26.01.16, 19.01.16, 13.01.16 г. 05.01.16, 29.12.15, 22.12.15, 15.12.15,
08.12.15, 01.12.15, 24.11.15, 17.11.15, 10.11.15, 03.11.15, 27.10.15 г. 20.10.15 г. 13.10.15 г. 06.10.15, 22.09.15 г. 15.09.15 г. 08.09.15

Данные RSV по регионам здравоохранения, 2014-2015 гг.
(формат PDF)
26.05.15, г. 19.05.15 г. 12.05.15 г. 05.05.15 г. 28.04.15 г. 21.04.15 г. 14.04.15 г. 07.04.15 г. 31.03.15 г. 24.03.15 г. 17.03.15, 10.03.15, 03.03.15, 24.02.15 г. 17.02.15, 10.02.15, 20.01.15, 13.01.15 г. 30.12.14, 16.12.14, 09.12.14, 02.12.14, 25.11.14, 18.11.14, г. 12.01.14, г. 04.11.14 г. 29.10.14, г. 22.10.14 г. 15.10.14 г. 07.10.14, г. 30.09.14, г. 24.09.14

Данные RSV по сезонам: Сезоны 2011-2013 (формат PDF)

RSV Сводные данные за сезон: 2016-2017, 2015-2016, 2014-2015, 2013-2014, 2012-2013 (формат PDF)


УЧАСТНИКИ RSV Эпиднадзор
RSV в Техасе основан на данных, собранных в рамках Национальной системы надзора за респираторными и кишечными вирусами ( NREVSS) при поддержке Центров по контролю и профилактике заболеваний (CDC).Это лабораторная система дозорного эпиднадзора, участие в которой является добровольным. Провайдеры Sentinel еженедельно сообщают как о количестве выполненных тестов на РСВ, так и о количестве обнаруженных положительных тестов. Тестирование обычно обнаружением антигена; однако также проводится выделение вируса (т.е. культивирование) и тестирование полимеразной цепной реакции (ПЦР). В сезоне 2016-2017 гг. Больницы и лаборатории общественного здравоохранения, представляющие данные по RSV, расположены в следующих округах Техаса:

  • Округ Белл
  • Округ Бексар
  • Округ Боуи
  • Округ Бразория
  • Округ Бразос
  • Округ Браун
  • Округ Касс
  • Округ Даллас
  • Округ Эль-Пасо
  • Округ Гейнс
  • Округ Галвестон
  • Округ Грегг
  • Округ Харрис
  • Округ Джефферсон
  • Округ Кимбл
  • Округ Лаймстоун
  • Округ Лаббок
  • Округ Накогдочес
  • Округ Нуэсес
  • Округ Поттер
  • Округ Смит
  • Округ Таррант
  • Округ Трэвис
  • Округ Валь-Верде
  • Округ Уокер
  • Округ Уэбб

Обратите внимание: данные RSV передаются добровольно дозорными лабораториями Техаса на еженедельной основе.Данные за текущую и предыдущие недели могут изменяться по мере поступления отчетов. “Хотя данные NREVSS дают хорошее приближение сезонного RSV характеристики «на национальном уровне», они не всегда могут отражать активность RSV на уровне штата или округа [1] ». Это особенно верно, когда количество лабораторий, представляющих отчеты, невелико, когда лаборатории проводят небольшое количество тестов RSV, или при отчетности лаборатории не распространяется по всем географическим регионам штата.Кроме того, «процент положительных обнаружений отражает практику заказа тестов и может не отражать напрямую бремя болезни [1]».

1. Центры по контролю и профилактике заболеваний. Респираторно-синцитиальный вирус – США, июль 2007 г. – июнь 2011 г. Еженедельный отчет о заболеваемости и смертности (MMWR). Сентябрь 2011 г .; 60 (35): 1203-1206.

Мощные широко нейтрализующие человеческие антитела против РСВ нацелены на консервативный сайт IV слитого гликопротеина

Человеческие субъекты

Информированное согласие добровольцев было получено в соответствии с Хельсинкской декларацией 1975 г. дочерняя компания Merck & Co., Inc., Кенилворт, Нью-Джерси, США). РВМС от выбранных доноров очищали из крови, собранной в пробирки с ЭДТА, центрифугированием в градиенте плотности в гистопаке над пробирками Accuspin TM (Sigma Aldrich, Кат. №: A2055) в соответствии с инструкциями производителя. Затем PBMC замораживали в 90% инактивированном нагреванием FBS с добавлением 10% диметилсульфоксида и хранили в жидком азоте до оттаивания для использования в экспериментах.

Выделение специфических B-клеток памяти после Fusion RSV

Способ выделения post-F-специфических B-клеток памяти и антител из них осуществляли аналогично методу, описанному в Cox et al. 41 . В частности, криоконсервированные PBMC размораживали в день сортировки, промывали стерильным PBS с добавлением 1% FBS и инкубировали в течение 25 минут с биотинилированным белком Post-F. Клетки промывали и окрашивали анти-CD3 BV421 (каталожный № 562426, BD Biosciences), анти-CD19 FITC (кат. № 555412, BD Biosciences), анти-IgG APC (кат. № 550931, BD Biosciences) и стрептавидином. ПЭ (каталожный № 349023, BD Biosciences) в течение 25 минут в объеме, рекомендованном производителем, на тест и промывали. Клетки, связывающие белок CD3- / CD19 + / IgG + / Post-F, сортировали с помощью BD FACS Jazz в одноклеточном режиме в 96-луночный планшет.Отсортированные клетки культивировали в RPMI с FBS в присутствии облученных CD40L-экспрессирующих фидерных клеток в концентрации 4,0 × 10 4 клеток / лунку (клеточная линия собственного производства) и IL-21 (Sino Biologicals cat. # 10584-HNAE-20) при 50 нг / мл для преобразования в секретирующие антитела клетки. Супернатанты переносили в новые планшеты и анализировали на связывание с белком F RSV и активность по нейтрализации вирусов. Осадки клеток в планшетах лизировали в 50 мкл на лунку буфера RLT (Qiagen) с добавлением 1% 2-меркаптоэтанола (2-ME) (Sigma Aldrich Chemicals) и быстро замораживали на сухом льду.Затем планшеты переносили в морозильную камеру при -80 ° C для хранения.

Экспрессия и очистка слитых белков RSV

Плазмиды, кодирующие оптимизированные по кодонам белки RSV F до слияния (DS-Cav1) и пост-слияния (F∆FP) млекопитающих, использовали для трансфекции клеток Expi 293 F (номер по каталогу ThermoFisher. A14527), и белки очищали из культуральных супернатантов 18,17 . В частности, супернатанты клеточных культур собирали на 3-й (F∆FP) или 7-й (DS-Cav1) день после плазмидной трансфекции, и белки F RSV очищали с использованием хроматографии на Ni-сефарозе (GE healthcare).Супернатанты замороженных культур клеток размораживали и повторно осветляли при 14260 × г в течение 30 минут при 5 ° C. РН супернатанта доводили путем добавления 1 М HEPES, рН 7,5 (обычно 50 мл / л) и добавляли 2 М имидазола (рН 7,5) до конечной концентрации 10 мМ. После добавления супернатант перемешивали и фильтровали через 1 л вакуумный фильтр Nalgene Rapid-Flow (0,45 микрон / PES). Белки F RSV очищали с помощью хроматографии на Ni-сефарозе (GE healthcare). F∆FP дополнительно очищали с помощью хроматографии на Strep-Tactin (Strep-Tactin Superflow Plus, Qiagen).Метки удаляли с DS-Cav1 и F∆FP путем расщепления тромбином в течение ночи. Для удаления примесей IMAC и нерасщепленного белка F DS-Cav1 подвергали второй стадии хроматографии на Ni-сефарозе. И DS-Cav1, и F∆FP очищали гель-фильтрационной хроматографией (Superdex 200, GE Healthcare) и хранили в буфере 50 мМ HEPES pH 7,5, 300 мМ NaCl. Очистку всех колонок проводили в системе очистки GE Healthcare AKTA Purifier System при комнатной температуре. Все буферы перед использованием фильтровали под вакуумом (0.22 мкм, CA).

Иммуноферментный анализ слитого белка RSV

Планшеты Nunc C96 Maxisorp Nunc-Immuno покрывали 50 мкл на лунку белка RSV Pre-F или Post-F в концентрации 1 мкг / мл при 4 ° C в течение ночи. Планшеты промывали PBS / 0,05% Tween 20, а затем блокировали PBS / 0,05% Tween 20/3% обезжиренного молока при комнатной температуре в течение 1 часа. Затем добавляли 50 мкл на лунку 3-кратно серийно титрованных mAb и инкубировали при комнатной температуре в течение 90 мин. Планшеты промывали и добавляли по 50 мкл на лунку конъюгированного с HRP козьего античеловеческого IgG (1: 2000) (Southern Biotech cat.№ 2040–05). После 60 мин инкубации при комнатной температуре планшеты промывали и добавляли по 100 мкл на лунку раствора SuperBlu-Turbo TMB (ViroLabs). Планшеты инкубировали при комнатной температуре в течение 5 мин и реакцию останавливали добавлением 100 мкл на лунку стоп-раствора для TMB ELISA (ViroLabs). Затем планшеты считывали на счетчике VICTOR Multilabel Counter (Wallac / Perkin Elmer) при 450 нм.

Извлечение последовательностей антител из культуры В-клеток памяти

Хранимые в замороженном виде отсортированные и культивируемые 96-луночные планшеты, содержащие лизированные В-клетки в буфере RLT, размораживали при комнатной температуре.Экстракцию тотальной РНК для иммуноанализа проводили с помощью набора Qiagen RNeasy Micro Kit (Qiagen) в соответствии с инструкциями производителя.

Экстрагированную тотальную РНК использовали в качестве матрицы в ОТ-ПЦР для амплификации генов антител человека с помощью набора для одностадийной ОТ-ПЦР Qiagen (Qiagen). Реакцию RT проводили при 50 ° C в течение 30 мин для синтеза первой цепи кДНК. Реакция ПЦР была запущена при 95 ° C в течение 15 минут, чтобы инициировать горячий старт для ДНК-полимеразы HotStarTaq, представленной в смеси RT-PCR, с последующими 40 циклами 94 ° C в течение 30 секунд, 55 ° C в течение 30 секунд, 72 ° C в течение 1 мин, затем 10 мин элонгации при 72 ° C и выдержке 4 ° C для кратковременного хранения.Продукты ОТ-ПЦР использовали непосредственно (без очистки) в качестве матриц во вложенной ПЦР для амплификации вариабельных областей антитела с помощью ДНК-полимеразы pfx50 (Invitrogen). Условия ПЦР для амплификации вариабельных областей тяжелой, каппа, легкой цепи остались прежними: 94 ° C в течение 2 минут, затем 10 циклов 94 ° C в течение 30 секунд, 50 ° C в течение 30 секунд, 68 ° C в течение 1 минуты, затем 30 циклов: 94 ° C в течение 30 секунд, 60 ° C в течение 30 секунд, 68 ° C в течение 1 минуты, затем 7-минутное удлинение при 68 ° C и 4 ° C для кратковременного хранения. Затем вложенные продукты ПЦР использовали в качестве матриц в перекрывающейся ПЦР для соединения легкой и тяжелой цепей антитела.Условия перекрывающейся ПЦР для соединения легкой цепи (каппа или лямбда) и тяжелой цепи с линкером: 94 ° C в течение 2 минут, затем 10 циклов 94 ° C в течение 30 секунд, 60 ° C в течение 30 секунд, 68 ° C в течение 2 минут. с последующими 30 циклами 94 ° C в течение 30 секунд, 65 ° C в течение 30 секунд, 68 ° C в течение 2 минут, затем 7-минутное удлинение при 68 ° C и выдержка 4 ° C для кратковременного хранения. Перекрывающийся продукт ПЦР субклонировали с помощью набора для клонирования HD для инфузии (Clontech) в соответствии с инструкциями производителя и секвенировали. Праймеры для клонирования В-клеток человека представлены в дополнительной таблице 1.

Выравнивание вариабельной области RB1 с зародышевой линией человека

Аминокислотная последовательность антитела RB1 была выровнена с последовательностью зародышевой линии человеческого антитела с использованием IgBlast (https://ftp.ncbi.nih.gov/blast/executables/igblast / release / LATEST) и определяющую комплементарность область антитела (CDR) тяжелой цепи (обозначенной как RB1_VH) и легкой цепи (обозначенной как RB1_VK) определяли в соответствии с системой нумерации Kabat.

Продукция рекомбинантных антител

Были синтезированы естественные парные последовательности вариабельной области тяжелой и легкой цепей, которые затем были субклонированы в вектор pTT5 для CHO-3E7 (Национальный исследовательский совет Канады, кат.# 11992) выражение ячейки. Клетки CHO-3E7 выращивали в суспензии в бессывороточной среде для экспрессии FreeStyle CHO Expression Medium (Life Technologies). Рекомбинантные плазмиды, кодирующие тяжелые и легкие цепи каждого антитела, временно котрансфицировали в клетки CHO-3E7 и культивировали в течение 6 дней. Супернатант клеточной культуры собирали, центрифугировали и фильтровали. Отфильтрованный супернатант загружали в колонку Protein A CIP (GenScript). После промывки и элюирования элюат заменяли буферным раствором на 1 × фосфатно-солевой буферный раствор (PBS) при pH 7.2.

Оценка аффинности связывания с помощью SPR

Связывание Fab RB1 с белками F RSV до и после слияния характеризовали с помощью поверхностного плазмонного резонанса с использованием системы Biacore T200 (GE Healthcare, Piscataway, NJ). Для белка перед слиянием приблизительно 5000 RU антитела D25 загружали в каналы 1 и 2 сенсорного чипа Series S Protein A (GE Healthcare), и DS-Cav1 пропускали через канал 2 в условиях, которые позволяли захват 50 RU рекомбинантного белка. Двухкратные серийные разведения моновалентного Fab RB1 пропускали через оба канала со скоростью 50 мкл / мин в течение 30 с, после чего следовали период диссоциации 300 с для 0.Концентрации RB1 Fab от 31 нМ до 10 нМ или 1800 с для концентрации 20 нМ RB1 Fab. Для анализа связывания с F после слияния 5000 RU антитела Synagis загружали на чип белка A для захвата 50 RU рекомбинантного белка F после слияния. RB1 Fab пропускали в двукратных серийных разведениях от концентрации 200 нМ до 3,12 нМ с последующим 40-секундным периодом диссоциации. Поверхности белка А регенерировали для каждого цикла после двух 20-секундных инъекций 10 мМ глицинового буфера, pH 1,5, при скорости потока 30 мкл / мин. Сенсограммы были скорректированы на фон сенсора (канал 2–1) и сделаны двойные эталоны после вычитания аналита с использованием холостого (0 нМ) введения RB1 Fab.Полученные наборы данных были подогнаны к модели связывания Ленгмюра 1: 1 с использованием оценочного программного обеспечения Biacore T200 (версия 2.0) для определения константы скорости ассоциации ( k a ) и диссоциации ( k d ), и константа равновесной диссоциации K D .

Анализ микронейтрализации RSV

RB1 разбавляли в EMEM, содержащем 2% FBS (инактивированный нагреванием), начиная с 10 мкг / мл, с последующими 3-кратными серийными разведениями. Разведения RB1 смешивали со 100 БОЕ RSV A (Long, ATCC cat.№: VR-26) или штамм RSV B (Вашингтон, АТСС, кат. №: VR-1580) и инкубировали в течение 1 часа при 37 ° C. После 1 ч инкубации в планшеты добавляли клетки HEp-2 (ATCC, кат. № CCL-23) в количестве 1,5 × 10 4 клеток / лунку. Чашки инкубировали при 37 ° C в течение 3 дней. После этого клетки промывали и фиксировали ледяным 80% ацетоном в PBS в течение 15 мин. Мышиные mAb против RSV-F и против RSV-N (созданные в компании, клон 143-F3-1B8 и 34C9, соответственно) в концентрации 1,25 мкг / мл каждое добавляли в планшеты и инкубировали в течение 1 ч при комнатной температуре.Затем планшеты промывали и добавляли биотинилированный лошадиный антимышиный IgG (Vector Laboratories Cat. # BA-2000) в разведении 1: 200. Через час планшеты промывали и проявляли с помощью двухканальной системы обнаружения в ближней инфракрасной области (NID) (Licor Odyssey Sa). В 96-луночные планшеты добавляли инфракрасный краситель-стрептавидин для обнаружения специфического сигнала RSV и два окрашивания клеток для нормализации анализа. Планшеты инкубировали 1 ч в темноте, промывали и сушили в темноте 20 мин. Затем планшеты считывали с помощью автоматизированной системы визуализации Licor Aerius® с использованием 700-канального лазера для нормализации клеток и 800-канального лазера для обнаружения специфического сигнала RSV.Рассчитывали соотношения 800/700 и определяли титры нейтрализации сыворотки с помощью четырехпараметрической аппроксимации кривой в GraphPad Prism.

Анализ микронейтрализации уменьшения бляшек HMPV

Моноклональные тестируемые антитела разводили в среде для анализа OTI-MEM (Gibco 31985-070) в серийных 3-кратных разведениях. Разведения антител смешивали со 100 БОЕ вируса HMPV HMPV A (штамм HMPV 16 типа A1: IA10-2003, ZepoMetrix, Ref # 0810161CF) или HMPV B (штамм hMPV-8: Peru6-2003 B2, ZepoMetrix Ref # 0810159CF) и инкубировали. в течение 1 ч при 37 ° C.После 1 ч инкубации в 96-луночные планшеты добавляли 50 мкл клеток LLC-MK2 (ATCC # CCL-7.1) в концентрации 1,2 × 10 6 клеток / мл. Планшеты инкубировали при 37 ° C в течение 1 ч, затем центрифугировали при 250 × g в течение 10 минут, покрывали 1% -ным покрытием из метилцеллюлозы и инкубировали при 37 ° C в течение 3 дней. На третий день накладку удаляли с лунок, используя 12-канальную вакуумную машину для промывки планшетов, и оставшуюся смесь клеток / вируса фиксировали 10% формалином. Планшеты инкубировали при температуре окружающей среды в течение 30 мин и фиксатор удаляли.Планшеты промывали шесть раз блокированным PBS-0,05% Tween-20 (каталог Odessey № 927-4000) в течение 30 мин. Блокирующий буфер удаляли, и планшеты инкубировали с mab против HMPV (EMD Millipore Cat. # MAB80124) 1: 1000 в блокирующем буфере в течение 1 часа. Планшеты промывали шесть раз PBS-0,05% Tween-20, и антитело детектировали с использованием вторичного антитела, конъюгированного с IgG Alexa 488 (Invitrogen # A11017) 1: 500. Планшеты инкубировали в течение 1 ч при температуре окружающей среды и считывали с помощью планшет-ридера EnSight (Perkin Elmer).

Анализы последовательностей RSV

Полные последовательности гликопротеинов RSV F из 3600 заявок были получены из GenBank для анализа (https://www.ncbi.nlm.nih.gov/genbank/; по состоянию на апрель 2019 г.). Из них 3058 содержали полный внеклеточный домен и не содержали неоднозначных аминокислот в антигенном сайте IV. Запись в Genbank AHA61614 была исключена из анализа из-за атипично большой степени расхождения последовательностей с другими последовательностями RSV A и RSV B согласно нашему собственному анализу и, как сообщалось в Souza, et al. 42 . Последовательности выравнивали с использованием модифицированной программы Seq2Logo 43 и определяли аминокислотную частоту в каждом положении. Последовательности гликопротеина F RSV из дополнительной панели из 47 клинических изолятов были секвенированы.

Анализ дендрограммы гликопротеина F RSV

Внеклеточный домен гликопротеина F RSV включает аминокислоты с 27 по 529, согласно аннотации Uniprot (Консорциум UniProt). Используя алгоритм биоинформатики clustalW http: // www.clustal.org/ 44 , всего 391 последовательность внеклеточного домена были сгруппированы. 391 последовательность включает 345 уникальных последовательностей GenBank и последовательности из 47 клинических изолятов. Кластерные данные были визуализированы с помощью FigTree версии 1.4.3 (http://tree.bio.ed.ac/software/figtree/).

Сбор и получение клинических изолятов RSV

Для анализа нейтрализации in vitro была отобрана панель из 47 клинических изолятов RSV, содержащих аминокислотные изменения в слитом гликопротеине F.Клинические изоляты RSV размножали в клетках HEp-2 (ATCC, кат. № CCL-23); Для анализа готовили запасы вирусов с низким числом пассажей. Титры исходных вирусных исходных клинических изолятов с малым пассажем определяли с использованием иммуноокрашивания бляшек. Эти исходные вирусы впоследствии использовали в анализе нейтрализации инфекции in vitro.

Модель профилактического заражения хлопковых крыс in vivo

Пять самок хлопковых крыс в возрасте 4-7 недель ( Sigmodon hispidus ) на каждую дозовую группу (SAGE Animals, Boyertown, PA или Envigo, Somerset, NJ) были пассивно иммунизированы. , внутримышечно с RB1 (рис.4a – d), или с RB1, RB1-LALA (рис. 4e), паливизумабом или паливизумаб-LALA (рис. 4f). Для каждого эксперимента разведения антител начинались с 2,5 мг / кг и были серийно разбавлены в 3 раза до 0,03. мг / килограмм (в частности, было протестировано всего пять дозовых групп антител (5 животных / группа): 2,5, 0,83, 0,27, 0,09 и 0,03 мг / кг). Для расчета дозы использовали единичный вес, полученный при усреднении шести случайных животных. Животным вводили антитело в левую четырехглавую мышцу в объеме 100 мкл в день 1 под изофлурановой анестезией.Также была включена контрольная группа, состоящая из наивных животных. Образцы сыворотки были собраны для определения концентрации антител в сыворотке с последующей интраназальной инокуляцией животных 10 5 БОЕ вируса RSV A2 (ATCC VR-1540) или RSV B 18537 (Вашингтон, ATCC VR-1580) в объеме 0,1 мл на 2-й день. примерно через 24 ± 2 часа после переноса RB1 под анестезией. Через четыре дня после инокуляции животных умерщвляли путем ингаляции СО2, и доли левого легкого, а также носовые раковины удаляли и гомогенизировали в 10 объемах сбалансированного солевого раствора Хэнкса (Lonza), содержащего фосфатный буфер сахарозы (SPG), на влажном льду.Образцы осветляли центрифугированием при 300 × g в течение 10 минут, разделяли на аликвоты, мгновенно замораживали и немедленно хранили замороженными при -70 ° C до размораживания для титрования вирусов. Исследования на животных были одобрены Merck Sharp & Dohme Corp., дочерней компанией Merck & Co., Inc., Кенилворт, штат Нью-Джерси, США, Институциональным комитетом по уходу и использованию животных, и проводились в соответствии с руководящими принципами по уходу за животными.

Анализ бляшек RSV для исследований заражения хлопковых крыс

Гомогенаты легких и носа хлопковых крыс тестировали с помощью анализа бляшек для определения бляшкообразующих единиц на грамм (БОЕ / г) ткани.Гомогенаты разводили в бессывороточной среде Williams E и добавляли в двух экземплярах в 24-луночные планшеты, содержащие конфлюэнтные клетки HEp-2 (ATCC кат. № CCL-23). После 1-часового заражения при 37 ° C испытуемые образцы удаляли, и клетки покрывали 1 мл 0,75% метилцеллюлозы в Williams E с добавлением 1,6% фетальной бычьей сыворотки. После инкубации при 37 ° C в течение 5 дней клетки фиксировали / окрашивали раствором кристаллического фиолетового, содержащим 5% глутарового альдегида. Бляшки подсчитывали визуально с помощью препаровального микроскопа и использовали для расчета БОЕ / г.

mAb к RSV pK ELISA

Белок pre-F или post-F RSV наносили на 96-луночные планшеты в концентрации 2 мкг / мл в 1 × (PBS) в течение ночи. Планшеты промывали и блокировали 3% молоком в PBS, содержащем 0,05% Tween 20, в течение 1 часа. Образцы сыворотки разводили 1:50 в блокирующем буфере с последующими 4-кратными серийными разведениями. Сто (100) мкл каждого разбавленного образца сыворотки и стандарта добавляли в 96-луночные планшеты и инкубировали в течение двух часов. Для каждого анализа стандартным контролем было соответствующее антитело. Например, для исследований на хлопковых крысах, которым вводили дозу RB1, в качестве стандарта использовали серийно разведенный RB1 с определенной количественной концентрацией.После инкубации планшеты промывали и добавляли 50 мкл конъюгированного с пероксидазой хрена (HRP) античеловеческого IgG (Invitrogen # 62-7120), разведенного 1: 2000 в блокирующем буфере, и инкубировали в течение 1 часа. Планшеты промывали и проявляли SuperBlu Turbo TMB и стоп-раствором. Планшеты считывали на Molecular Devices VersaMax при OD 450 нм. Программное обеспечение Softmax использовалось для построения 4-параметрической кривой для получения концентрации антитела в каждом образце.

Расчет ЕС

50

для хлопковой крысы Значения ЕС 50 для каждого штамма RSV рассчитывали следующим образом: Концентрацию антител в сыворотке измеряли для каждого животного в первые дни после введения с использованием описанного иммуноанализа на концентрацию лекарственного средства антитела в сыворотке.Инфекционные титры RSV также определяли на 5 день с использованием анализа бляшек RSV. Значения EC 50 и 95% доверительные интервалы для mAb в ткани оценивали с помощью ингибирующего сигмоидального анализа зависимости реакции от дозы с переменным наклоном (GraphPad Prism ® версия 6).

Данные наносили на график следующим образом: ось x представляет собой концентрацию трансформированного антитела log10 в сыворотке крови в день 1 в мкг / мл, где: 100 мкг / мл = 2 log (мкг / мл). Ось y представляет собой log10-трансформированный вирусный титр, где: 1 × 10 5 БОЕ / г ткани = 5 log (БОЕ / г ткани) на 5-й день.Подбор 4-параметрической кривой соответствовал следующим ограничениям: нижняя часть кривой была ограничена, чтобы равняться пределу обнаружения бляшек, 2 log БОЕ / г ткани для легкого и 1,6 log БОЕ / г ткани для носа и верхняя часть кривой ограничена значением среднего титра необработанных контролей.

Статистический анализ исследований антител к LALA хлопковых крыс

Статистический анализ выполняли с использованием двустороннего непарного теста t с использованием статистического программного обеспечения GraphPad (GraphPad Prism ® версия 6).Для выполнения анализа данные от каждого животного использовались в качестве точки данных, когда каждое тестировалось один раз (5 животных на группу в группе с пятью дозами).

Получение и секвенирование мутантов ускользания RSV (MARMS)

Создание мутантов ускользания RSV in vitro осуществляли аналогично тому, как описано в X. Zhao, et al и L. Tome, et al. 45,46 . В частности, 3,5–4,5 × 10 5 клеток HEp-2 (ATCC cat. # CCL-23) высевали на лунку в 6-луночные планшеты. Культуральную среду удаляли через 24 часа, и клетки инфицировали штаммом RSV A2 при MOI 10 (~ 7.5 × 10 6 БОЕ / лунку) или штамм B Washington (1,7 × 10 6 БОЕ / лунку) при MOI 4 в присутствии субоптимальных концентраций антител в 3 мл среды EMEM / 2% FBS. Клетки и супернатанты собирали с использованием скребка для клеток при значительном CPE. Сборы переносили в пробирки на 15 мл и быстро замораживали на бане сухой лед / этанол, а затем размораживали на водяной бане при 37 ° C. Затем пробирки центрифугировали при 300 × 90 166 g при комнатной температуре в течение 10 мин. 1 мл супернатанта использовали для заражения новых клеток HEp-2 в следующем раунде 2 мл свежей среды, содержащей такие же или повышенные концентрации mAb.Затем вирус собирали из лунок, содержащих более высокие концентрации mAb и показывающих CPE, и использовали в следующем раунде заражения. Процедуру повторяли до тех пор, пока концентрация mAb не достигала 10 мкг / мл, всего за 9 раундов отбора.

Мутанты Escape представляют собой отдельные бляшки, выбранные под микроскопом и используемые для инфицирования клеток HEp-2 в 24-луночных планшетах. Культуры HEp-2, инфицированные единичными бляшками, применяли при последующей экстракции РНК с помощью Qiagen RNeasy Mini Kit (Qiagen, каталожный номер 74104) в соответствии с инструкциями производителя.Затем РНК применяли в ОТ-ПЦР-амплификации RSV F. В реакции ОТ-ПЦР использовали набор QIAGEN One-Step RT-PCR (Qiagen, каталожный номер 210212), условия ПЦР следующие: 50 ° C 30 мин для реакции RT, затем инкубация при 95 ° C 15 мин, затем 40 циклов 94 ° C 30 с, 57 ° C 30 с, 72 ° C 2 мин, затем 10 мин при 72 ° C для элонгации и 4 ° C для временного хранения. Последовательность прямого праймера – 5’ATGGAGTTGCTAATCCTCAAAG, а последовательность обратного праймера – 5 ’GTTACTAAATGCAAT ATTATTTATACCACTCAG.Продукты ПЦР секвенировали и анализировали с помощью Sequencher (Gene Codes Corp.) и Vector NTI (Invitrogen).

ELISA для связывания RB1 с мутантными белками по последовательности MARMS.

Плазмидные конструкции

MARM, содержащие желаемые точечные мутации, были созданы на фоне DS-Cav1 компанией Genewiz (South Plainfield, NJ 07080). Плазмидную ДНК использовали для временной трансфекции клеток Expi293F (ThermoFisher cat. # A14527). Экспифектамин (ThermoFisher, номер по каталогу A14525) использовали в качестве реагента для трансфекции для трансфекций.Клетки трансфицировали до конечной плотности клеток 2,6 × 10 6 жизнеспособных клеток / мл. На каждые 30 мл трансфекционной клеточной культуры использовали 30 мкг плазмидной ДНК и 80 мкл экспифектамина. Трансфекция была завершена в соответствии с рекомендациями производителя для реагента Expifectamine. Все культуры клеток инкубировали в инкубаторе при 37 ° C с влажной атмосферой, 8% CO 2 на орбитальном шейкере, вращающемся со скоростью 125 оборотов в минуту с шагом 1 дюйм. На 3-й и 7-й день после трансфекции 10 мл каждой трансфекции собирали центрифугированием при 2800 × g при комнатной температуре.Осветленные супернатанты подвергали денатурированию, восстановлению с помощью SDS-PAGE и вестерн-блоттинга, чтобы подтвердить желаемую экспрессию белка. Затем планшеты Nunc C96 Maxisorp Nunc-Immuno покрывали белком RSV Pre-F или вариантами белка F, которые включали изменения последовательностей, обнаруженные в MARMS. Планшеты инкубировали при 4 ° C в течение ночи, промывали PBS / 0,05% Tween 20 и затем блокировали PBS / 0,05% Tween 20/3% обезжиренного молока при комнатной температуре в течение 1 часа. Затем добавляли 50 мкл на лунку 3-кратно серийно титрованного RB1 и инкубировали при комнатной температуре в течение 90 мин.Планшеты промывали и добавляли 50 мкл на лунку конъюгированного с HRP козьего античеловеческого IgG (1: 2000) (Southern Biotech Cat. № 2040-05). После 60 мин инкубации при комнатной температуре планшеты промывали и добавляли по 100 мкл на лунку раствора SuperBlu-Turbo TMB (ViroLabs). Планшеты инкубировали при комнатной температуре в течение 5 мин и реакцию останавливали добавлением 100 мкл на лунку стоп-раствора для TMB ELISA (ViroLabs). Затем планшеты считывали на счетчике VICTOR Multilabel Counter (Wallac / Perkin Elmer) при 450 нм.

Картирование эпитопов с помощью мутагенеза дробовика

Картирование эпитопов сайта связывания RB1 на гликопротеине F RSV было выполнено Integral Molecular, Inc. (Филадельфия, США). В методе использовали гликопротеиновую последовательность RSV-F, полученную из RSV-A2, номер ссылки FJ614814 Национального центра биотехнологической информации (NCBI). Мутагенез со сканированием аланином экспрессионной конструкции для гликопротеина F RSV нацелился на 368 открытых остатков, идентифицированных из кристаллических структур как до, так и после слияния конформаций RSV F 17,18 .Каждый представляющий интерес остаток индивидуально мутировали в аланин, при этом нативные остатки аланина мутировали в серин. Полученные в результате 368 мутантных конструкций экспрессии гликопротеина RSV F подтверждали последовательность и помещали в 384-луночный планшет с одной мутацией на лунку. Мутации внутри клонов были идентифицированы как критические для эпитопа, связывающего антитело, если они не поддерживали реактивность по отношению к тестируемому антителу (например, RB1), но поддерживали реактивность контрольного антитела (например, D25 или паливизумаб). Эта стратегия встречного скрининга, включающая второе антитело против RSV, способствует исключению мутантов гликопротеина F RSV, которые были неправильно свернуты или имели дефект экспрессии.Алгоритмы и интерпретация мутагенеза дробовика были выполнены в Intergrol Molecular, как описано в Davidson et al. 28

Кристаллизация гликопротеина слияния RB1 и RSV

Для образования комплекса RB1 / DS-Cav1 mAb RB1 расщепляли на моновалентный Fab с использованием набора для подготовки Fab (Pierce) в соответствии с инструкциями производителя. Расщепленный Fab RB1 инкубировали с очищенным DS-Cav1 при 4 ° C в течение ночи при соотношении антигена к Fab от 1 до 1,3 (вес / вес). Комплекс антиген / Fab очищали с помощью эксклюзионной хроматографии на колонке Superdex 200 (GE Healthcare) в 50 мМ HEPES, pH 7.5 и 300 мМ NaCl. Комплекс RB1-DSCav1 концентрировали до 10 мг / мл в буфере, содержащем 20 мМ HEPES pH 7,5 и 100 мМ NaCl. Кристаллы получали в условиях, содержащих 100 мМ Трис pH 8,5, 12% PEG 8000 и 200 мМ сульфата аммония. Хотя кристаллы появлялись легко, исходные кристаллы не подвергались дифракции с достаточным разрешением. Комбинация кристаллов затравки, дегидратации и просеивания дала кристаллы, дифрагированные более 3,5 ангстрем. Кристалл обезвоживали в течение четырех дней в буфере, содержащем 100 мМ Трис, pH 8.5 и 35% PEG 1500. Кристалл остекловывали для сбора данных непосредственно из буфера для дегидратации путем быстрого погружения в жидкий азот.

Сбор данных и решение для построения структуры

Данные были собраны в канадском источнике света, Beamline 8ID-1, с использованием монокристалла. Сбор проводился при 100 К с использованием падающего рентгеновского излучения при 0,97490 Å. После обработки данных с помощью Autoproc 47 фазы были определены путем молекулярного замещения с помощью программы Phaser 48 , реализованной в пакете Phenix 49 .Решение было получено с использованием структуры DS-CAV1 (PDB: 4MMT 16 ) и Fab (код PDB: 1HZH 50 ) с удаленными областями, определяющими комплементарность, в качестве моделей поиска. Были обнаружены две копии DS-Cav1 и одна копия Fab. Поиск по двум и более фабрикам решений не дал. После уточнения с использованием Buster 51 другие пять копий Fab были созданы с помощью операций симметрии, основанных на ожидаемом связывании одного Fab с каждым мономером в пределах двух тримеров.Структура была уточнена с помощью итерационных циклов перестройки в Coot 52 и уточнения с помощью Buster или Phenix. Конечная структура имеет 94,9% остатков в благоприятной области графика Рамачандрана, 4,9% в разрешенной области и 0,2% в области выбросов. Структура комплекса между RB1 и RSV-F (DS-cav1) депонирована в wwPDB (код: 6OUS). Pymol (PyMOL Molecular Graphics System, Version 2.2 Schrödinger, LLC.) Использовался для создания молекулярных фигур и выполнения структурного выравнивания для моделирования взаимодействий RB1 с F.

Доступность материалов

Антитело RB1 не является общедоступным. В настоящее время образцы и дополнительное описание не будут предоставляться по запросу. Читатели могут связаться с соответствующим автором, запрашивающим реагенты или материалы, через Соглашение о передаче материалов (MTA), которое будет рассматриваться в индивидуальном порядке.

Сводка отчетов

Дополнительная информация о дизайне исследования доступна в Сводке отчетов по исследованиям природы, связанной с этой статьей.

Проникновение респираторно-синцитиального вируса и способы его блокирования

  • 1.

    Блаунт Р. Младший, Моррис Дж. А. и Сэвидж Р. Е. Извлечение цитопатогенного агента у шимпанзе с ринитом. Proc. Soc. Exp. Биол. Med. 92 , 544–549 (1956).

    PubMed Статья Google ученый

  • 2.

    Чанок Р., Ройзман Б. и Майерс Р. Выздоровление младенцев с респираторным заболеванием от вируса, связанного с возбудителем ринита шимпанзе (CCA).I. Изоляция, свойства и характеристика. Am. J. Hyg. 66 , 281–290 (1957). В этом исследовании сообщается о первом выделении RSV у младенцев .

    CAS PubMed Google ученый

  • 3.

    Чанок Р. и Финберг Л. Выздоровление младенцев с респираторным заболеванием от вируса, связанного с возбудителем ринита шимпанзе (CCA). II. Эпидемиологические аспекты инфекции у детей грудного и раннего возраста. Am.J. Hyg. 66 , 291–300 (1957).

    CAS PubMed Google ученый

  • 4.

    Глезен, В. П., Табер, Л. Х., Франк, А. Л., Касел, Дж. А. Риск первичного инфицирования и повторного заражения респираторно-синцитиальным вирусом. Am. J. Dis. Детский 140 , 543–546 (1986).

    CAS PubMed Google ученый

  • 5.

    Shi, T. et al.Глобальные, региональные и национальные оценки бремени острых респираторных инфекций нижних дыхательных путей, вызванных респираторно-синцитиальным вирусом, у детей младшего возраста в 2015 г .: систематический обзор и исследование на основе моделирования. Ланцет 390 , 946–958 (2017).

    PubMed PubMed Central Статья Google ученый

  • 6.

    Falsey, A. R., Hennessey, P. A., Formica, M. A., Cox, C. & Walsh, E. E. Инфекция респираторно-синцитиальным вирусом у пожилых людей и взрослых из групп высокого риска. N. Engl. J. Med. 352 , 1749–1759 (2005).

    CAS PubMed Статья Google ученый

  • 7.

    van den Hoogen, B.G. et al. Недавно обнаруженный пневмовирус человека, выделенный у детей раннего возраста с заболеванием дыхательных путей. Нат. Med. 7 , 719–724 (2001). В этой работе описывается первая изоляция метапневмовируса человека от детей .

    PubMed Статья CAS Google ученый

  • 8.

    Панда С., Мохакуд Н. К., Пена Л. и Кумар С. Метапневмовирус человека: обзор важного респираторного патогена. Внутр. J. Infect. Дис. 25 , 45–52 (2014).

    PubMed Статья Google ученый

  • 9.

    Холл, К. Б. Респираторно-синцитиальный вирус: его передача в больничных условиях. Yale J. Biol. Med. 55 , 219–223 (1982).

    CAS PubMed PubMed Central Google ученый

  • 10.

    Хаас, Л. Е., Тийсен, С. Ф., ван Элден, Л. и Хемстра, К. А. Метапневмовирус человека у взрослых. Вирусы 5 , 87–110 (2013).

    PubMed PubMed Central Статья Google ученый

  • 11.

    Грейсон, С. А., Гриффитс, П. С., Перес, М. К. и Пьедимонте, Г. Обнаружение респираторно-синцитиального вируса, передающегося по воздуху, в педиатрической клинике неотложной помощи. Pediatr. Пульмонол. 52 , 684–688 (2017).

    PubMed Статья Google ученый

  • 12.

    Коллинз П. Л. и Грэм Б. С. Вирусные факторы и факторы хозяина в патогенезе респираторно-синцитиального вируса человека. J. Virol. 82 , 2040–2055 (2008).

    CAS PubMed Статья Google ученый

  • 13.

    Пиблз Р. С. Младший и Грэм Б. С. Патогенез респираторно-синцитиальной вирусной инфекции на мышиной модели. Proc. Являюсь. Thorac Soc. 2 , 110–115 (2005).

    CAS PubMed PubMed Central Статья Google ученый

  • 14.

    Kim, H. W. et al. Респираторно-синцитиальное вирусное заболевание у младенцев, несмотря на предварительное введение антигенной инактивированной вакцины. Am. J. Epidemiol. 89 , 422–434 (1969).

    CAS PubMed Статья Google ученый

  • 15.

    Капикян А. З., Митчелл Р. Х., Чанок Р. М., Шведофф Р. А. и Стюарт С. Е. Эпидемиологическое исследование измененной клинической реактивности к респираторно-синцитиальной (RS) вирусной инфекции у детей, ранее вакцинированных вакциной на основе инактивированного RS-вируса. Am. J. Epidemiol. 89 , 405–421 (1969).

    CAS PubMed Статья Google ученый

  • 16.

    Fulginiti, V.A. et al. Иммунизация респираторным вирусом.I. Полевые испытания двух вакцин против инактивированных респираторных вирусов; водная трехвалентная вакцина против вируса парагриппа и вакцина против респираторно-синцитиального вируса, осажденного алюминием. Am. J. Epidemiol. 89 , 435–448 (1969).

    CAS PubMed Статья Google ученый

  • 17.

    Чин, Дж., Магоффин, Р. Л., Ширер, Л. А., Шибл, Дж. Х. и Леннетт, Э. Х. Полевая оценка вакцины против респираторно-синцитиального вируса и вакцины от трехвалентного вируса парагриппа в педиатрической популяции. Am. J. Epidemiol. 89 , 449–463 (1969).

    CAS PubMed Статья Google ученый

  • 18.

    Принс, Г. А., Кертис, С. Дж., Йим, К. С. и Портер, Д. Д. Усиленное вакциной респираторно-синцитиальное вирусное заболевание у хлопковых крыс после иммунизации партией 100 или недавно приготовленной контрольной вакциной. J. Gen. Virol. 82 , 2881–2888 (2001).

    CAS PubMed Статья Google ученый

  • 19.

    Polack, F. P. et al. Роль иммунных комплексов в усилении респираторно-синцитиального вирусного заболевания. J. Exp. Med. 196 , 859–865 (2002). Эта рукопись демонстрирует, что болезнь, усиленная вакциной, опосредуется иммунными комплексами .

    CAS PubMed PubMed Central Статья Google ученый

  • 20.

    Хомайра, Н., Роулинсон, В., Снеллинг, Т. Л. и Джаффе, А. Эффективность паливизумаба в предотвращении госпитализации РСВ у детей из группы высокого риска: реальная перспектива. Внутр. J. Pediatr. 2014 , 571609 (2014).

    PubMed PubMed Central Статья Google ученый

  • 21.

    Фирнс Р. и Коллинз П. Л. Роль антитерминационного белка транскрипции M2-1 респираторно-синцитиального вируса в последовательной транскрипции. J. Virol. 73 , 5852–5864 (1999).

    CAS PubMed PubMed Central Google ученый

  • 22.

    Коллинз П. Л., Хилл М. Г., Кристина Дж. И Гросфельд H. Фактор удлинения транскрипции респираторно-синцитиального вируса, несегментированного РНК-вируса с отрицательной цепью. Proc. Natl Acad. Sci. USA 93 , 81–85 (1996).

    CAS PubMed Статья Google ученый

  • 23.

    Bermingham, A. & Collins, P. L. Белок M2-2 респираторно-синцитиального вируса человека является регуляторным фактором, участвующим в балансе между репликацией РНК и транскрипцией. Proc. Natl Acad. Sci. США 96 , 11259–11264 (1999).

    CAS PubMed Статья Google ученый

  • 24.

    Bitko, V. et al. Неструктурные белки респираторно-синцитиального вируса подавляют преждевременный апоптоз с помощью NF-κB-зависимого, интерферон-независимого механизма и способствуют росту вируса. J. Virol. 81 , 1786–1795 (2007).

    CAS PubMed Статья Google ученый

  • 25.

    Спанн, К. М., Тран, К. и Коллинз, П. Л. Влияние неструктурных белков NS1 и NS2 респираторно-синцитиального вируса человека на фактор регуляции интерферона 3, NF-κB и провоспалительные цитокины. J. Virol. 79 , 5353–5362 (2005).

    CAS PubMed PubMed Central Статья Google ученый

  • 26.

    Gan, S. W. et al. Небольшой гидрофобный белок респираторно-синцитиального вируса человека образует пентамерные ионные каналы. J. Biol. Chem. 287 , 24671–24689 (2012).

    CAS PubMed PubMed Central Статья Google ученый

  • 27.

    Fuentes, S., Tran, K. C., Luthra, P., Teng, M. N. & He, B. Функция малого гидрофобного белка респираторно-синцитиального вируса. J. Virol. 81 , 8361–8366 (2007).

    CAS PubMed PubMed Central Статья Google ученый

  • 28.

    Baviskar, P. S., Hotard, A. L., Moore, M. L. & Oomens, A. G. Слитый белок респираторно-синцитиального вируса нацеливается на периметр телец включения и способствует образованию филаментов за счет цитоплазматического хвостового механизма. J. Virol. 87 , 10730–10741 (2013).

    CAS PubMed PubMed Central Статья Google ученый

  • 29.

    Shaikh, F. Y. et al. Важный остаток фенилаланина в цитоплазматическом хвосте слитого белка респираторно-синцитиального вируса опосредует сборку внутренних вирусных белков в вирусные филаменты и частицы. mBio 3 , e00270-11 (2012).

    CAS PubMed PubMed Central Статья Google ученый

  • 30.

    Oomens, A. G., Bevis, K. P. & Wertz, G. W. Цитоплазматический хвост белка F респираторно-синцитиального вируса человека играет решающую роль в клеточной локализации белка F и продукции инфекционного потомства. J. Virol. 80 , 10465–10477 (2006).

    CAS PubMed PubMed Central Статья Google ученый

  • 31.

    Марти А., Минджер Дж., Миллс Дж., Шилдс Б. и Гильдиал Р. Ассоциация матричного белка респираторно-синцитиального вируса с мембраной клетки-хозяина инфицированных клеток. Arch. Virol. 149 , 199–210 (2004).

    CAS PubMed Статья Google ученый

  • 32.

    Kiss, G. et al. Структурный анализ респираторно-синцитиального вируса показывает положение M2-1 между матриксным белком и рибонуклеопротеидным комплексом. J. Virol. 88 , 7602–7617 (2014).

    PubMed PubMed Central Статья CAS Google ученый

  • 33.

    Tawar, R.G. et al. Кристаллическая структура нуклеокапсидоподобного комплекса нуклеопротеин-РНК респираторно-синцитиального вируса. Наука 326 , 1279–1283 (2009).

    CAS PubMed Статья Google ученый

  • 34.

    Rixon, H. W. et al. Небольшой гидрофобный (SH) белок накапливается в структурах липидного рафта комплекса Гольджи во время респираторно-синцитиальной вирусной инфекции. J. Gen. Virol. 85 , 1153–1165 (2004).

    CAS PubMed Статья Google ученый

  • 35.

    Букреев А., Уайтхед С.С., Мерфи, Б.Р. и Коллинз, П.Л. Рекомбинантный респираторно-синцитиальный вирус, из которого был удален весь ген SH, эффективно растет в культуре клеток и проявляет сайт-специфическое ослабление в дыхательных путях. мыши. J. Virol. 71 , 8973–8982 (1997).

    CAS PubMed PubMed Central Google ученый

  • 36.

    Левин, С., Клайбер-Франко, Р. и Парадизо, П. Р. Демонстрация того, что гликопротеин G является белком прикрепления респираторно-синцитиального вируса. J. Gen. Virol. 68 , 2521–2524 (1987).

    CAS PubMed Статья Google ученый

  • 37.

    Хендрикс Д. А., Барадаран К., Макинтош К. и Паттерсон Дж. Л. Появление растворимой формы G-белка респираторно-синцитиального вируса в жидкостях инфицированных клеток. J. Gen. Virol. 68 , 1705–1714 (1987).

    CAS PubMed Статья Google ученый

  • 38.

    Wertz, G. W. et al. Нуклеотидная последовательность гена G-белка респираторно-синцитиального вируса человека обнаруживает необычный тип вирусного мембранного белка. Proc. Natl Acad. Sci. США 82 , 4075–4079 (1985).

    CAS PubMed Статья Google ученый

  • 39.

    Коллинз П. Л. и Моттет Г. Олигомеризация и посттрансляционный процессинг гликопротеина G респираторно-синцитиального вируса человека: измененное О-гликозилирование в присутствии брефельдина А. J. Gen. Virol. 73 , 849–863 (1992).

    CAS PubMed Статья Google ученый

  • 40.

    Сатаке, М., Колиган, Дж. Э., Эланго, Н., Норрби, Э. и Венкатесан, С. Гликопротеин оболочки респираторно-синцитиального вируса (G) имеет новую структуру. Nucleic Acids Res. 13 , 7795–7812 (1985).

    CAS PubMed PubMed Central Статья Google ученый

  • 41.

    Garcia-Beato, R. et al. Влияние клетки-хозяина на гликозилирование и антигенность гликопротеина G респираторно-синцитиального вируса человека. Вирусология 221 , 301–309 (1996).

    CAS PubMed Статья Google ученый

  • 42.

    Kwilas, S. et al. Респираторно-синцитиальный вирус, выращенный в клетках Vero, содержит усеченный белок прикрепления, который изменяет его инфекционность и зависимость от гликозаминогликанов. J. Virol. 83 , 10710–10718 (2009).

    CAS PubMed PubMed Central Статья Google ученый

  • 43.

    Робертс, С. Р., Лихтенштейн, Д., Болл, Л. А. и Вертц, Г. В. Ассоциированные с мембраной и секретируемые формы гликопротеина G прикрепления респираторно-синцитиального вируса синтезируются из альтернативных инициирующих кодонов. J. Virol. 68 , 4538–4546 (1994).

    CAS PubMed PubMed Central Google ученый

  • 44.

    Хендрикс Д. А., Макинтош К. и Паттерсон Дж. Л. Дальнейшая характеристика растворимой формы гликопротеина G респираторно-синцитиального вируса. J. Virol. 62 , 2228–2233 (1988).

    CAS PubMed PubMed Central Google ученый

  • 45.

    Букреев А., Янг, Л. и Коллинз, П. Л. Секретируемый G-белок респираторно-синцитиального вируса человека противодействует опосредованному антителами ограничению репликации с участием макрофагов и комплемента. J. Virol. 86 , 10880–10884 (2012).

    CAS PubMed PubMed Central Статья Google ученый

  • 46.

    Букреев А. и др. Секретируемая форма гликопротеина G респираторно-синцитиального вируса помогает вирусу избежать опосредованного антителами ограничения репликации, действуя как ловушка для антигена и воздействуя на лейкоциты, несущие рецептор Fc. J. Virol. 82 , 12191–12204 (2008).

    CAS PubMed PubMed Central Статья Google ученый

  • 47.

    Горман, Дж. Дж., Фергюсон, Б. Л., Спилман, Д. и Миллс, Дж.Определение расположения дисульфидных связей в белке прикрепления (G) респираторно-синцитиального вируса человека с помощью масс-спектрометрии с времяпролетной лазерной десорбцией / ионизацией с использованием матрицы. Protein Sci. 6 , 1308–1315 (1997).

    CAS PubMed PubMed Central Статья Google ученый

  • 48.

    Langedijk, J. P., Schaaper, W. M., Meloen, R.H. & van Oirschot, J. T. Предложили трехмерную модель для белка присоединения G респираторно-синцитиального вируса. J. Gen. Virol. 77 , 1249–1257 (1996).

    CAS PubMed Статья Google ученый

  • 49.

    Doreleijers, J. F. et al. Структура раствора иммунодоминантной области белка G респираторно-синцитиального вируса крупного рогатого скота. Биохимия 35 , 14684–14688 (1996). Это исследование определяет первую трехмерную структуру цистиновой петли RSV G .

    CAS PubMed Статья Google ученый

  • 50.

    Sugawara, M. et al. Исследования взаимосвязи структура-антигенность центральной консервативной области белка G респираторно-синцитиального вируса человека. J. Pept. Res. 60 , 271–282 (2002).

    CAS PubMed Статья Google ученый

  • 51.

    Langedijk, JP, de Groot, BL, Berendsen, HJ & van Oirschot, JT. Структурная гомология центральной консервативной области белка прикрепления G респираторно-синцитиального вируса с четвертым субдоменом 55-кДа фактора некроза опухоли. рецептор. Вирусология 243 , 293–302 (1998).

    CAS PubMed Статья Google ученый

  • 52.

    Jones, H.G. et al. Структурная основа распознавания центральной консервативной области G RSV путем нейтрализации человеческих антител. PLOS Pathog. 14 , e1006935 (2018).

    PubMed PubMed Central Статья CAS Google ученый

  • 53.

    Федечкин, С.О., Джордж, Н.Л., Вольф, Дж. Т., Каувар, Л. М. и Дюбуа, Р. М. Структуры антигена G респираторно-синцитиального вируса, связанного с широко нейтрализующими антителами. Sci. Иммунол. 3 , eaar3534 (2018).

    PubMed PubMed Central Статья Google ученый

  • 54.

    Пангести, К. Н., Абд Эль Гани, М., Уолш, М. Г., Кессон, А. М. и Хилл-Коуторн, Г. А. Молекулярная эпидемиология респираторно-синцитиального вируса. Rev. Med. Virol. 28 , e1968 (2018).

    Артикул Google ученый

  • 55.

    Муфсон М. А., Орвелл К., Рафнар Б. и Норрби Е. Два различных подтипа респираторно-синцитиального вируса человека. J. Gen. Virol. 66 , 2111–2124 (1985).

    CAS PubMed Статья Google ученый

  • 56.

    Anderson, L.J. et al.Антигенная характеристика штаммов респираторно-синцитиального вируса с помощью моноклональных антител. J. Infect. Дис. 151 , 626–633 (1985).

    CAS PubMed Статья Google ученый

  • 57.

    Hall, C. B. et al. Распространенность респираторно-синцитиального вируса группы A и B в течение 15 лет: связанные эпидемиологические и клинические характеристики у детей, находящихся в стационаре и амбулаторно. J. Infect. Дис. 162 , 1283–1290 (1990).

    CAS PubMed Статья Google ученый

  • 58.

    Trento, A. et al. Основные изменения в G-белке изолятов респираторно-синцитиального вируса человека, вызванные дупликацией 60 нуклеотидов. J. Gen. Virol. 84 , 3115–3120 (2003).

    CAS PubMed Статья Google ученый

  • 59.

    Trento, A. et al. Естественная история респираторно-синцитиального вируса человека, выведенная из филогенетического анализа прикрепленного (G) гликопротеина с дупликацией 60 нуклеотидов. J. Virol. 80 , 975–984 (2006).

    CAS PubMed PubMed Central Статья Google ученый

  • 60.

    Trento, A. et al. Десять лет глобальной эволюции генотипа респираторно-синцитиального вируса человека BA с 60-нуклеотидной дупликацией в гене G-белка. J. Virol. 84 , 7500–7512 (2010).

    CAS PubMed PubMed Central Статья Google ученый

  • 61.

    Eshaghi, A. et al. Генетическая изменчивость штаммов респираторно-синцитиального вируса человека А, циркулирующих в Онтарио: новый генотип с дупликацией гена G. PLOS ONE 7 , e32807 (2012).

    CAS PubMed PubMed Central Статья Google ученый

  • 62.

    Duvvuri, V. R. et al. Генетическое разнообразие и эволюционное понимание генотипа респираторно-синцитиального вируса A ON1: глобальная и локальная динамика передачи. Sci. Отчет 5 , 14268 (2015).

    CAS PubMed PubMed Central Статья Google ученый

  • 63.

    Hirano, E. et al. Молекулярная эволюция гена гликопротеина (G) прикрепления респираторно-синцитиального вируса человека нового генотипа ON1 и предка NA1. Заражение. Genet. Evol. 28 , 183–191 (2014).

    CAS PubMed Статья Google ученый

  • 64.

    Хотард, А. Л., Лайхтер, Э., Брукс, К., Хартерт, Т. В. и Мур, М. Л. Функциональный анализ дупликации 60 нуклеотидов в гликопротеине прикрепления штамма Буэнос-Айреса респираторно-синцитиального вируса. J. Virol. 89 , 8258–8266 (2015).

    CAS PubMed PubMed Central Статья Google ученый

  • 65.

    Лейрат, К., Паесен, Г.С., Чарльстон, Дж., Реннер, М. и Граймс, Дж. М. Структурные открытия эктодомена гликопротеина метапневмовируса человека. J. Virol. 88 , 11611–11616 (2014).

    PubMed PubMed Central Статья CAS Google ученый

  • 66.

    Yin, H. S., Wen, X., Paterson, R. G., Lamb, R. A. & Jardetzky, T. S. Структура белка 5 F вируса парагриппа в его метастабильной префузионной конформации. Nature 439 , 38–44 (2006).

    CAS PubMed Статья Google ученый

  • 67.

    Yin, H. S., Paterson, R. G., Wen, X., Lamb, R. A. & Jardetzky, T. S. Структура нерасщепленного эктодомена слитого белка парамиксовируса (hPIV3). Proc. Natl Acad. Sci. США 102 , 9288–9293 (2005).

    CAS PubMed Статья Google ученый

  • 68.

    Collins, P. L., Huang, Y. T. & Wertz, G. W. Нуклеотидная последовательность гена, кодирующего слитый (F) гликопротеин респираторно-синцитиального вируса человека. Proc. Natl Acad. Sci. США 81 , 7683–7687 (1984).

    CAS PubMed Статья Google ученый

  • 69.

    Циммер, Г., Будз, Л. и Херрлер, Г. Протеолитическая активация слитого белка респираторно-синцитиального вируса. Расщепление по двум консенсусным последовательностям фурина. J. Biol. Chem. 276 , 31642–31650 (2001).

    CAS PubMed Статья Google ученый

  • 70.

    Gonzalez-Reyes, L. et al. Расщепление слитого белка респираторно-синцитиального вируса человека в двух разных сайтах необходимо для активации слияния мембран. Proc. Natl Acad. Sci. США 98 , 9859–9864 (2001).

    CAS PubMed Статья Google ученый

  • 71.

    Bolt, G., Pedersen, L.O. & Birkeslund, H.H. Для его поверхностной экспрессии требуется расщепление слитого белка респираторно-синцитиального вируса: роль фурина. Virus Res. 68 , 25–33 (2000).

    CAS PubMed Статья Google ученый

  • 72.

    Коллинз П. Л. и Моттет Г. Посттрансляционный процессинг и олигомеризация слитого гликопротеина респираторно-синцитиального вируса человека. J. Gen. Virol. 72 , 3095–3101 (1991).

    CAS PubMed Статья Google ученый

  • 73.

    Day, N. D. et al. Вклад остатков цистеина во внеклеточном домене белка F респираторно-синцитиального вируса человека в его функцию. Virol. J. 3 , 34 (2006).

    PubMed PubMed Central Статья CAS Google ученый

  • 74.

    Gilman, M. S. et al. Характеристика антитела, специфичного для префузии, которое распознает четвертичный, зависимый от расщепления эпитоп на гликопротеине слияния RSV. PLOS Pathog. 11 , e1005035 (2015).

    PubMed PubMed Central Статья CAS Google ученый

  • 75.

    Krarup, A. et al. Высокостабильная вакцина перед слиянием RSV F, полученная в результате структурного анализа механизма слияния. Нат.Commun. 6 , 8143 (2015).

    PubMed PubMed Central Статья Google ученый

  • 76.

    McLellan, J. S. et al. Структура тримерного гликопротеина слияния RSV, связанного с нейтрализующим антителом, специфичным для предварительного слияния. Наука 340 , 1113–1117 (2013). Эта работа обеспечивает первую трехмерную структуру конформации RSV F перед слиянием и определяет главный антигенный сайт, распознаваемый специфическими антителами до слияния.

    CAS PubMed PubMed Central Статья Google ученый

  • 77.

    Liljeroos, L., Krzyzaniak, M. A., Helenius, A. & Butcher, S. J. Архитектура респираторно-синцитиального вируса, выявленная с помощью электронной криотомографии. Proc. Natl Acad. Sci. США 110 , 11133–11138 (2013). Эта рукопись раскрывает организацию и морфологию вирионов RSV с помощью криоэлектронной томографии .

    CAS PubMed Статья Google ученый

  • 78.

    Килликелли, А. М., Канекиё, М. и Грэхэм, Б. С. Предварительное слияние F отсутствует на поверхности инактивированного формалином респираторно-синцитиального вируса. Sci. Отчет 6 , 34108 (2016).

    CAS PubMed PubMed Central Статья Google ученый

  • 79.

    Kim, Y.H. et al. Захват и визуализация промежуточного соединения прешпильчатого слияния парамиксовируса PIV5. Proc. Natl Acad. Sci. США 108 , 20992–20997 (2011).

    CAS PubMed Статья Google ученый

  • 80.

    Чжао, X., Сингх, М., Малашкевич, В. Н. и Ким, П. С. Структурная характеристика ядра слитого белка респираторно-синцитиального вируса человека. Proc. Natl Acad. Sci. США 97 , 14172–14177 (2000).

    CAS PubMed Статья Google ученый

  • 81.

    Маклеллан, Дж.С., Янг, Ю., Грэм, Б. С., Квонг, П. Д. Структура гликопротеина слияния респираторно-синцитиального вируса в постфузионной конформации показывает сохранение нейтрализующих эпитопов. J. Virol. 85 , 7788–7796 (2011).

    CAS PubMed PubMed Central Статья Google ученый

  • 82.

    Swanson, K. A. et al. Структурная основа иммунизации постфузионным гликопротеином F слияния респираторно-синцитиального вируса (RSV F) для получения высоких титров нейтрализующих антител. Proc. Natl Acad. Sci. США 108 , 9619–9624 (2011).

    CAS PubMed Статья Google ученый

  • 83.

    Джонсон, Дж. Э., Гонсалес, Р. А., Олсон, С. Дж., Райт, П. Ф. и Грэм, Б. С. Гистопатология фатальной нелеченой респираторно-синцитиальной вирусной инфекции человека. Мод. Патол. 20 , 108–119 (2007).

    CAS PubMed Статья Google ученый

  • 84.

    Xu, L. et al. Смертельный случай, связанный с инфекцией респираторно-синцитиального вируса у маленького ребенка. BMC Infect. Дис. 18 , 217 (2018).

    PubMed PubMed Central Статья Google ученый

  • 85.

    Pitkaranta, A., Virolainen, A., Jero, J., Arruda, E. & Hayden, FG Выявление риновирусов, респираторно-синцитиальных вирусов и коронавирусных инфекций при остром среднем отите с помощью полимеразной цепной реакции с обратной транскриптазой . Педиатрия 102 , 291–295 (1998).

    CAS PubMed Статья Google ученый

  • 86.

    Rohwedder, A. et al. Обнаружение РНК респираторно-синцитиального вируса в крови новорожденных методом полимеразной цепной реакции. J. Med. Virol. 54 , 320–327 (1998).

    CAS PubMed Статья Google ученый

  • 87.

    Эскрибано-Ромеро, Э., Rawling, J., Garcia-Barreno, B. & Melero, J. A. Растворимая форма белка прикрепления респираторно-синцитиального вируса человека отличается от мембраносвязанной формы своим олигомерным состоянием, но все же способна связываться с протеогликанами клеточной поверхности. J. Virol. 78 , 3524–3532 (2004).

    CAS PubMed PubMed Central Статья Google ученый

  • 88.

    Krusat, T. & Streckert, H.J. Гепарин-зависимое прикрепление респираторно-синцитиального вируса (RSV) к клеткам-хозяевам. Arch. Virol. 142 , 1247–1254 (1997).

    CAS PubMed Статья Google ученый

  • 89.

    Фельдман С. А., Хендри Р. М. и Билер Дж. А. Идентификация линейного гепарин-связывающего домена для гликопротеина присоединения респираторно-синцитиального вируса человека G. J. Virol. 73 , 6610–6617 (1999).

    CAS PubMed PubMed Central Google ученый

  • 90.

    Халлак, Л. К., Спиллманн, Д., Коллинз, П. Л. и Пиплс, М. Е. Требования сульфатирования гликозаминогликанов при респираторно-синцитиальной вирусной инфекции. J. Virol. 74 , 10508–10513 (2000).

    CAS PubMed PubMed Central Статья Google ученый

  • 91.

    Мартинес И. и Мелеро Дж. А. Связывание респираторно-синцитиального вируса человека с клетками: влияние протеогликанов сульфатированной клеточной поверхности. J. Gen. Virol. 81 , 2715–2722 (2000).

    CAS PubMed Статья Google ученый

  • 92.

    Халлак, Л. К., Коллинз, П. Л., Кнудсон, В. и Пиплз, М. Е. Гликозаминогликаны, содержащие идуроновую кислоту, на клетках-мишенях необходимы для эффективной респираторно-синцитиальной вирусной инфекции. Вирусология 271 , 264–275 (2000).

    CAS PubMed Статья Google ученый

  • 93.

    Чиркова Т. и др. CX3CR1 является важной поверхностной молекулой для респираторно-синцитиальной вирусной инфекции в эпителиальных клетках дыхательных путей человека. J. Gen. Virol. 96 , 2543–2556 (2015).

    CAS PubMed PubMed Central Статья Google ученый

  • 94.

    Zhang, L. et al. Инфекция реснитчатых клеток вирусом парагриппа человека типа 3 на модели эпителия дыхательных путей человека in vitro. J. Virol. 79 , 1113–1124 (2005).

    CAS PubMed PubMed Central Статья Google ученый

  • 95.

    Zhang, L., Peeples, M. E., Boucher, R. C., Collins, P. L. & Pickles, R.J. Респираторно-синцитиальная вирусная инфекция эпителиальных клеток дыхательных путей человека поляризована, специфична для реснитчатых клеток и не имеет явной цитопатологии. J. Virol. 76 , 5654–5666 (2002).

    CAS PubMed PubMed Central Статья Google ученый

  • 96.

    Johnson, S. M. et al. Респираторно-синцитиальный вирус использует CX3CR1 в качестве рецептора на первичных культурах эпителия дыхательных путей человека. PLOS Pathog. 11 , e1005318 (2015).

    PubMed PubMed Central Статья CAS Google ученый

  • 97.

    Tripp, R.A. et al. Мимикрия хемокина CX3C гликопротеином G респираторно-синцитиального вируса. Нат. Иммунол. 2 , 732–738 (2001). Это исследование идентифицирует CX 3 Мотив C в RSV G и демонстрирует, что CX 3 CR1 облегчает ввод RSV .

    CAS PubMed Статья Google ученый

  • 98.

    Bazan, J. F. et al. Новый класс мембраносвязанных хемокинов с мотивом CX3C. Nature 385 , 640–644 (1997).

    CAS PubMed Статья PubMed Central Google ученый

  • 99.

    Jeong, K. I. et al. CX3CR1 экспрессируется в дифференцированных клетках ресничных дыхательных путей человека и совместно с респираторно-синцитиальным вирусом локализуется на ресничках G-белком. PLOS ONE 10 , e0130517 (2015).

    PubMed PubMed Central Статья CAS Google ученый

  • 100.

    Karron, R.A. et al. Белки SH и G респираторно-синцитиального вируса (RSV) не являются существенными для вирусной репликации in vitro: клиническая оценка и молекулярная характеристика пересаженного холодом аттенуированного мутанта подгруппы B RSV. Proc. Natl Acad. Sci. США 94 , 13961–13966 (1997). Эта работа демонстрирует, что инфекционный RSV требует только белка F на своей поверхности .

    CAS PubMed Статья Google ученый

  • 101.

    Techaarpornkul, S., Barretto, N. & Peeples, M. E. Функциональный анализ рекомбинантных мутантов с делецией респираторно-синцитиального вируса, лишенных небольшого гена гидрофобного и / или прикрепляющего гликопротеина. J. Virol. 75 , 6825–6834 (2001).

    CAS PubMed PubMed Central Статья Google ученый

  • 102.

    Feldman, S. A., Audet, S. & Beeler, J. A. Слитый гликопротеин респираторно-синцитиального вируса человека облегчает прикрепление вируса и инфекционность за счет взаимодействия с клеточным гепарансульфатом. J. Virol. 74 , 6442–6447 (2000).

    CAS PubMed PubMed Central Статья Google ученый

  • 103.

    Behera, A. K. et al. Блокирование молекулы-1 межклеточной адгезии на эпителиальных клетках человека снижает инфекцию респираторно-синцитиального вируса. Biochem. Биофиз. Res. Commun. 280 , 188–195 (2001).

    CAS PubMed Статья Google ученый

  • 104.

    Currier, M. G. et al. EGFR взаимодействует со слитым белком штамма респираторно-синцитиального вируса 2–20 и опосредует инфекцию и экспрессию муцина. PLOS Pathog. 12 , e1005622 (2016).

    PubMed PubMed Central Статья CAS Google ученый

  • 105.

    Tayyari, F. et al. Идентификация нуклеолина как клеточного рецептора респираторно-синцитиального вируса человека. Нат. Med. 17 , 1132–1135 (2011). В этой рукописи нуклеолин идентифицируется как фактор клетки-хозяина, который взаимодействует с белком F и способствует проникновению RSV .

    CAS PubMed Статья Google ученый

  • 106.

    Бозе С., Басу М. и Банерджи А. К. Роль нуклеолина в инфицировании эпителиальных клеток легких человека вирусом парагриппа 3 типа. J. Virol. 78 , 8146–8158 (2004).

    CAS PubMed PubMed Central Статья Google ученый

  • 107.

    Su, P. Y. et al. Нуклеолин клеточной поверхности способствует связыванию энтеровируса 71 и инфицированию. J. Virol. 89 , 4527–4538 (2015).

    CAS PubMed PubMed Central Статья Google ученый

  • 108.

    Xiao, X., Feng, Y., Zhu, Z. & Dimitrov, D.S. Идентификация предполагаемого фактора проникновения вируса крымско-конголезской геморрагической лихорадки. Biochem. Биофиз. Res. Commun. 411 , 253–258 (2011).

    CAS PubMed PubMed Central Статья Google ученый

  • 109.

    Qiu, J. & Brown, K. E. A. Ядерный челночный белок массой 110 кДа, нуклеолин, специфически связывается с капсидом аденоассоциированного вируса типа 2 (AAV-2). Вирусология 257 , 373–382 (1999).

    CAS PubMed Статья Google ученый

  • 110.

    Callebaut, C. et al. Идентификация белков, связывающих петлю V3, как потенциальных рецепторов, участвующих в связывании частиц ВИЧ с клетками CD4 + . J. Biol. Chem. 273 , 21988–21997 (1998).

    CAS PubMed Статья Google ученый

  • 111.

    Сринивасакумар, Н., Огра, П. Л. и Фланаган, Т. Д. Характеристики слияния респираторно-синцитиального вируса с клетками HEp-2, измеренные с помощью анализа ослабления флуоресценции R18. J. Virol. 65 , 4063–4069 (1991).

    CAS PubMed PubMed Central Google ученый

  • 112.

    Kahn, J. S., Schnell, M. J., Buonocore, L. и Rose, J. K. Рекомбинантный вирус везикулярного стоматита, экспрессирующий гликопротеины респираторно-синцитиального вируса (RSV): слитый белок RSV может опосредовать инфекцию и слияние клеток. Virology 254 , 81–91 (1999).

    CAS PubMed Статья Google ученый

  • 113.

    Уайт, Дж. М. и Уиттакер, Г. Р. Слияние оболочечных вирусов в эндосомах. Трафик 17 , 593–614 (2016).

    CAS PubMed PubMed Central Статья Google ученый

  • 114.

    San-Juan-Vergara, H. et al.Богатые холестерином микродомены как стыковочные платформы для респираторно-синцитиального вируса в нормальных эпителиальных клетках бронхов человека. J. Virol. 86 , 1832–1843 (2012).

    CAS PubMed PubMed Central Статья Google ученый

  • 115.

    Krzyzaniak, M. A., Zumstein, M. T., Gerez, J. A., Picotti, P. & Helenius, A. Попадание респираторно-синцитиального вируса в клетки-хозяева включает макропиноцитоз с последующей протеолитической активацией белка F. PLOS Pathog. 9 , e1003309 (2013).

    CAS PubMed PubMed Central Статья Google ученый

  • 116.

    Schlender, J., Zimmer, G., Herrler, G. & Conzelmann, K. K. Субъединица F2 слитого белка респираторно-синцитиального вируса (RSV), а не белок присоединения G, определяет специфичность инфекции RSV. J. Virol. 77 , 4609–4616 (2003).

    CAS PubMed PubMed Central Статья Google ученый

  • 117.

    Yuan, P. et al. Структурные исследования тетрамера гемагглютинин-нейраминидазы вируса парагриппа 5 в комплексе с его рецептором сиалиллактозой. Структура 13 , 803–815 (2005).

    CAS PubMed Статья Google ученый

  • 118.

    Креннелл, С., Такимото, Т., Портнер, А. и Тейлор, Г. Кристаллическая структура многофункциональной парамиксовирусной гемагглютинин-нейраминидазы. Нат. Struct.Биол. 7 , 1068–1074 (2000).

    CAS PubMed Статья Google ученый

  • 119.

    Bose, S., Jardetzky, T. S. & Lamb, R. A. Время решает все: точно настроенные молекулярные машины организуют проникновение парамиксовирусов. Вирусология 479–480 , 518–531 (2015).

    PubMed Статья CAS Google ученый

  • 120.

    Юнус, А.S. et al. Повышенная температура вызывает образование шестиспирального пучка белка F респираторно-синцитиального вируса человека. Вирусология 396 , 226–237 (2010).

    CAS PubMed Статья Google ученый

  • 121.

    Фирнс Р. и Деваль Дж. Новые противовирусные подходы к респираторно-синцитиальному вирусу и другим мононегавирусам: ингибирование РНК-полимеразы. Antiviral Res. 134 , 63–76 (2016).

    CAS PubMed Статья Google ученый

  • 122.

    Falsey, A. R. & Walsh, E. E. Связь сывороточных антител с риском респираторно-синцитиальной вирусной инфекции у пожилых людей. J. Infect. Дис. 177 , 463–466 (1998).

    CAS PubMed Статья Google ученый

  • 123.

    Холл, К. Б., Уолш, Э. Э., Лонг, К. Э. и Шнабель, К.C. Иммунитет к респираторно-синцитиальному вирусу и частота повторного заражения. J. Infect. Дис. 163 , 693–698 (1991).

    CAS PubMed Статья Google ученый

  • 124.

    Американская педиатрическая академия. Иммуноглобулин респираторно-синцитиального вируса для внутривенного введения: показания к применению. Комитет по инфекционным болезням, Комитет по плодам и новорожденным. Педиатрия 99 , 645–650 (1997).

    Артикул Google ученый

  • 125.

    Исследовательская группа IMpact-RSV. Паливизумаб, гуманизированное моноклональное антитело к респираторно-синцитиальному вирусу, снижает количество госпитализаций в связи с инфекцией респираторно-синцитиального вируса у младенцев из группы высокого риска. Педиатрия 102 , 531–537 (1998).

    Артикул Google ученый

  • 126.

    Beeler, J. A. & Coelingh, K.V. Нейтрализация эпитопов F-гликопротеина респираторно-синцитиального вируса – влияние мутации на функцию слияния. J. Virol. 63 , 2941–2950 (1989).

    CAS PubMed PubMed Central Google ученый

  • 127.

    Kwakkenbos, M. J. et al. Создание стабильных моноклональных антител, продуцирующих B-клеточные рецепторы B-клеток памяти человека, путем генетического программирования. Нат. Med. 16 , 123–128 (2010). В этом исследовании сообщается о выделении и характеристике первых F-специфических моноклональных антител перед слиянием, хотя их специфичность на момент не была известна.

    CAS PubMed Статья Google ученый

  • 128.

    Goodwin, E. et al. Младенцы, инфицированные респираторно-синцитиальным вирусом, вырабатывают мощные нейтрализующие антитела, в которых отсутствует соматическая гипермутация. Иммунитет 48 , 339–349 (2018).

    CAS PubMed PubMed Central Статья Google ученый

  • 129.

    Gilman, M. S. et al. Быстрое профилирование репертуаров антител к RSV из В-клеток памяти естественно инфицированных взрослых доноров. Sci. Иммунол . 1 (2016).

  • 130.

    Collarini, E.J. et al. Мощные высокоаффинные антитела для лечения и профилактики респираторно-синцитиального вируса, полученные из В-клеток инфицированных пациентов. J. Immunol. 183 , 6338–6345 (2009).

    CAS PubMed Статья Google ученый

  • 131.

    Mousa, J. J., Kose, N., Matta, P., Gilchuk, P. & Crowe, J. E. Jr. Новый нейтрализующий эпитоп, специфичный для конформации перед слиянием, на слитном белке респираторно-синцитиального вируса. Нат. Microbiol. 2 , 16271 (2017).

    CAS PubMed PubMed Central Статья Google ученый

  • 132.

    Corti, D. et al. Перекрестная нейтрализация четырех парамиксовирусов человеческим моноклональным антителом. Природа 501 , 439–443 (2013).

    CAS PubMed Статья Google ученый

  • 133.

    Zhu, Q. et al. Высокоэффективное антитело с увеличенным периодом полужизни в качестве потенциального заменителя вакцины против RSV для всех младенцев. Sci. Transl Med. 9 , eaaj1928 (2017).

    PubMed Статья Google ученый

  • 134.

    Национальная медицинская библиотека США. ClinicalTrials.gov https://clinicaltrials.gov/ct2/show/NCT02878330 (2018).

  • 135.

    Национальная медицинская библиотека США. ClinicalTrials.gov https://clinicaltrials.gov/ct2/show/NCT02325791 (2018).

  • 136.

    Костелло, Х. М., Рэй, В. К., Чайватпонгсакорн, С. и Пиплс, М. Е. Нацеливание на РСВ с помощью вакцин и низкомолекулярных препаратов. Заражение. Disord. Drug Targets 12 , 110–128 (2012).

    CAS PubMed PubMed Central Статья Google ученый

  • 137.

    Хейлен, Э., Нейтс, Дж. И Джохманс, Д. Лекарственные препараты-кандидаты и модельные системы в открытии противовирусных препаратов для респираторно-синцитиального вируса. Biochem. Pharmacol. 127 , 1–12 (2017).

    CAS PubMed Статья Google ученый

  • 138.

    Cianci, C. et al. Нацеливание на связывающий карман в тримере шпильки: низкомолекулярное ингибирование слияния вирусов. Proc. Natl Acad. Sci. США 101 , 15046–15051 (2004).

    CAS PubMed Статья Google ученый

  • 139.

    Roymans, D. et al. Связывание мощного низкомолекулярного ингибитора образования пучка из шести спиралей требует взаимодействия с обоими гептадными повторами слитого белка RSV. Proc. Natl Acad. Sci. США 107 , 308–313 (2010).

    CAS PubMed Статья Google ученый

  • 140.

    Yan, D. et al. Механизм перекрестной резистентности респираторно-синцитиального вируса против структурно разнообразных ингибиторов проникновения. Proc. Natl Acad. Sci. США 111 , E3441 – E3449 (2014).

    CAS PubMed Статья Google ученый

  • 141.

    Battles, M. B. et al. Молекулярный механизм ингибиторов слияния респираторно-синцитиального вируса. Нат. Chem. Биол. 12 , 87–93 (2016). Эта работа описывает сайт связывания и механизм действия для ингибиторов слияния малых молекул .

    CAS PubMed Статья Google ученый

  • 142.

    Samuel, D. et al. GS-5806 ингибирует пре- и постфузионные конформационные изменения слитого белка респираторно-синцитиального вируса. Антимикробный. Агенты Chemother. 59 , 7109–7112 (2015).

    CAS PubMed PubMed Central Статья Google ученый

  • 143.

    Де Винченцо, Дж.P. et al. Оральная активность GS-5806 в исследовании заражения респираторно-синцитиальным вирусом. N. Engl. J. Med. 371 , 711–722 (2014).

    PubMed Статья CAS Google ученый

  • 144.

    Stevens, M. et al. Противовирусная активность перорального JNJ-53718678 у здоровых взрослых добровольцев, зараженных респираторно-синцитиальным вирусом: плацебо-контролируемое исследование. J. Infect. Дис. 218 , 748–756 (2018).

    PubMed Статья Google ученый

  • 145.

    Mazur, N. I. et al. Пейзаж вакцин против респираторно-синцитиального вируса: уроки с кладбища и многообещающие кандидаты. Lancet Infect. Дис. 18 , e295 – e311 (2018).

    PubMed Статья Google ученый

  • 146.

    Грэм Б.С. Разработка вакцины против респираторно-синцитиального вируса. Curr. Opin. Virol. 23 , 107–112 (2017).

    CAS PubMed PubMed Central Статья Google ученый

  • 147.

    Magro, M. et al. Нейтрализующие антитела против преактивной формы слитого белка респираторно-синцитиального вируса открывают уникальные возможности для клинического вмешательства. Proc. Natl Acad. Sci. США 109 , 3089–3094 (2012). Это исследование является первым доказательством существования F-специфических антител перед слиянием и их доминирующего вклада в RSV-нейтрализующую активность сывороток человека .

    CAS PubMed Статья Google ученый

  • 148.

    Ngwuta, J. O. et al. F-специфические антитела перед слиянием определяют величину нейтрализующей активности RSV в сыворотке крови человека. Sci. Transl Med. 7 , 309ра162 (2015).

    PubMed PubMed Central Статья CAS Google ученый

  • 149.

    McLellan, J. S. et al. Конструирование на основе структуры гибридной гликопротеиновой вакцины против респираторно-синцитиального вируса. Наука 342 , 592–598 (2013). В этой рукописи сообщается о первом структурном дизайне вакцинного антигена F до слияния и демонстрируется его превосходная иммуногенность по сравнению с антигенами F после слияния .

    CAS PubMed PubMed Central Статья Google ученый

  • 150.

    Национальная медицинская библиотека США. ClinicalTrials.gov https://clinicaltrials.gov/ct2/show/NCT03049488 (2018).

  • 151.

    Национальная медицинская библиотека США. ClinicalTrials.gov https://clinicaltrials.gov/ct2/show/NCT03529773 (2018).

  • 152.

    Falloon, J. et al. Постфузионная вакцина на основе F-белка с адъювантом не предотвращала респираторно-синцитиальное вирусное заболевание у пожилых людей. J. Infect. Дис. 216 , 1362–1370 (2017).

    CAS PubMed PubMed Central Статья Google ученый

  • 153.

    Национальная медицинская библиотека США. ClinicalTrials.gov https://clinicaltrials.gov/ct2/show/NCT02608502 (2017).

  • 154.

    Национальная медицинская библиотека США. ClinicalTrials.gov https://clinicaltrials.gov/ct2/show/NCT02508194 (2017).

  • 155.

    Национальная медицинская библиотека США. ClinicalTrials.gov https://clinicaltrials.gov/ct2/show/NCT02624947 (2018).

  • 156.

    Каррон, Р. А., Бухгольц, У. Дж. И Коллинз, П.L. Живые аттенуированные вакцины против респираторно-синцитиального вируса. Curr. Верхний. Microbiol. Иммунол. 372 , 259–284 (2013).

    CAS PubMed PubMed Central Google ученый

  • 157.

    Karron, R.A. et al. Делеция гена, которая активирует экспрессию вирусного гена, дает аттенуированную вакцину против RSV с улучшенными реакциями антител у детей. Sci. Transl Med. 7 , 312ра175 (2015).

    PubMed PubMed Central Статья CAS Google ученый

  • 158.

    Liang, B. et al. Улучшенная стабильность перед слиянием, оптимизированное использование кодонов и расширенная упаковка вирионов повышают иммуногенность слитого белка респираторно-синцитиального вируса в кандидате с векторной вакциной. J. Virol. 91 , e00189-17 (2017).

    CAS PubMed PubMed Central Статья Google ученый

  • 159.

    Stobart, C.C. et al. Несмотря на высокую аттенуацию, живая вакцина против RSV с модифицированной термостабильностью является иммуногенной для хлопковых крыс. Нат. Commun. 7 , 13916 (2016).

    CAS PubMed PubMed Central Статья Google ученый

  • 160.

    Национальная медицинская библиотека США. ClinicalTrials.gov https://clinicaltrials.gov/ct2/show/NCT03303625 (2018).

  • 161.

    Национальная медицинская библиотека США. ClinicalTrials.gov https://clinicaltrials.gov/ct2/show/NCT02927873 (2018).

  • 162.

    Национальная медицинская библиотека США. ClinicalTrials.gov https://clinicaltrials.gov/ct2/show/NCT02873286 (2018).

  • 163.

    Левин С. Полипептиды респираторно-синцитиального вируса. J. Virol. 21 , 427–431 (1977).

    CAS PubMed PubMed Central Google ученый

  • 164.

    Уолш Э. Э. и Хруска Дж. Моноклональные антитела к белкам респираторно-синцитиального вируса: идентификация слитого белка. J. Virol. 47 , 171–177 (1983).

    CAS PubMed PubMed Central Google ученый

  • 165.

    Гарсия, Дж., Гарсия-Баррено, Б., Виво, А. и Мелеро, Дж. А. Цитоплазматические включения клеток, инфицированных респираторно-синцитиальным вирусом: образование телец включения в трансфицированных клетках, которые коэкспрессируют нуклеопротеин, фосфопротеин и белок 22К. Вирусология 195 , 243–247 (1993).

    CAS PubMed Статья Google ученый

  • 166.

    Гарсия-Баррено, Б., Дельгадо, Т. и Мелеро, Дж. А. Идентификация участков белка, участвующих во взаимодействии фосфопротеина и нуклеопротеина респираторно-синцитиального вируса человека: значение для сборки нуклеокапсида и образования цитоплазматических включений. J. Virol. 70 , 801–808 (1996).

    CAS PubMed PubMed Central Google ученый

  • 167.

    Rincheval, V. et al. Функциональная организация цитоплазматических телец включения в клетках, инфицированных респираторно-синцитиальным вирусом. Нат. Commun. 8 , 563 (2017).

    PubMed PubMed Central Статья CAS Google ученый

  • 168.

    Noton, S. L. & Fearns, R. Инициирование и регуляция транскрипции и репликации парамиксовирусов. Вирусология 479–480 , 545–554 (2015).

    PubMed Статья CAS Google ученый

  • 169.

    Gower, T. L. et al. Передача сигналов RhoA необходима для индуцированного респираторно-синцитиальным вирусом образования синцития и морфологии нитевидного вириона. J. Virol. 79 , 5326–5336 (2005).

    CAS PubMed PubMed Central Статья Google ученый

  • 170.

    Ke, Z. et al. Морфология и сборка респираторно-синцитиального вируса, выявленная с помощью криоэлектронной томографии. Вирусы 10 , E446 (2018). Эта работа убедительно демонстрирует, что RSV является нитчатым вирусом после отпочкования из инфицированных клеток .

    PubMed Статья Google ученый

  • 171.

    Mehedi, M. et al. Связанный с актином белок 2 (ARP2) и индуцированные вирусом филоподии способствуют распространению респираторно-синцитиального вируса человека. PLOS Pathog. 12 , e1006062 (2016).

    PubMed PubMed Central Статья CAS Google ученый

  • 172.

    Vanover, D. et al. Динамика гликопротеина RSV и геномной РНК выявляет сборку филаментов до плазматической мембраны. Нат. Commun. 8 , 667 (2017).

    PubMed PubMed Central Статья CAS Google ученый

  • 173.

    Форстер А., Мартенс Г. Н., Фаррелл П. Дж. И Байорек М. Димеризация матриксного белка необходима для отпочкования респираторно-синцитиального вируса. J. Virol. 89 , 4624–4635 (2015).

    CAS PubMed PubMed Central Статья Google ученый

  • 174.

    Робертс, С. Р., Компанс, Р. В. и Верц, Г. В. Респираторно-синцитиальный вирус созревает на апикальных поверхностях поляризованных эпителиальных клеток. J. Virol. 69 , 2667–2673 (1995).

    CAS PubMed PubMed Central Google ученый

  • 175.

    Ярдецки Т.С. и Лэмб, Р. А. Активация слияния мембран парамиксовируса и проникновение вируса. Curr. Opin. Virol. 5 , 24–33 (2014).

    CAS PubMed Статья Google ученый

  • 176.

    Yuan, P. et al. Структура эктодомена гемагглютинин-нейраминидазы (HN) вируса болезни Ньюкасла обнаруживает стебель пучка из четырех спиралей. Proc. Natl Acad. Sci. США 108 , 14920–14925 (2011).

    CAS PubMed Статья Google ученый

  • 177.

    Welch, B.D. et al. Структура эктодомена гемагглютинин-нейраминидазы (HN) вируса парагриппа 5 (PIV5). PLOS Pathog. 9 , e1003534 (2013).

    CAS PubMed PubMed Central Статья Google ученый

  • 178.

    Bose, S. et al. Активация слияния стеблем гемагглютинин-нейраминидазы вируса парагриппа без головы 5 предполагает модульный механизм запуска. Proc. Natl Acad.Sci. США 109 , E2625 – E2634 (2012).

    CAS PubMed Статья Google ученый

  • 179.

    Brindley, M.A. et al. Стабилизированный стебель прикрепляющего белка вируса безголовой кори эффективно запускает слияние мембран. J. Virol. 87 , 11693–11703 (2013).

    CAS PubMed PubMed Central Статья Google ученый

  • 180.

    Liu, Q. et al. Раскрытие трехэтапного пространственно-временного механизма запуска индуцированного рецептором слияния вируса Нипах и проникновения в клетки. PLOS Pathog. 9 , e1003770 (2013).

    PubMed PubMed Central Статья CAS Google ученый

  • 181.

    Иорио, Р. М., Мелансон, В. Р. и Махон, П. Дж. Взаимодействия гликопротеинов при слиянии парамиксовирусов. Future Virol. 4 , 335–351 (2009).

    CAS PubMed PubMed Central Статья Google ученый

  • 182.

    Маклеллан, Дж. С. Нейтрализующие эпитопы на гликопротеине слияния респираторно-синцитиального вируса. Curr. Opin. Virol. 11 , 70–75 (2015).

    CAS PubMed PubMed Central Статья Google ученый

  • Health Partners планируют начать процесс предварительной авторизации Synagis 15 октября

    План

    Health Partners (HPP) начнет ежегодный процесс предварительной авторизации Synagis 15 октября 2019 года, за две недели до начала сезона респираторно-синцитиального вируса (RSV).Синагис (паливизумаб) – моноклональные антитела, указанные для профилактики серьезных заболеваний нижних дыхательных путей, вызванных RSV, у младенцев и детей из группы высокого риска. Сезон RSV начинается 1 ноября 2019 г. и продлится до 31 марта 2020 г.

    ИСПОЛЬЗОВАНИЕ СИНАГИ

    Synagis снижает количество госпитализаций, связанных с РСВ, среди младенцев и детей из группы высокого риска. По информированному мнению Комитета по инфекционным заболеваниям и Руководящего комитета по бронхиолиту, а также других участников настоящего заявления, использование Synagis должно быть ограничено соответствующими группами населения, в том числе:

    • Младенцы, родившиеся до 29 недель, 0 дней беременности и младше 12 месяцев
    • Недоношенные дети с ХЗП недоношенных (определяется как рождение на сроке <32 недель, 0 дней беременности и потребность в> 21% кислорода в течение как минимум 28 дней после рождения), которым меньше 12 месяцев в начале сезона RSV.
    • Младенцы, которые удовлетворяют требованиям CLD по определению недоношенности и продолжают нуждаться в медицинской поддержке в течение 6-месячного периода до начала второго сезона RSV, и в возрасте от 12 до 24 месяцев.
    • Некоторые дети младше 12 месяцев с гемодинамически значимой ИБС.
    • Дети младше 24 месяцев с серьезным ослаблением иммунитета во время сезона RSV.
    • Младенцы с врожденным пороком сердца (ВПС), хроническим заболеванием легких (ХЗЛ) или другим состоянием (например, легочной аномалией или нервно-мышечным заболеванием), родившиеся на сроке 29 недель, 0 дней беременности или позже.

    ПРОЦЕСС ПРЕДВАРИТЕЛЬНОГО РАЗРЕШЕНИЯ ГЭС

    Если вы считаете, что Synagis имеет гарантии после просмотра медицинских записей пациента, заполните форму запроса предварительного разрешения Synagis на нашей веб-странице предварительного разрешения на конкретный препарат и отправьте ее по факсу 1-866-240-3712 . После того, как мы получим заполненную форму, Greater Philadelphia Pharmacy организует доставку вакцины для пациента в ваш офис или через поставщика услуг по уходу на дому.Если вы предпочитаете использовать другую специализированную аптеку, укажите это в форме.

    Обратите внимание, что только участвующие специализированные аптеки, работающие по контракту, могут распространять Synagis. Свяжитесь с нашим отделом аптек по телефону 215-991-4300 , и мы будем рады помочь вам с любыми вопросами, которые могут у вас возникнуть.

    Респираторно-синцитиальный вирус (RSV): симптомы, лечение, помощь

    Обзор

    RSV у младенцев и детей

    Что такое респираторно-синцитиальный вирус (RSV)?

    Респираторно-синцитиальный вирус (RSV) – распространенный респираторный вирус.Он поражает легкие и их бронхиолы (более мелкие проходы, по которым воздух попадает в легкие). RSV – одна из наиболее частых причин детских болезней, поражающая большинство детей к двухлетнему возрасту. RSV может также инфицировать взрослых.

    У большинства здоровых детей и пожилых людей, инфицированных РСВ, заболевание протекает в легкой форме с симптомами, напоминающими простуду. Обычно требуется только забота о себе или «забота о комфорте».

    Тяжелая инфекция RSV может привести к пневмонии (инфекции легких) и бронхиолиту (воспалению мелких дыхательных путей в легких) и может потребовать госпитализации.Наибольшему риску тяжелой инфекции подвержены очень молодые (младше шести месяцев), люди старше 65 лет и люди любого возраста с заболеваниями сердца или легких или ослабленной иммунной системой. RSV также может усугубить существующие проблемы с сердцем и легкими.

    Заразен ли респираторно-синцитиальный вирус (РСВ)? Как это распространяется? Как долго это длится?

    Да, RSV очень заразен, особенно в течение трех-семи дней у человека появляются симптомы. Некоторые младенцы и люди с ослабленной иммунной системой могут оставаться заразными до четырех недель.

    Вирус распространяется при тесном контакте, когда инфицированный человек чихает или кашляет, и вирус переносится по воздуху и попадает в ваше тело через глаза, нос или рот. Он также распространяется при прикосновении к объектам, на которые приземлился вирус, а затем при прикосновении к вашему лицу. RSV может жить на твердых поверхностях в течение многих часов.

    Проявление симптомов с момента контакта человека с RSV занимает от двух до восьми дней. Симптомы обычно длятся от трех до семи дней. Большинство детей и взрослых полностью выздоравливают через одну-две недели.

    Насколько распространен респираторно-синцитиальный вирус (РСВ)?

    Большинство детей заражаются RSV до двухлетнего возраста. Инфекция легко распространяется среди маленьких детей из-за их тесного контакта с другими детьми, которые могут быть инфицированы, путем совместного использования игрушек и постоянного прикосновения к предметам, которые могут быть заражены вирусом. Ежегодно около 57000 детей в возрасте до пяти лет в США нуждаются в стационарной помощи из-за RSV

    .

    Среди взрослых около 177 000 пожилых людей ежегодно госпитализируются по поводу RSV.Ежегодно около 14 000 взрослых умирают от этой инфекции.

    Является ли респираторно-синцитиальный вирус (РСВ) сезонным заболеванием?

    Да, как и грипп, RSV – это сезонное заболевание. Это происходит в большинстве районов США, начиная с поздней осени и длится до ранней весны.

    Кто заражается респираторно-синцитиальным вирусом (RSV)?

    RSV заражает почти всех детей по крайней мере один раз в возрасте до двух лет. В большинстве случаев этот вирус вызывает лишь незначительные симптомы простуды.Однако для некоторых младенцев и некоторых взрослых инфекция может быть более опасной.

    Младенцы и взрослые с наибольшим риском тяжелой или опасной для жизни инфекции RSV:

    • Недоношенные дети (потому что их легкие недоразвиты).
    • Младенцы в возрасте до 6 месяцев.
    • Младенцы, рожденные с заболеваниями сердца или легких.
    • Дети и взрослые с ослабленной иммунной системой, в том числе перенесшие трансплантацию органов или проходящие химиотерапию.
    • Дети, которые испытывают затруднения при глотании или не могут очистить слизистые.
    • Взрослые от 65 лет и старше.
    • Взрослые с заболеваниями сердца и легких, такими как застойная сердечная недостаточность, хроническая обструктивная болезнь легких или астма.

    Симптомы и причины

    Каковы признаки и симптомы респираторно-синцитиального вируса (РСВ) у младенцев?

    Общие симптомы RSV у младенцев включают:

    • Насморк.
    • Снижение аппетита.
    • Чихание и кашель.
    • Лихорадка (температура выше 100 градусов по Фаренгейту). Лихорадка может присутствовать не всегда.

    Симптомы у младенцев младшего возраста включают:

    • Суетливость / раздражительность.
    • Снижение активности / большая усталость, чем обычно.
    • Пониженный аппетит.
    • Паузы в дыхании.

    Симптомы тяжелого RSV у младенцев включают:

    • Короткое, поверхностное и учащенное дыхание.
    • Расширение (раздутие) ноздрей при каждом вдохе.
    • Дыхание животом (ищите «прогиб» грудной клетки в виде перевернутой буквы «V», начинающейся под шеей).
    • Голубоватая окраска губ, рта и ногтей.
    • Свистящее дыхание (это может быть признаком пневмонии или бронхиолита.)
    • Плохой аппетит.

    Каковы симптомы респираторно-синцитиального вируса (РСВ) у детей старшего возраста и взрослых?

    Многие дети старшего возраста и взрослые не имеют симптомов или имеют очень легкие симптомы. Общие симптомы RSV у тех, у кого есть симптомы, аналогичны простуде и включают:

    • Насморк.
    • Перегрузка.
    • Легкая головная боль.
    • Боль в горле.
    • Лихорадка.
    • Кашель.
    • Усталость.

    К каким серьезным заболеваниям может привести респираторно-синцитиальный вирус (РСВ)?

    Серьезные условия, которые могут возникнуть в результате RSV, включают:

    • Пневмония или бронхиолит.
    • Ухудшение симптомов у людей с такими состояниями, как хроническая обструктивная болезнь легких, астма и застойная сердечная недостаточность.

    Диагностика и тесты

    Как диагностируется респираторно-синцитиальный вирус (РСВ)?

    Ваш лечащий врач изучит вашу историю болезни или вашего ребенка и спросит о симптомах.Медицинский осмотр будет включать прослушивание легких ваших или вашего ребенка и проверку уровня кислорода с помощью простого пальцевого теста (пульсоксиметрия). Они могут заказать анализ крови для проверки на наличие признаков инфекции (например, более высокое, чем обычно, количество лейкоцитов) или взять мазок из носа для проверки на вирусы.

    Если есть подозрение на более тяжелое заболевание, ваш лечащий врач закажет вам визуализационные тесты (рентген, компьютерную томографию), чтобы проверить ваши легкие или легкие вашего ребенка.

    Ведение и лечение

    Как лечится респираторно-синцитиальный вирус (RSV)?

    Если у вас или у вашего ребенка легкие симптомы, лечение по рецепту обычно не требуется.RSV проходит сам по себе через одну-две недели. Антибиотики не используются для лечения вирусных инфекций, в том числе вызванных RSV. (Однако могут быть назначены антибиотики, если анализ показывает, что у вас или у вашего ребенка бактериальная пневмония или другая инфекция.)

    Некоторых маленьких детей, у которых развивается бронхиолит, возможно, придется госпитализировать для получения кислородного лечения. Если ваш ребенок не может пить из-за учащенного дыхания, ему может потребоваться внутривенное введение жидкости, чтобы избежать обезвоживания. В редких случаях инфицированным младенцам потребуется респиратор, чтобы помочь им дышать.Лишь около 3% детей с RSV нуждаются в госпитализации. Большинство детей могут вернуться домой из больницы через два-три дня.

    Если вы пожилой человек и особенно если у вас ослабленная иммунная система, вам может потребоваться госпитализация, если RSV тяжелый. Находясь в больнице, вы можете получать кислород или пользоваться аппаратом искусственной вентиляции легких, чтобы помочь вам дышать, или внутривенно вводить жидкости для облегчения обезвоживания.

    Доступна ли вакцина для предотвращения респираторно-синцитиального вируса (РСВ)?

    Вакцины для лечения RSV пока нет.Ученые работают над его разработкой.

    Есть ли лекарство от респираторно-синцитиального вируса (RSV)?

    В настоящее время лекарства от RSV не существует. Однако ученые продолжают изучать вирус и искать способы предотвратить заражение или лучше справиться с тяжелым заболеванием.

    Что такое паливизумаб (Synagis®)?

    Павливимаб – это лекарство, одобренное для профилактики тяжелого РСВ у некоторых младенцев и детей с высоким риском тяжелого заболевания. Препарат не лечит RSV, не используется для лечения детей, у которых уже есть тяжелая форма RSV, и не может предотвратить инфекцию RSV.Это делается в виде ежемесячных инъекций во время сезона RSV. Спросите своего врача, подходит ли павливимаб для предотвращения инфекции RSV у вашего ребенка.

    Если я или мой ребенок заразимся респираторно-синцитиальным вирусом (РСВ) один раз, сможем ли мы заразиться им снова?

    Люди, зараженные определенными вирусами, иногда могут выработать иммунитет к вирусу. Это означает, что они не заразятся снова в течение некоторого времени или даже навсегда. Это не относится к RSV. Вы или ваш ребенок можете заразиться RSV более одного раза в жизни и даже более одного раза в течение одного сезона RSV.

    Хорошая новость заключается в том, что повторные инфекции, как правило, менее серьезны, чем первоначальная инфекция. Однако если вы пожилой человек или взрослый человек с ослабленной иммунной системой или длительным заболеванием сердца или легких, инфекция RSV может быть более серьезной, если вы снова заразитесь.

    Профилактика

    Что я могу сделать, чтобы предотвратить заражение респираторно-синцитиальным вирусом (RSV) или предотвратить распространение RSV в случае заражения?

    Вы можете соблюдать те же меры предосторожности, что и при простуде, гриппе или другом заразном заболевании:

    • Часто мойте руки.Стирать 20 секунд. Если мыло и вода недоступны, используйте дезинфицирующее средство для рук на спиртовой основе, которое содержит не менее 60% спирта. (Средства на спиртовой основе хорошо подходят для маленьких детей, у которых отсутствует координация или концентрация внимания для правильной техники мытья рук.)
    • Не прикасайтесь к глазам, носу и рту, чтобы вирусы не распространялись через руки.
    • Прикрывайте рот и нос салфеткой при чихании и кашле или чихании и кашле в локоть. Выбросьте салфетку в мусор.После этого вымойте руки. Никогда не кашляйте и не чихайте в руки!
    • Избегайте тесного контакта (в пределах 6 футов) с теми, кто переболел RSV, кашляет, простужен или болен. Если ты заболел, оставайся дома.
    • Не передавайте чашки, игрушки, бутылки или какие-либо предметы. Вирусы могут жить на таких поверхностях часами (и передаваться вам в руки).
    • Если вы предрасположены к болезням или у вас ослабленная иммунная система, держитесь подальше от больших скоплений людей.
    • Очистите часто используемые поверхности (например, дверные ручки и столешницы) дезинфицирующим средством, уничтожающим вирусы.

    Дополнительные советы для детей:

    • Не давайте детям присматривать за детьми, когда они или другие дети заболеют.
    • Если у вас есть ребенок с высоким риском развития тяжелой формы RSV, постарайтесь ограничить время пребывания в детских учреждениях или на собраниях большого количества детей во время сезона RSV.
    • Часто мойте игрушки.

    Как сделать так, чтобы мой ребенок, больной респираторно-синцитиальным вирусом (РСВ), чувствовал себя лучше дома?

    • Не позволяйте никому курить рядом с вашим ребенком или дома.Это может затруднить дыхание.
    • Попробуйте использовать испаритель прохладного тумана, чтобы успокоить сухие дыхательные пути, если это рекомендовано вашим доктором. Следует избегать использования испарителей с горячим воздухом из-за риска ожогов.
    • Убедитесь, что ваш ребенок получает много жидкости, например грудного молока или смеси для младенцев, или молока, соков и воды для детей старшего возраста. Грудное молоко содержит антитела, которые помогают бороться с инфекциями.
    • При лихорадке давайте ребенку (старше 6 месяцев) такие лекарства, как ацетаминофен (детский тайленол®) или ибупрофен.Никогда не давайте ребенку аспирин, так как аспирин может вызвать синдром Рея.
    • Нанесите солевые капли для носа, чтобы помочь разжижить слизь в носу.
    • Часто сморкайтесь (или аккуратно сосите нос ребенка).
    • При необходимости позвольте вашему ребенку много отдыхать.
    • Дайте все лекарства в соответствии с указаниями врача вашего ребенка.

    Перспективы / Прогноз

    Чего можно ожидать, если у меня или моего ребенка разовьется респираторно-синцитиальный вирус (RSV)?

    В большинстве случаев RSV протекает в легкой форме и вызывает симптомы, похожие на простуду.Почти все дети в возрасте до двух лет будут инфицированы RSV.

    В большинстве случаев RSV у взрослых и здоровых детей не требует лечения. У младенцев и пожилых людей с наибольшим риском развития тяжелой формы РСВ может развиться пневмония или бронхиолит или ухудшиться состояние сердца и легких, и может потребоваться госпитализация.

    Вы можете помочь предотвратить распространение RSV, следуя здравым советам по гигиене и чистоте.

    Всегда обращайтесь к своему лечащему врачу или в отделение неотложной помощи, если у вас проблемы с дыханием, высокая температура или вас беспокоят какие-либо симптомы у вас или вашего ребенка.

    Жить с

    Когда мне следует позвонить своему врачу?

    Позвоните своему врачу, если у вас или вашего ребенка есть следующие симптомы:

    • Лихорадка (температура выше 100 градусов по Фаренгейту).
    • Лихорадка, продолжающаяся более двух дней.
    • Серый или голубой оттенок языка, губ или кожи.
    • Затрудненное дыхание.
    • Обострение симптомов простуды.

    Дополнительные симптомы, на которые следует обратить внимание у маленьких детей, включают:

    • Сильная суетливость, снижение внимания.
    • Обезвоживание (признаки включают менее одного влажного подгузника каждые 8 ​​часов, сухость во рту и плач без слез).
    • Кашель продолжается днем ​​и ночью.
    • Плохой аппетит.

    Респираторно-синцитиальный вирус, 2019: DCN

    Респираторно подтверждено лабораторно синцитиальная вирусная болезнь (RSV) стала отчет для всех госпитализированных жителей агломерации сентябрь 2016. Любая смерть, произошедшая по всему штату. в течение 60 дней после положительного результата теста RSV также подлежат отчетности.

    С 1 октября 2019 г. по 30 апреля 2020 г., Было зарегистрировано 774 случая (13,7 случая на 100000 человек) по сравнению с 721 случаев (12,9 случая на 100 000 человек) с октября 2018 г. по апрель 2019 г. общий средний возраст составлял 10 месяцев (диапазон: 8 дней – 100 лет). Шестьдесят шесть процентов (514) были младше 2 лет: 38% (291) были <6 месяцев, 15% (116) были 6 мес - 11 мес и 14% (107) были 1 год - <2 лет. Восемь процентов (64) были 2-4 года, 2% (14) были 5 - 17 лет, 4% (31) были от 18 до 49 лет, 6% (46) были от 50 до 64 лет и 14% (105) были старше 65 лет.Общий, 53% случаев RSV были мужчинами и 52% были белыми.

    Сорок пять процентов случаев имели сопутствующие заболевания. состояние на момент их болезнь и наличие сопутствующего состояние значительно улучшилось, так как возраст увеличился. Самый распространенный сопутствующие заболевания для случаев <2 лет были недоношенными (18%), сердечно-сосудистые заболевания (5%) и хронические заболевания легких (4%). Для кейсов 2 - 17 лет, хроническое заболевание легких (24%), астма / реактивное заболевание дыхательных путей (18%) и неврологические заболевания (17%) было записано.Самый распространенный основные условия для взрослых От 18 до 64 лет и старше (≥65 лет) имели хронический метаболизм болезнь (29% и 46% соответственно), сердечно-сосудистые заболевания (38% и 72% соответственно) и хроническое заболевание легких (45% и 51% соответственно).

    Девятнадцать смертей, связанных с RSV, были отчет за респираторный сезон: 11 умерли при госпитализации, и 8 в течение 60 дней после выписки из больница. Средний возраст смертельного исхода Случаи РСВ составляли 73 года (диапазон: 11 лет. – 90 лет), и у всех 19 были сопутствующие заболевания. условия.Выявление дополнительных Смертность, связанная с RSV, продолжается.

    SEC.gov | Превышен порог скорости запросов

    Чтобы обеспечить равный доступ для всех пользователей, SEC оставляет за собой право ограничивать запросы, исходящие от необъявленных автоматизированных инструментов. Ваш запрос был идентифицирован как часть сети автоматизированных инструментов за пределами допустимой политики и будет обрабатываться до тех пор, пока не будут приняты меры по объявлению вашего трафика.

    Пожалуйста, объявите свой трафик, обновив свой пользовательский агент, чтобы включить в него информацию о компании.

    Чтобы узнать о передовых методах эффективной загрузки информации с SEC.gov, в том числе о последних документах EDGAR, посетите sec.gov/developer. Вы также можете подписаться на рассылку обновлений по электронной почте о программе открытых данных SEC, включая передовые методы, которые делают загрузку данных более эффективной, и улучшения SEC.gov, которые могут повлиять на процессы загрузки по сценарию. Для получения дополнительной информации обращайтесь по адресу [email protected]

    Для получения дополнительной информации см. Политику конфиденциальности и безопасности веб-сайта SEC.Благодарим вас за интерес к Комиссии по ценным бумагам и биржам США.

    Код ссылки: 0.67fd733e.1634869965.24016f81

    Дополнительная информация

    Политика безопасности в Интернете

    Используя этот сайт, вы соглашаетесь на мониторинг и аудит безопасности. В целях безопасности и обеспечения того, чтобы общедоступная услуга оставалась доступной для пользователей, эта правительственная компьютерная система использует программы для мониторинга сетевого трафика для выявления несанкционированных попыток загрузки или изменения информации или иного причинения ущерба, включая попытки отказать пользователям в обслуживании.

    Несанкционированные попытки загрузить информацию и / или изменить информацию в любой части этого сайта строго запрещены и подлежат судебному преследованию в соответствии с Законом о компьютерном мошенничестве и злоупотреблениях 1986 года и Законом о защите национальной информационной инфраструктуры 1996 года (см. Раздел 18 USC §§ 1001 и 1030).

    Чтобы обеспечить хорошую работу нашего веб-сайта для всех пользователей, SEC отслеживает частоту запросов на контент SEC.gov, чтобы гарантировать, что автоматический поиск не влияет на возможность доступа других пользователей к SEC.содержание правительства. Мы оставляем за собой право блокировать IP-адреса, которые отправляют чрезмерное количество запросов. Текущие правила ограничивают пользователей до 10 запросов в секунду, независимо от количества машин, используемых для отправки запросов.

    Если пользователь или приложение отправляет более 10 запросов в секунду, дальнейшие запросы с IP-адреса (-ов) могут быть ограничены на короткий период. Как только количество запросов упадет ниже порогового значения на 10 минут, пользователь может возобновить доступ к контенту на SEC.губ. Эта практика SEC предназначена для ограничения чрезмерного автоматического поиска на SEC.gov и не предназначена и не ожидается, чтобы повлиять на людей, просматривающих веб-сайт SEC.