Содержание

Запись в трудовой книжке о переводе на другую должность образец 2019 пример

Представляем готовые образцы заполнения трудовых книжек в году, которые подготовлены в строгом соответствии с ТК РФ. Трудовики начали штрафовать бухгалтеров и кадровиков за ошибки в заполнении трудовых книжек. Журнал “Упрощенка” поможет исправить ошибки без штрафов:. Образцы трудовых книжек

ВИДЕО ПО ТЕМЕ: Запись в трудовую книжку о совместительстве – Елена А. Пономарева

Дорогие читатели! Наши статьи рассказывают о типовых способах решения юридических вопросов, но каждый случай носит уникальный характер.

Если вы хотите узнать, как решить именно Вашу проблему – обращайтесь в форму онлайн-консультанта справа или звоните по телефонам, представленным на сайте.

Это быстро и бесплатно!

Приказ о переводе работника на другую должность

Не заполнено обязательное поле Подтверждение пароля. Необходимо согласие на обработку персональных данных. П режде чем перейти к характеристике конкретных записей в трудовую книжку, отметим наиболее общие правила, которые установлены двумя уже известными вам нормативными правовыми актами – Правилами ведения и хранения трудовых книжек, изготовления бланков трудовой книжки и обеспечения ими работодателей, утвержденными Постановлением Правительства РФ от Сведения о работе в той или иной организации начинаются с данных о приеме на работу.

Рассмотрим основные правила внесения этой информации. При поступлении работника на основное место работы на срок более чем 5 дней работодатель обязан внести в его трудовую книжку представленную работником или оформленную тем же работодателем при приеме на работу сотрудника, для которого это основное место работы является первым запись о приеме на работу. В больших компаниях зачастую в целях облегчения работы по многократному внесению записей о приеме на работу используется следующий подход.

Заказывается специальный штамп с наборным текстом, содержащим наименование – полное и сокращенное – организации. Оттиск такого штампа в трудовой книжке заменяет внесенную от руки запись. Это целесообразно делать и в тех случаях, когда указание в трудовой книжке двух вариантов наименования организации полного и сокращенного от руки занимает много строк. Под указанным выше заголовком в 1-й графе ставится от руки далее все записи вносятся только от руки порядковый номер вносимой записи.

Далее – во 2-й графе указывается дата приема на работу. Потом в 3-й графе делается запись о принятии или назначении в структурное подразделение организации с указанием его конкретного наименования 2 , наименования должности работы , специальности, профессии с указанием квалификации. Как правило, наименование должности работы , специальности, профессии с указанием квалификации производится в соответствии со штатным расписанием – документом, который должен быть в каждой организации в обязательном порядке.

Однако если в соответствии с федеральным законом с выполнением работ по определенным должностям, специальностям или профессиям связано предоставление льгот либо наличие ограничений, то наименование этих должностей, специальностей или профессий и квалификационные требования к ним должны соответствовать наименованиям и требованиям, предусмотренным соответствующими квалификационными справочниками, утверждаемыми в порядке, установленном Правительством РФ.

В настоящее время действуют:. Обратите внимание! При игнорировании этих правил у работника могут возникнуть трудности при назначении пенсии, в том числе в отношении зачета периода работы на должностях по профессиям или специальностям , связанных с вредностью: сотрудники территориального отделения пенсионного фонда могут отказать работнику в зачете соответствующего периода в качестве льготного со ссылкой на то, что в списках должностей, специальностей и профессий, согласно которым предоставляют право на льготное начисление, данной должности специальности или профессии нет.

Кроме того, на практике важно понимать, какие наименования относятся к должностям, а какие – к профессиям. Для того чтобы точно определить, какое наименование правильно отнести к должности, а какое – к профессии, можно воспользоваться указанными выше справочниками, а также Общероссийским классификатором профессий рабочих, должностей служащих и тарифных разрядов ОКПДТР , утвержденным постановлением Госстандарта России от Указанные документы помогут избежать ошибок не только при внесении записей в трудовые книжки, но и при заключении трудовых договоров с работниками, при издании приказов распоряжений о приеме на работу.

Дело в том, что назначение на должность может иметь место в строго определенных случаях, а именно – только в случае, когда это предусмотрено нормативными правовыми актами или уставом положением организации, например, руководители филиалов и представительств юридического лица. Во всех иных случаях указывать о назначении на должность неправомерно. При внесении записей в трудовую книжку о приеме на работу часто неправильно толкуют требование о точном соответствии записей о приеме на работу приказу распоряжению работодателя, воспроизводя текст приказа распоряжения в трудовой книжке с указанием, например:.

Несмотря на то, что все эти подробности действительно установлены приказом распоряжением о приеме на работу, их указание в трудовой книжке недопустимо, поскольку противоречит Инструкции и означает нарушение правил внесения записей в трудовую книжку. Анализ текста Инструкции позволяет сделать вывод, что запись в трудовой книжке о приеме на работу должна включать в себя лишь указание, куда и кем принят человек, исключая особенности характера работы и другие условия трудоустройства у данного работодателя.

Наконец, в 4-й графе указывается наименование организационно-распорядительного документа, на основании которого в трудовую книжку внесена запись о приеме на работу – приказа распоряжения или иного решения работодателя – с указанием его даты сначала и номера после даты.

Семенова Е. Необходимо внести следующую запись в трудовую книжку Семеновой Е. Что, если к вам на работу придет человек и принесет трудовую книжку по форме, которая была утверждена ранее той формы, которая применяется теперь? Ответ на этот вопрос вы найдете в Постановлении Правительства РФ от Это значит, что трудовые книжки, оформленные на старых бланках г. Если трудовая книжка вашего работника была заведена до Когда свободное место закончится, следует оформить вкладыш в эту же трудовую книжку, но уже на бланке г.

Рассмотрим их подробно. Работнику в период работы в организации может быть присвоен новый разряд класс или категория. Тогда на основании приказа распоряжения работодателя необходимо внести соответствующую запись в его трудовую книжку п. Евсеева Е. Приказом от Равным образом отмечается установление работнику второй и последующих профессии, специальности или иной квалификации с указанием соответствующих категорий этих профессий, специальностей или уровней квалификации.

Слесарю по ремонту автомобилей 3 разряда Сергееву П. В трудовую книжку вносятся записи о переводе работника на другую постоянную работу у того же работодателя. Давайте разберемся, какие ситуации подразумеваются под таким переводом и как правильно внести записи в трудовую книжку.

Согласно ч. Например, переводом на другую работу у того же работодателя будет повышение работника в должности;. В трудовой книжке это отражается следующим образом:. Чинарева С. В последующем она была переведена в отдел по работе с персоналом на должность инспектора. Если перевод носит временный характер, запись в трудовую книжку работника о таком переводе не вносится.

Само по себе изменение заработной платы работника, изменение режима его труда, а равно перемещение работника в той же организации на другое рабочее место, в другое структурное подразделение в той же местности, поручение работы на другом механизме, если не изменяется трудовая функция работника, не считаются переводом и не требуют внесения изменений в трудовую книжку.

В случае изменения наименования компании в трудовую книжку работников необходимо внести соответствующую запись. Дело в том, что если ее не вносить, то получится парадоксальная ситуация – работник принят в одну организацию, а при внесении записи об увольнении будет проставлен оттиск печати организации уже с другим наименованием. Это позволит в последующем при оформлении пенсии засомневаться в правомерности включения времени работы в такой организации в соответствующий стаж, в результате чего от работника, скорее всего, потребуют представления дополнительных подтверждающих документов – справок с места работы, из государственного архива и т.

Подчеркнем, что само по себе изменение наименования организации не является причиной основанием для расторжения трудовых договоров с работниками, поэтому в такой ситуации вносить запись об увольнении нельзя! Согласно решению общего собрания участников, оформленного протоколом от Учитывая, что в организации работает более работников, отделом кадров заранее был заказан наборный штамп, с помощью которого в трудовые книжки работников вносилась соответствующая запись см.

С остальными работниками новый собственник по своей инициативе расторгнуть трудовые договоры не может. В силу ч. Во всех перечисленных случаях может иметь место расторжение трудового договора в связи с отказом работников от продолжения работы п. Оставшимся же на работе сотрудникам в трудовые книжки вносятся записи, выполненные по аналогии с записью, вносимой в связи с переименованием организации см.

Пример 7. Запись в трудовую книжку работника об изменении наименования должности профессии или структурного подразделения вносятся аналогичным образом.

Основанием для внесения таких записей будет являться приказ распоряжение или иное решение работодателя о соответствующем переименовании. В трудовую книжку также вносятся записи о времени военной службы в соответствии с Федеральным законом от По окончании обучения ей выдано свидетельство о повышении квалификации от Подпись об ознакомлении с ней ставится еще и в самой трудовой книжке.

Вернуться назад. За исключением случая, когда внутреннее структурное подразделение не указано в трудовом договоре в качестве дополнительного условия. В то же время указание на обособленное структурное подразделение организации-работодателя – филиал, представительство или иное обособленное структурное подразделение – является обязательным.

По приказу звучит так “Принят на должность начальника отдела” так и записывать в трудовую или есть более правильные варианты? Подскажите, а как быть если работала в одной организации 3 года, потом меняется название 2 раза и трудовую даже не просили при приеме.

Сейчас ушла в декрет и хочу чтоб сделали записи в трудовой. Какая печать и какие записи должны быть? Добрый день! Проинформируйте пожалуйста по вопросу записи в трудовой книжке о переименовании организации. Обязательно ли делать запись в разделе “сведения о работе”, можно ли делать вклейки в конце трудовой книжки о полной информации о переименовании организации с подписью и печатью руководителя организации?

Заранее спасибо за ответ! Подскажите пожалуйста, работаю по договору оказания возмездных услуг, должны ли мне сделать запись в трудовую книжку, если да то какую? Подскажите пожалуйста, если я работаю на второй работе по совместительству, то как должна быть оформлена запись в трудовой?

Запись в трудовой книжке делается по основному месту работы по желанию работника на основании приказов, полученных от работодателя, где работник работает по совместительству.

Нужно ли после внесения записи о приеме на работу ставить печать организации или печать ставится только после увольнения? При приеме на работу может ставится штамп предприя тия, четко.

Чтобы читалась. В трудовом договоре, в разделе “Режым работы” прописанно – Шестидневка; 40 – часовая рабочая неделя!!! А работаю в разъездах по Записывается ли в трудовую книжку разъездной график работы и на что это влияет???

Работаю в одной государственной гражданской организации с года, ввесной года был приказом направлен в г. Грозный, точнее командирован. Занимался там не свойственными для себя обязанностями по эвакуации гражданского населения, пробыл там месяц. По возвращению были выплачены командировачные из расчёта “один день за три” так как в тот момент там действовал режим КТО и каждый день был приравнен к боевым.

Из документов имел справку на руках подписанную руководителем подразделения в котором мы находились под защитой. Там указан период моего пребывания, и то, что я имею соответствующие льготы в связи с тем, что эти дни я находился в зоне боевых действий.. Но по возвращению на справку никто не обратил внимание и все благополучно забыли.

Попытался получить удостоверение участника боевых действий, но в связи с тем, что в тот момент моё министерство было гражданским и я тоже являлся гражданским госслужащим, я его не получил. Теперь вопрос. Обязаны ли мне внести в трудовую книжку запись такого вида ” Что такой-то такой-то в период с – по – выполнял служебные обязанности в зоне боевых действий и день службы засчитывается за три” Ну короче что-то вроде этого.

Когда присвоен новый разряд, нужно ли в трудовой запись делать развернуто то есть опять с указанием участка, цеха? Подскажите пожалуйста если мы приняли врачом по спортивной медицине со 0,7 ед и 0,5 врач-методист, как делать запись в трудовой о принятии работы? Буду Вам очень благодарна!

Перевод на другую работу: запись в трудовой: образец 2019 года

Не заполнено обязательное поле Подтверждение пароля. Необходимо согласие на обработку персональных данных. П режде чем перейти к характеристике конкретных записей в трудовую книжку, отметим наиболее общие правила, которые установлены двумя уже известными вам нормативными правовыми актами – Правилами ведения и хранения трудовых книжек, изготовления бланков трудовой книжки и обеспечения ими работодателей, утвержденными Постановлением Правительства РФ от

О том, как оформляется перевод, редко задумываются рядовые работники, а вот для сотрудников отдела кадров порой эта задача оказывается сложна. Не всегда можно сразу оценить на постоянный срок переводят специалиста и нужно ли заносить сведения о его переводе в трудовую книжку.

В настоящем разделе опубликованы материалы книги “Трудовые книжки. Все образцы записей соответствуют требованиям законодательства на 1 января г. Те главы, которые “не светятся” как ссылки, в данном разделе недоступны. Также Вы можете заказать доступ к книге “Трудовые книжки.

Как правильно заполнить трудовую книжку

В первую очередь необходимо упомянуть, что заполнение трудовых книжек регулируется статей 66 ТК РФ. Кроме того, нужно упомянуть два других основополагающих документа. Образец и правила заполнения трудовой книжки утверждены Постановлением Минтруда России от В нем подробно раскрыты нюансы внесения сведений в документ и исправления некорректных записей. Помимо инструкции, которая отвечает на вопрос: как правильно вносятся записи в трудовой книжке год — существуют также Правила ведения и хранения трудовых книжек, утвержденные Постановлением Правительства РФ от Согласно ст. Образец трудовой книжки можно посмотреть в нашей статье. Ошибки в записях, которые вносятся в этот бланк, могут помешать трудоустройству работника и офромлению пенсии. Исправить неточности будет работодатель, который их допустил. Либо текущий работодатель на основании документов от организации, которая эти ошибки допустила.

Заполнение трудовой книжки в 2019 году: образцы

Трудовая книжка — это основной документ работника о его трудовой деятельности и наработанном стаже. Все работодатели должны вести оформлять и вносить необходимые записи трудовые книжки своих работников. Под работодателями следует понимать:. Отметим, что физические лица, не оформленные как индивидуальные предприниматели, делать записи в трудовых книжках своих работников не могут.

Согласно статье Он может производиться только по соглашению сторон, за исключением некоторых случаев, которые мы рассмотрим далее.

Виды переводов на другую работу. Как оформить перевод сотрудника на другую должность. Временный перевод работника на другую должность.

Трудовые книжки: образцы записей, порядок ведения, исправления 2019

.

.

Как делать запись в трудовой книжке о переводе на другую должность?

.

Образец заполнения титульного листа трудовой книжки . Сведения о приеме на работу, переводе на другую работу, увольнении (с указанием причин.

.

Правила внесения записей в трудовую книжку

.

Запись о переводе на другую должность образец

.

.

.

.

Заполнение трудовой книжки в Беларуси с примерами в 2021 году

В этой статье мы приведем наглядные примеры того, как заполнять трудовую книжку в 2020 году в определенных случаях (РБ). Ниже указаны основные случаи и образцы заполнения.

Образец заполнения титульного листа трудовой книжки

Как видите тут максимально все просто-в поля пишите свои данные, дату рождения, образование, профессия и всё. На этом титульный лист заканчивается.

Внесение записи об образовании

Заполнив титульный лист, по образцу, данному выше. нужно теперь указать сведения об образовании.  Указывайте номер диплома, дату выдачи и кем выдан. Вместе с трудовой книжкой вы делаете копию диплома и в нем непосредственно указаны более подробные данные, нежели в трудовой. Смотрите образец записи в трудовой:

Прием на работу после ВУЗа

Данный пример будет очень полезен для молодых специалистов, которые только что выпустились и хотят пойти на свою первую работу после получения диплома.

Указываете период вашего обучения в учебном заведении, номер диплома и дату его выдачи. Затем уже вписывается место работы на которую вы только что пошли и должность.

Образец записи об увольнении в трудовой книжке

Дан пример увольнения по соглашению сторон. Если вы уволены по другой причине, то указывайте в сведениях о работе конкретную причину увольнения и статью на нормативный правовой акт. Заполняется дата, причина увольнения и на основании чего работник уволен.

Если вступил(а) в брак

Очень актуально для девушек, реже-для мужчин. Слева вписываете какая фамилия была и на какую изменена и на основании чего ( свидетельство о регистрации брака). В последующем, при смене фамилии ( развод) необходимо указать основание ( свидетельство о расторжении брака) и вписать фамилию которую вы взяли. В графе «Фамилия» снова зачеркивается предыдущая фамилия и пишется другая.

О призыве на военную службу

А теперь это уже актуально для мужчин. Вы устроились на работу, но приходит осень, а с ней и призыв в Вооруженные Силы Республики Беларусь. Придется отдавать долг Родине. Издается указ  и вносится запись об увольнении по причине призыва на военную службу.

Если на работе присвоили новую категорию/квалификацию

Издается отдельный приказ о присвоении новой категории и вносится в трудовую книжку. Обязательно пишется дата присвоения, и какая категория присвоена.

Запись в трудовой книжке сделана неправильно, что делать?

Не волнуйтесь, ничего страшного, все изменения и дополнения производятся в вашу книжку. Поэтому достаточно просто в следующей графе указать, что данная запись недействительна и написать верный вариант. Как видим из нашего примера, в записи  под номером 3 указан неверно год принятия на работу сотрудника. Следующей записью добавили, что прошлая запись недействительна и исправлена на верный вариант. Также бывают случаи, когда неверно указали должность сотрудника. Исправляется это аналогичным способом.

Образцы Записей В Трудовой Книжке 2021: изменения и поправки

Автор Виктория Андреевна На чтение 9 мин. Просмотров 14 Опубликовано

Инструкция: как заполнить трудовую книжку при увольнении

Основные положения регламентированы «Правилами ведения и хранения трудовых книжек, изготовления бланков и обеспечения ими работодателей», утвержденными Постановлением Правительства РФ от 16.04.2021 № 225 и «Инструкцией по заполнению тр. книжек», утвержденной Постановлением Минтруда РФ от 10.10.2021 № 69.

Запись в трудовой об увольнении по собственному желанию 2021 года, равно как и по другим основаниям, вносится после издания соответствующего приказа, а формулировка должна соответствовать статье ТК РФ. Не допускаются помарки, исправления и сокращения слов. В статье мы приводим образец записи об увольнении в трудовой книжке 2021 года для разных случаев. Основные реквизиты:

Заполнение трудовой книжки

Помимо вносимых от руки данных, на титульной и других страницах, имеется серийный номер необходимый для идентификации. Этот номер заноситься в реестр, в дальнейшем может быть использован для быстрого поиска данных в пенсионном и иных фондах.

Правила заполнения трудовой книжки в 2021 году сохраняются прежними, несмотря на пакет изменений по ведению документации в связи с пенсионной реформой и рядом других преобразований. Единственным изменением, становится возможность заверения записей, только подписями ответственных лиц без печати организации. При этом, законность и достоверность данных не будет приниматься по сомнение.

Как внести исправление в трудовую книжку — образец 2021

Исправление в данном случае будет производиться посредством признания ранее сделанной записи недействительной (путем внесения в книжку новой отдельной записи соответствующего содержания) с последующим указанием актуальной информации.

Если ошибка была допущена при первичном оформлении трудовой книжки (к примеру, сотруднику — выпускнику вуза), то исправлять ничего не надо. Следует просто уничтожить бланк с неверными данными и заполнить новый, содержащий корректные сведения (п. 42 правил заполнения книжек, утвержденных постановлением Правительства РФ от 16.04.2021 № 225).

Трудовая книжка работника в 2021 году

  • Заполнение книжки начинается с графы 3, в которой необходимо указать полное и сокращенное наименование организации. Допускается вместо этого поставить печать с указанием наименования. Если работник принимается в филиал – указывается наименование головной организации.
  • После графы 3 заполняется графа 1, в которой указывается порядковый номер записи. При внесении записи должен соблюдаться порядок сквозной нумерации. То есть, если предыдущая запись была под номером 8, следующая будет под номером 9.
  • В графе 2 необходимо указать дату начала работы в соответствии с приказом.
  • В графе 3 (напротив даты начала работы) необходимо указать должность, специальность или профессию с указанием квалификации на которую принят работник и наименование подразделения в котором он будет трудиться.
  • В графе 4 указывается дата и номер приказа о приеме на работу.

Примечание: если допущена такая ошибка, то она исправляется путем внесения записи под следующим номером в формате «Запись за номером таким-то недействительна»» и затем, следующей строкой указывается верная запись с дублированием номера и даты приказа.

Запись в трудовой книжке о приеме на работу: как ее правильно сделать в 2021 году, рассмотрено на примерах

Таким образом, если ответственное лицо за ведение трудовых, в течение первых пяти дней не сделало запись о приеме, а сотрудник в течение этого же времени принял решение об увольнении, то отсутствие записи о приеме не будет являться нарушением установленных норм.

Одним из основных документов работника, свидетельствующим о его трудовой деятельности, является трудовая, которую оформляют ему на первом его месте работы. В дальнейшем там делают при оформлении запись в трудовой книжке о приеме на работу, и отметку о расторжении. Ее сдают в кадровую службу при поступлении, и получают на руки при увольнении под роспись.

Трудовая книжка: инструкция по заполнению 2021

Обратите внимание: в бланке трудовой книжки под чертой, предназначенной для подписи ответственного лица, написано «разборчиво». Нормативные акты трудового законодательства данное понятие не конкретизируют. Поэтому специалисты рекомендуют должностному лицу не ставить личную подпись, а записывать в данной строке четко и разборчиво свою фамилию.

Таким образом, если документ оформляется работнику впервые, используется бланк, утвержденный Постановлением № 225. При этом труд. книжки работников, начатые до 01.01.2021, замены не требуют, а продолжают эксплуатироваться в обычном порядке.

Правила заполнения трудовой книжки и образец 2021

Также в столбец 3 заносится информация о переименовании или реорганизации предприятия, например: Общество с ограниченной ответственностью «Кристалл» (ООО «Кристалл») 22.01.2021 переименовано в Общество с ограниченной ответственностью «Эдельвейс» (ООО «Эдельвейс»).

Шаг 2. Вернемся к столбцам 1 и 2. Строки, в которых указано название организации, не нумеруются. Порядковый номер присваивается только той строке, в которой, в соответствии с записями в столбце 3, зафиксировано событие.

Запись в трудовой книжке об увольнении по собственному желанию 2021

Запись об увольнении по собственному желанию 2021 в этом случае будет иной. Нужно будет не только внести отметку об увольнении по собственному желанию, но и прописать мотивы ухода. То есть уважительные причины.

Кроме того, вместо этих формулировок можно использовать и следующие: «трудовой договор прекращен по инициативе работника» и «трудовой договор прекращен по собственному желанию». Ошибки здесь, опять же, не будет. Равно как и не будет ее, если вы используете сочетание — «трудовой договор расторгнут по инициативе работника».

Правила заполнения трудовой книжки работника

  • недопустимо повреждение самой обложки;
  • недопустимо исправление ошибок, все записи должны оформляться по правилам ведения ТК;
  • без самой трудовой книги вкладыш не имеет никакой юридической силы;
  • при внесении изменений в формуляр, они заносятся на все страницы, включая вклеенные бланки.

Если ИП совмещает свою деятельность с работой на другом предприятии, то в той фирме на него ведется формуляр как на обычного сотрудника, что не освобождает предпринимателя от обязанности уплаты налога на частный бизнес.

Образец заполнения трудовой книжки при приеме на работу: 2021 год

  • Порядок обеспечения работодателей бланками трудовых книжек и вкладышей к ним, утвержденный Приказом Минфина № 117н от 22.12.2021;
  • Инструкция по заполнению трудовых книжек, утвержденная Постановлением Минтруда № 69 от 10.10.2021;
  • Правила ведения и хранения трудовых книжек, утвержденные Постановлением Правительства № 225 от 16.04.2021.

Приступающему к трудовой деятельности впервые гражданину трудовая книжка оформляется по первому месту работы. Для этого он обязан написать личное заявление с просьбой получить книжку, а также внести сумму, равную стоимости бланка.

Как правильно заполнять трудовую книжку: образец 2021 года

В ТК сохраняется все сведения о трудовой активности гражданина, и она предназначена для вычисления продолжительности его трудового стажа при выходе на пенсию. Действующие форматы ТК и вкладышей регламентируются Постановлением № 225 от 16.04.2021 г. В Постановлении № 69 от 10.10.2021 г описываются правила записей в ТК. Указанные постановления имеют разногласия по некоторым вопросам, поэтому для грамотного ведения записей в ТК возникает необходимость обращаться к Трудовому Кодексу РФ.

  • При обнаружении опечаток в титульном бланке (в ФИО, а также в прочих личных сведениях) после заполнения ТК другими фирмами, придется подавать иск в судебные инстанции для того, чтобы ТК была признана за заявителем.
  • При повышении уровня образования необходимо вносить поправки данных об образовании.
  • Если работник получил новую специальность, также вводится новая запись.
  • Для правки надписей во 2-м и 3-м пунктах старая надпись зачеркивается и заносится новая на основании предъявленных материалов. При этом, отметим, что на странице «Сведения о работе» зачеркивания не допускаются. Если все-таки надпись сделана ошибочно, то после нее в этой же колонке записывается, что данная надпись недействительна и заполняется правильная запись под новым порядковым номером.
  • При обнаружении ошибки у нового работодателя кадровый работник оформляет запись о недействительности предыдущей, с внесением новой записи, с новым порядковым номером, датой исправления и соответствующего приказа.

Запись об увольнении в трудовой книжке: образцы

Под перечисленными основаниями со ссылками на статьи действующего законодательства РФ (обязательно проверьте, действует ли данное положение, не было ли она изменено или исключено из законодательной базы) работник-кадровик, который заполняет трудовые книжки ставит свою подпись вместе с подписью увольняемого сотрудника, выражая таким образом своё ознакомление и согласие со всеми перечисленными пунктами и причинами увольнения. После этого страница должна быть заверена фирменной печатью организации нанимателя, если таковая имеется.

Важно: Некоторые юристы в 2021 году настаивают, что, в первую очередь, законной силой обладает формулировка статьи кодекса, являющаяся первостепенным актом для самого нанимателя, в которой фигурируют слова «договор расторгнут», а также «прекращён».

Инструкция по заполнению трудовых книжек в 2021 году

Если происходят изменения условий трудового договора с работником, и они не касаются напрямую его трудовой функции (например, меняется режим работы или оклад), то внесение таких данных в трудовую не делается. Не фиксируются также совмещение должностей, расширение зоны обслуживания или увеличение объёма работ в текущей должности, временные переводы или временное исполнение обязанностей другого работника, за исключением случаев, для которых оформляется срочный трудовой договор.

Однако после восстановления работника в должности нередки случаи, когда у работодателя получается обжаловать решение суда и снова уволить сотрудника. В таком случае в трудовую книжку в обычном порядке вносится запись об увольнении, ссылающаяся на п. 11 ч. 1 ст. 83 ТК РФ.

Сведения про образование в трудовой книжке: образец на 2021 год

Этот же пример заполнения документации в трудовом документе используется в качестве образца исправления сведений образовательного характера.
Не делают запись о повышении квалификационного уровня после прохождения курсов и сдачи экзамена. Эти данные вносятся во внутреннюю часть трудовой.
Если трудоустраиваемое лицо не имеет никакого образования, кроме среднего, то указываются именно эти данные, на основании школьного аттестата.
Владелец трудовой, в присутствии кадрового сотрудника обязан проверить все внесенные сведения, и при правильности оформления закрепить их личной подписью. Инспектор по кадрам тоже визирует документ.

Кадровый сотрудник указывает всю нужную правдивую информацию о трудоустраиваемом гражданине полностью (ст. 65 ТК РФ). Сокращать и заменять данные документов недопустимо (п. 9 Правил). Основанием сведений является паспорт или любой документ с удостоверением личности (военный билет, загранпаспорт, водительские права).

Пример заполнения трудовой книжки прием директора

Пример заполнения трудовой книжки прием директора

Дата публикации 27.02.2020

На собрании учредителей принято решение об организации ООО. Генеральный директор был избран 16.12.2019, общество зарегистрировано 26.12.2019. К работе директор приступил с 01.01.2020. Как сделать запись в трудовую книжку генерального директора? Какую дату приема указать?

Трудовую книжку генерального директора во вновь созданной организации необходимо заполнять в общем порядке. В графе 2 в качестве даты приема на работу указывается день, когда трудовой договор с директором вступил в силу.

Обоснован такой вывод следующим.

Трудовая книжка (в случае ее ведения) является основным документом о трудовой деятельности. Ведется она на всех работников организации, проработавших в ней по основному месту работы не менее 5 дней (ч. 1, ч. 3 ст. 66 ТК РФ).

Порядок заполнения трудовой книжки установлен в Инструкции по заполнению трудовых книжек, утвержденной постановлением Минтруда России от 10.10.2003 № 69 (далее – Инструкция). В ней нет особенностей заполнения трудовой книжки руководителя. Поэтому трудовая книжка руководителя заполняется в том же порядке, что и трудовая книжка любого работника.

Наряду с записью о назначении на должность генерального директора в трудовой книжке указывается (п. 3.1 Инструкции):

  • в графе 2 – дата приема на работу;
  • в графе 4 – дата и номер приказа или иного распоряжения работодателя о приеме на работу.

Датой приема на работу генерального директора вновь созданной организации является дата начала работы в качестве руководителя. (До регистрации ООО директор не может исполнять своих обязанностей, поскольку организация еще не создана). При этом дата начала работы является условием, которое обязательно указывается в трудовом договоре (ст. 57 ТК РФ). Сам трудовой договор вступает в силу либо со дня его подписания, либо со дня допуска работника к работе (ч. 1 ст. 61 ТК РФ). Например, 01.01.2020. Следовательно, в графу 2 в качестве даты приема на работу вносится день, в который директор приступил к работе.

Генерального директора ООО избирает общее собрание участников (назначает единственный учредитель). Оформляется это протоколом общего собрания или решением единственного учредителя. Кроме того, сам директор может издать приказ о вступлении в должность. Поэтому в графе 4 его трудовой книжки можно указать:

  • дату и номер протокола общего собрания участников (решения единственного участника)
  • или дату и номер приказа директора о вступлении в должность (назначении на должность) (письмо Роструда от 22.09.2010 № 2894-6-1).

Смотрите также

Не пропускайте последние новости — подпишитесь
на бесплатную рассылку сайта:

  • десятки экспертов ежедневно мониторят изменения законодательства и судебную практику;
  • рассылка бесплатная, независимо от наличия договора 1С:ИТС;
  • ваш e-mail не передается третьим лицам;

Запись в трудовой книжке генерального директора: образец

Оформление приема на работу руководителя отличается от обыкновенного сотрудника. Из нашей консультации вы узнаете, какие делать записи в трудовой книжке генерального директора и какие документы указывать в качестве основания, а также что нужно учитывать при ее заполнении.

Зачем нужна руководителю

Генеральный директор – исполнительное лицо, избираемое на должность советом директоров или собранием участников фирмы. Он на протяжении определенного времени занимается управленческими делами. Однако с ним возможно заключение и бессрочного трудового контракта. Также см. «Трудовой договор с гендиректором: образец 2016 года».

Одним из важных источников, содержащих данные о трудовой биографии, выступает образец трудовой книжки директора. Ее заполняют несколько иначе, чем рядовым работникам. Она нужна для правильного исчисления трудового стажа и определения размера пенсии. Но прежде, чем ответить на поставленные вопросы, вкратце о порядке устройства на должность руководителя.

Как принимают в начальники

Схема приема на работу зависит от количества учредителей бизнеса. Если создателем является один человек, он просто составляет заявление на собственное имя. Когда же собственников несколько, оформляют протокол или решение. Этот документ содержит мнение всех заинтересованных лиц с обязательным наличием их подписей. Дальнейший порядок действий такой:

  1. Составление трудового контракта, который будет подписан между будущим директором и председателем собрания акционеров (участников общества).
  2. Издание приказа о вступлении на место главы фирмы (очень рекомендуем одновременно составлять и распоряжение о приеме на работу по стандартной форме Т-1, чтобы предотвратить разные конфликты). Также см. «Приказ о назначении на должность гендиректора: как оформить».
  3. По инструкции Минтруда № 69 идет заполнение трудовой книжки директора. (если у лица она отсутствует в этот документ, покупают чистый бланк).

Выполнение последнего действия возможно только тогда, когда подписан контракт, выпущены оба приказа и новый начальник поставил подпись о том, что ознакомлен с содержанием всех документов. Также см. «Правила заполнения и ведения трудовой книжки».

Трудовая книжка генерального директора: записи о приеме

На первую страницу вносят личные данные: Ф.И.О., дату рождения, статус полученного образования, профессию и специальность. Также обязательно отмечают дату заполнения, ставят подписи сторон и печать предприятия.

Раздел с информацией о трудовой деятельности и занимаемой должности заполняют так (см. таблицу).

Столбец Что указать
1 Номер новой записи
2 Дата события: приема на место руководителя (должна совпадать с поставленной в приказе)
3 Пишут полное и сокращенное название компании, факт трудоустройства, подпись кадрового сотрудника и фирменный штамп. Например: «Принят на должность генерального директора».
4 В качестве основания приема на работу в трудовой книжке директора ООО, который является единственным учредителем, указывают реквизиты его приказа о своем вступлении в должность.

Когда кандидата избирают в АО или фирме, имеющей несколько владельцев данного бизнеса, следует сослаться на сведения из протокола общего собрания или решения.

ПРИМЕР
ООО «Гуру» принимает на должность генерального директора В.И. Рябчикова. Решение принято на общем собрании участников, проведенном 19 октября 2011 г. Как сделать запись в трудовую книжку директору:

В момент избрания на высшую должность кандидат получает право подписывать документы о назначении, увольнении и переводе подчиненных. Аналогичные полномочия распространяются и на собственную кандидатуру. Поэтому в некоторых ситуациях книжку заполняет учредитель или председатель главного органа управления компанией.

Трудовая книжка: увольнение генерального директора

Прекращение производственных взаимоотношений возможно по разным причинам: закрытие бизнеса, решение собственника или совета директоров. Внесение необходимых сведений об этом в трудовую книжку – обязательно для руководства и представителей кадровой службы. Визировать эту процедуру имеет право руководитель (до официального прекращения деятельности).

Далее на рисунке показан образец записи в трудовой книжке директора об увольнении с использованием данных из предыдущего примера:

Учтите, что Пенсионный фонд внимательно проверяет документы при определении стажа работы. Аналогично поступают и некоторые организации, принимающие нового кандидата на руководящую должность. Поэтому важно, чтобы трудовая книжка заполнялась грамотно.

Если вы нашли ошибку, пожалуйста, выделите фрагмент текста и нажмите Ctrl+Enter.

Трудовые книжки. Записи о назначении/избрании директором.

На практике существует спор о том, какой документ указывать в графе 4 раздела «Сведения о работе» в случаях, когда вносится запись о назначении на должность директора (генерального директора) общества. Одни специалисты предлагают указывать приказ о приеме на работу (приказ о вступлении в должность директора), другие считают правильным указывать протокол общего собрания участников общества. Третьи предлагают указывать оба эти документа.

Наиболее распространены последние два варианта.

Напоминаем, согласно п.3.1 Инструкции «в графу 4 заносятся дата и номер приказа (распоряжения) или иного решения работодателя, согласно которому работник принят на работу».

Примеры записей о назначении/избрании генеральным директором

Вместо слова «назначен» в формулировке о приеме на работу директора общества может быть слово «избран», потому что общее собрание участников общества (если участников более одного) директора избирает.

Даже самый маленький штраф Гострудинспекции гораздо дороже хорошего справочника

Это настольная книга для каждого работодателя. В ней подробно рассматривается множество вопросов заполнения трудовых книжек, исправления записей, учета трудовых книжек, приводятся образцы записей на самые разные случаи. Если Вы когда-либо встречали более полную книгу по этой теме, сообщите нам, пожалуйста. Мы не встречали.

Материалы книги бесплатно доступны подписчикам журнала «Кадровик-практик» в большой справочной базе >>

Электронный вариант! После оплаты заказчику открывается доступ к книге в электронном виде.

Правила и порядок формирования записи в трудовой книжке о приеме на работу генерального директора организации

Так как генеральный директор по своему трудовому положению мало чем отличается от обычного сотрудника, то и регулирование его приема на работу осуществляется Трудовым кодексом Российской Федерации. Однако в данном регулировании есть свои нюансы, обусловленные занимаемой должностью руководителя организации.

Дорогие читатели! Для решения именно Вашей проблемы — звоните на горячую линию или задайте вопрос на сайте. Это бесплатно.

Так, например, не всегда занятие должности генерального директора происходит на основании простого назначения на должность (например, когда человек «дорос» до нее). В этом случае, кроме Раздела 3 указанного нормативного акта (посвященного механизму заключения трудового договора с работником), для регулирования порядка приема на работу будут использоваться и другие статьи. Если сотрудник был утвержден в должности генерального директора на собрании учредителей либо избран на эту должность, а также назначен на нее, то использованию подлежат статьи 16, 17 и 19 Трудового кодекса.

Процесс заключения трудового договора с руководителем такого уровня полностью отрегулирован в статье 275 указанного кодекса. Но использование данной статьи осуществляется во взаимодействии с Главами 10 и 11 Трудового кодекса.

В частности, именно этот документ говорит о том, кто производит заполнение данного документа, а также какие правовые акты организации следует рассматривать в качестве основания для внесения соответствующих записей в бланк трудовой книжки.

Отличия трудовой книжки генерального директора от трудовых книжек других работников

Основное отличие трудовой книжки генерального директора организации от других работников заключается в механизме заполнения графы 4 данного документа. Это обусловлено тем, что генеральный директор может быть как назначен на свою должность на основании решения соответствующего собрания учредителей (если он сам является учредителем), так и принят на эту должность, например, в случае заполнения такой должности сторонним работником.

Если речь идет о втором варианте, когда на должность генерального директора назначается обычный работник, то механизм заполнения трудовой книжки от аналогичных документов рядовых работников ничем не отличается, так как принимается такой работник на основании специально издаваемых приказов (только подписывает такие приказы уже он сам).

В этом случае сначала указывается информация о протоколе собрания, а потом уже – о приказе о назначении на должность.

В остальном никаких отличий от трудовой книжки простого работника не имеется.

Правила заполнения трудовой книжки

Для заполнения трудовой книжки генерального директора есть некоторые нюансы, которые следует обязательно учитывать при оформлении данного кадрового документа. Выглядят эти нюансы следующим образом:

  • сначала происходит подписание приказа о назначении генерального директора. В том случае, если речь идёт об избрании генерального директора на собрании учредителей организации, то на основании протокола такого собрания сам избранный руководитель вправе подписать данный документ на самого себя. Если же речь идёт о подписании приказа на имя нанимаемого работника, то потребуется поставить подпись того лица, исполняющего обязанности руководителя, который был назначен, например, также на собрании учредителей или решением единственного учредителя;
  • если для трудовой книжки рядового сотрудника используется в качестве основания приема на работу только один документ — приказ о приёме на работу (его реквизиты и указываются в графе 4 сведений о трудовой деятельности работника), то для соответствующего раздела трудовой книжки работника, принимаемого на руководящую должность в организации, существует правило использования в качестве основания минимум двух кадровых документов, одним из которых является протокол собрания учредителей или иного учредительного уставного органа той или иной фирмы;
  • запись о приеме на работу в части формулирования наименования должности должна полностью соответствовать должности главного руководителя организации, как она поименована в Уставе организации или иных приравненных к нему документах.

Соблюдение данных правил, которые одновременно являются и особенностями оформления трудовой книжки генерального директора, позволяют минимизировать риски оспаривания назначения или приема на должность.

Порядок внесения записи

Внесение информации о трудоустройстве генерального директора осуществляется сотрудником кадрового подразделения организации в день издания и подписания приказа о назначении того или иного работника на должность генерального директора. Осуществляется эта процедура следующим образом:

  • сначала подписывается протокол собрания учредителей о назначении работника на должность генерального директора. Использование этого протокола, как уже говорилось выше, дает право такому сотруднику подписать самому на себя приказ о назначении на должность;
  • в качестве следующего шага следует рассматривать подписание трудового договора с таким работником. При этом следует учитывать, что подписываемый договор является срочным и не может превышать по своему действию срок, который указан в Уставе организации относительно срока действия полномочий руководителя;
  • следующим этапом становится подписание приказа о назначении работника на должность генерального директора организации;
  • после этого заполняется должностная инструкция конкретного сотрудника с отражением обязанностей конкретного работника, занимающего должность руководителя организации;
  • на последнем этапе происходит фиксация осуществленного назначения в трудовой книжке работника с его обязательным ознакомлением с произведенной записью в данном документе. Однако в бланке трудовой книжки такой работник не расписывается, а ставит свою подпись на листе ознакомления и визирования в приказе о своем назначении на должность.

Если сотрудник нанят на должность генерального директора, то в его трудовой книжке указывается только информация о том, что он принят на данную должность на основании приказа о принятии на работу. В этом случае подписания протокола собрания учредителей не потребуется, так как в данном документе не будет необходимости. То же самое касается и тех случаев, когда генеральный директор организации и учредитель ее – одно и то же лицо. При осуществлении внесения соответствующей записи в трудовую книжку такого руководителя придется руководствоваться принципами назначения на должность руководителя организации, являющегося единственным учредителем.

Повысьте качество опыта сотрудников – создайте книжный клуб на работе

Если вы хотите создать в своей организации неизменно высокий уровень взаимодействия с сотрудниками (а почему бы и нет?), То поиск способов способствовать личному и профессиональному развитию должен стать неотъемлемой частью часть вашего плана. Создание дополнительного клуба офисной книги – отличный способ побудить сотрудников пробовать что-то новое, улучшать себя и общаться друг с другом.

Недавно мы провели первое заседание книжного клуба в ExactHire и прочитали Radical Candor Ким Скотт.Я давно хотел основать книжный клуб внутри компании, но до сих пор неподходящее время. Однако случайный разговор с коллегой об интересных книгах зажег искру интереса и наш последующий план встретиться один на один, чтобы обсудить нашу первую книгу. Естественно, я прорекламировал эту возможность остальной части нашей небольшой организации и… вуаля! Тяга. Прежде чем я узнал об этом, шестеро из нас были подписаны и готовы читать!

Этот план идеально соответствовал моему собственному новогоднему решению прочитать двадцать шесть книг в 2019 году; однако мне больше нравилось намеренно общаться с коллегами из других отделов и делиться разными взглядами на что-то новое и что-то более универсальное safe .Что я имею в виду под словом «безопасно»? Когда вы можете посмотреть на опыт, успехи и невзгоды других компаний, тогда легче бросить вызов условностям и иметь твердое мнение, потому что это чужая ситуация.

Тем не менее, самое замечательное в книжном клубе, в который люди вносят свой органический вклад, – это то, что вы естественным образом начинаете применять концепции из книг в своей собственной рабочей среде. Обладая внутренним доверием, вы можете подумать о том, что сработало хорошо (а что – нет), а также использовать книгу для ссылки на общую основу для обработки сценариев в будущем.Например, в ExactHire будет легче быть более «радикально откровенными» друг с другом, поскольку многие из нас изучили подход к тому, чтобы делать это вместе.

Почему мы открыли клуб офисной книги в ExactHire

Чтение дает так много преимуществ, например, обретение новых перспектив и улучшение словарного запаса; однако эти основные преимущества умножаются, когда у вас также есть возможность обсуждать книги в комфортной групповой обстановке. Несмотря на то, что пока у нас было только одно обсуждение, я уже вижу внутренние преимущества, такие как выход

  • из творческой колеи, которая может поразить во время постпраздничного мрака, который часто характерен для середины зимы,
  • выход из строя разрозненность коммуникаций путем приглашения к участию членов из всех отделов,
  • чувствуют себя более связанными друг с другом, учитывая, что у нас очень дружелюбная рабочая сила,
  • лучше учитывают перспективы коллег на разных уровнях должности,
  • более высокие показатели участия в разработке, потому что он ориентирован на выбор пользователей с низкими барьерами для входа,
  • дает большему количеству людей возможность высказаться, а
  • дает прекрасную возможность более эффективно практиковаться в слушании.

Как создать собственный книжный клуб для сотрудников

Планируя свой книжный клуб для сотрудников, подумайте о том, как ваша культура повлияет на уровень формальности в ваших обсуждениях, и будете ли вы использовать последовательные вопросы для обсуждения или переключаете их каждый раз. Кроме того, размер вашей организации может определять, имеет ли смысл иметь много межведомственных групп или поддерживать группы, ориентированные на конкретные отделы. ExactHire – небольшая компания, поэтому я расскажу о шагах, которые мы предприняли для создания нашего книжного клуба.

Вызвать интерес и сделать это необязательным

Катализатор для нашего собственного книжного клуба ExactHire начался с разговора; однако ваше может начаться с группового электронного письма, сообщения на канале Slack вашей компании или пункта повестки дня на собрании компании.

Не пишите роман об ожиданиях относительно того, как он будет работать с самого начала (хотя некоторые из вас могут подумать, что мое приглашение ниже довольно длинное), но подчеркните сотрудникам, что клуб не является обязательным и должен быть образовательным и развлекательным.

Придерживайтесь подходящих жанров книг

Дайте людям представление о том, какие типы книг следует ожидать и какие жанры лучше всего подходят для книжного клуба компании. Например, книги о лидерстве, бизнесе, предпринимательстве, профессиональном развитии и даже книги по саморазвитию – все это отличные варианты.

Рекомендую основателям книжного клуба выбрать самую первую книгу. Затем попросите всех участников проголосовать за выбор будущих сессий. Не забывайте, что темы книг должны быть разнообразными, и заставляйте себя читать то, что вы не обязательно поймете самостоятельно – это важный стимул для многих участвовать в клубе, так что они несут ответственность за выход за рамки своих типичных предпочтений в чтении. .

Облегчите участие людей

Компания должна покупать книги (или цифровые издания) для участников. Это нормально – поощрять людей использовать любые существующие неограниченные подписки на электронные книги / аудиокниги, которые у них могут быть, или сначала проверить свою местную библиотеку, но в конечном итоге вложения организации в несколько книг – это небольшая цена, которую нужно заплатить за рентабельность инвестиций в развитие сотрудников. может выиграть.

Мы платим за экземпляры книг нашего книжного клуба и предлагаем дополнительное пособие для сотрудников, которое оплачивает часть подписки сотрудников на неограниченный сервис онлайн-книг в обмен на их обязательство ежеквартально вести блог, вдохновленный книгами.

И помните, что книжный клуб – это пособие для сотрудников. Не забудьте указать это как таковое в предложениях о трудоустройстве и в списке льгот на своем веб-сайте, посвященном карьере.

Сделайте это удобным и доступным

Спланируйте обсуждение в книжном клубе на день, когда в офисе уже много людей. Например, в ExactHire мы планируем, что наш книжный клуб будет сразу же следовать за «Ежемесячным номиналом», во время которого мы все собираемся вместе, чтобы вместе пообедать (или поужинать).Поскольку многие из нас часто работают удаленно, это обычно день месяца, когда в офисе работает больше всего людей (подайте им еду, они придут)! Помните, что день, в который вы планируете свое мероприятие, еще не слишком насыщен другими встречами, и подумайте о том, чтобы подать легкие закуски … или добавку кофеина, если это происходит сразу после еды.

В ExactHire у нас никогда не может быть каждого , доступного для личной встречи, потому что у нас есть товарищи по команде от Юты до Индианы и Германии! Поэтому мы используем Google Meet для видеоконференций с нашими действительно удаленными сотрудниками, чтобы они тоже могли участвовать.Если вам нужно учесть разные часовые пояса, будьте как можно более инклюзивными при планировании времени дня для сессии книжного клуба.

Наконец, тщательно выбирайте частоту ваших обсуждений. Имеет ли смысл встречаться для более коротких дискуссий раз в две недели, чтобы обсудить несколько глав, или более длительных дискуссий, охватывающих всю книгу, ежемесячно или ежеквартально? В нашем книжном клубе мы начинаем ежеквартально и каждый раз обсуждаем всю книгу.

Выполните базовую подготовку к дискуссии

Основатели клуба должны вести первое обсуждение и должны создать редактируемый, совместно используемый документ с идеями для вопросов для обсуждения.Этот документ должен быть виден участникам до встречи. Предложите участникам подбросить идеи для вопросов в документ, так как они тоже будут вдохновлены. Кроме того, напомните людям о мероприятии примерно за неделю, на случай, если кому-то понадобится дополнительный толчок, чтобы закончить всю книгу вовремя.

Включите вопросы о концепциях в книге, но также перечислите вопросы, которые заставят группу потратить время на то, чтобы применить концепции к реальным примерам из вашей организации. Если вам сложно самостоятельно придумывать вопросы, поищите в Интернете заметки и резюме по книге, которую вы читаете, и поищите руководства для обсуждения, которые уже существуют в Интернете, чтобы вам не пришлось изобретать велосипед.Этот подход особенно полезен, если вам назначено вести обсуждение после того, как вы прослушали аудиокнигу во время вождения или тренировки (без возможности делать заметки).

Вот несколько идей для начала.

  • Что вы встретили в этой книге, чего не ожидали, когда впервые проявили к ней интерес?
  • Какие части этой книги вам не понравились?
  • Что вы собираетесь реализовать или сделать по-другому теперь, когда вы прочитали эту книгу?
  • Выберите свой любимый отрывок / рассказ, прочтите его вслух и объясните, почему это важно для вас.
  • Какой у вас был момент «ага» при чтении этой книги?
  • Чего, по вашему мнению, не хватало в книге?
  • Подумайте о концепциях в книге, как мы уже хорошо применили их в нашей собственной организации. Приведите примеры.
  • Какие книжные концепции нам нужно лучше использовать на рабочем месте? Каковы следующие шаги для этого?

После первого мероприятия книжного клуба попросите добровольцев по очереди провести различные будущие занятия.Не заставляйте участвовать, но позвольте людям быть на высоте. Когда люди голосуют за будущие книги в опросе, подумайте о том, чтобы попросить их указать, хотят ли они также вести это обсуждение, если будет выбрана их предлагаемая книга.

«Не навязывайте участие, но позвольте людям быть на высоте».

Поощряйте активное участие

К счастью, привлечь к обсуждению на ExactHire не так уж сложно. Наш первый книжный клуб включал комментарии от всех участников, и во время множества вопросов был здоровый стеб.Конечно, возможно, это произошло потому, что наша первая книга была посвящена откровенности.

Если все ваши участники не так охотно высказываются, наберитесь терпения и сохраняйте вопросы для обсуждения изначально сосредоточенными на концепциях книги, а не на том, как они конкретно применимы к вашему рабочему месту. По мере роста уверенности в группе вы можете обнаружить, что обсуждение естественным образом переходит к тому, как эти концепции могут быть применены на вашем рабочем месте. По мере роста доверия в группе вы увидите, что возникает более инклюзивный и увлекательный разговор.

Включите всех в планирование будущих книг

В конце вашей первой встречи предложите всем отправить предложения по будущим книгам одному человеку, который объединит их в опрос, чтобы люди могли проголосовать за победителя. Этот человек может быть назначенным лидером следующего обсуждения или постоянным руководителем в вашей организации.

Я уже получил ряд интересных книг для нашего следующего обсуждения в апреле, и я воспользуюсь опросом, чтобы позволить сотрудникам составить рейтинг своих фаворитов.Обязательно поделитесь своим опросом со всей компанией для каждой будущей сессии на случай, если разные сотрудники предпочтут участвовать в разное время года. Посещаемость будет зависеть от расписания и интереса к выбранной книге.

Существует множество цифровых инструментов, которые вы можете использовать для коллективного отслеживания книг, представляющих интерес, для будущих обсуждений. Мне нравится собирать идеи из сообщений в Pinterest, из подкастов и блогов. Затем я отслеживаю книги в моем списке «для чтения» с помощью Goodreads – онлайн-сообщества любителей книг.

Приятного чтения!

Хотя эти шаги пока хорошо работают для моей компании, не бойтесь экспериментировать с различными форматами для своего собственного книжного клуба организации. Культура вашей компании, основные ценности и текущие бизнес-задачи направят вас в направлении, которое находит отклик у ваших сотрудников.

Просто не забывайте делать это весело и использовать события как возможность способствовать развитию сотрудников и максимизировать их опыт!

Как преданность своей работе делает нас эксплуатируемыми, истощенными и одинокими: Яффе, Сара: 9781568589398: Amazon.com: Книги

«Озаряет и вдохновляет… Work Won’t Love You Back – в конечном счете, оптимистическая книга. Яффе хорошо осведомлена обо всех способах использования работодателями доброй воли работников, но, поскольку она потратила так много времени на репортажи о трудовых действиях по всему миру, она также увидела, как работники используют любовь в своих интересах при организации ». – New Republic

«Чрезвычайно своевременный анализ того, как мы пришли к этому жестокому неравенству, и некоторых способов, которыми намеренно раздробленная рабочая сила начинает организовываться, чтобы бросить им вызов.»- The Guardian

« Книга также является амбициозной структурой, объединяя эссе по очень специфическим отраслям, таким как работа по дому, обучение, розничная торговля, некоммерческие организации, искусство, академические науки, технологии, спорт и, в частности, стажеры. поскольку это повествовательный подвиг… Самые яркие моменты в творчестве Джеффа проявляются в ее резком переопределении банальных идей. На страницах есть несколько таких блестящих предложений: «Короче говоря, труд любви – это обман»; «Благотворительность – это властные отношения»; и «программирование, область, в которой в настоящее время преобладают молодые мужчины, изобрела женщина», и это лишь некоторые из них.»- The Progressive

« Джаффе и рабочие, с которыми она беседует, помогают нам разобраться в путанице эмоций, которые многие из нас испытывают в своей профессиональной жизни; когда стираются границы между работой и игрой, как проницательно объясняет и исторически Джеффе для нас, это просто беспорядочный клубок эмоций, связанных с нашей жизнью, точка. Заключительная глава Work Won’t Love You Back – это одновременно блестящий вклад в растущий канон антирабочей политической теории и трогательная ода человеческим связям.»- The Baffler

« Проза четкая и навязчиво читаемая… очень увлекательная работа ».
Indypendent

«Важное и своевременное напоминание о значении работы» – Los Angeles Review of Books

«Разрушая миф о том, что работа – это любовь, Джефф показывает нам, что мы может переосмыслить будущее, построенное на заботе, а не на эксплуатации ». – Наоми Кляйн, автор книги« В огне: горящие дела для зеленого нового курса »

« Посвященный Джаффе участие на местах, исторический диапазон и свирепое собрание революционной мысли объединяется, чтобы создать нечто подлинное и глубокое.. . . Эта книга – подарок читателю и возможному будущему ». – Джорди Розенберг, автор книги« Признания лисы »

« Чудесно ясная, хорошо читаемая и чудесно увлекательная »- Кэти Уикс, автор книги «Проблема с работой: феминизм, марксизм, политика антиработа и воображение постворка»

«Годы трудового репортера Сары Джаффе позволили ей увидеть передовые позиции, на которые другие не могли взглянуть. Книга редкой важности.»- Радж Патель, автор книги« Чучела и голод: Скрытая битва за мировую продовольственную систему »

« Мультиплекс в натюрмортах; ошеломляющая критика капитализма, коллективный разговор о смысле жизни и работы, а также проницательный вклад в потребности общества будущего, которого каждый заслуживает ». – Джейн МакАлеви, автор книги« Коллективная сделка: союзы, организация и Борьба за демократию

«Очень необходимое вмешательство в плохие отношения: наша занятость.Неолиберализм рушится, и вы не найдете лучшего руководства, которое поможет отсеять обломки, чем эта книга »- Грег Грандин, профессор истории К. Ванн Вудворд, Йельский университет

« Великолепное развенчание мифа. работы ради любви и призыв к оружию для рабочих вкладывать свою любовь и солидарность не в свою работу, а друг в друга »- Молли Крэбэппл, художница и автор книги« Рисование крови »и соавтор книги« Братья по оружию »

«Незаменимое дополнение к трудовой журналистике, истории труда и, в более широком смысле, к нашему пониманию того, как выглядит – и могло бы выглядеть сопротивление – в эти трудные времена.»- Дэйв Зирин, автор книги« Народная история спорта в США »

« Нахальный и великодушный, образованный и проницательный. … Потрясающее достижение ». – Эйлин Борис, профессор Халла феминистских исследований, Калифорнийский университет, Санта-Барбара

« Work Won’t Love You Back заставил меня полностью переосмыслить мое отношение к тому, как я работаю. Прочтите, и это изменит и вас ». – Дэвид Дайен, автор книги« Цепи титулов и монополизация »

« В нем подробно рассказывается о том, как диаграммы Венна в нашей работе и жизни были преобразованы в нечто большее. как один круг, и предлагает ключи к разгадке того, как мы можем это изменить.Это очень своевременно ». – Прогрессивный популист

Сара Джаффе – научный сотрудник Type Media Center и независимый журналист, освещающий политику власти, от рабочего места до улицы. Она является автором Необходимые проблемы: американцы в восстании , и ее работа появилась в New York Times , Nation , Guardian , Washington Post , New Republic , American Prospect, и многие другие публикации.Вместе с Мишель Чен она является ведущей подкаста Belabored журнала Dissent , а также обозревателем The Progressive и New Labor Forum .

Клинические характеристики 138 госпитализированных пациентов с пневмонией, инфицированной новым коронавирусом 2019 г., в Ухане, Китай | Реанимационная медицина | JAMA

Ключевые моменты

Вопрос Каковы клинические характеристики госпитализированных пациентов с пневмонией, инфицированной новым коронавирусом (2019-nCoV) 2019 г., в Ухане, Китай?

Выводы В этой одноцентровой серии случаев с участием 138 пациентов с NCIP 26% пациентов требовали госпитализации в отделение интенсивной терапии и 4 пациента.3% умерли. Предполагаемая передача 2019-nCoV от человека человеку в больнице подозревалась у 41% пациентов.

Значение В этой серии случаев в Ухане, Китай, NCIP часто ассоциировался с предполагаемой передачей в больнице, 26% пациентов нуждались в лечении в отделении интенсивной терапии, а смертность составила 4,3%.

Важность В декабре 2019 года в Ухане, Китай, произошла пневмония, инфицированная новым коронавирусом (2019-nCoV).Число случаев быстро увеличивалось, но информация о клинических характеристиках больных ограничена.

Цель Описать эпидемиологические и клинические характеристики NCIP.

Дизайн, обстановка и участники Ретроспективная одноцентровая серия случаев 138 последовательных госпитализированных пациентов с подтвержденным NCIP в больнице Чжуннань Уханьского университета в Ухане, Китай, с 1 по 28 января 2020 г .; окончательная дата наблюдения – 3 февраля 2020 г.

Экспозиции Документировано NCIP.

Основные результаты и мероприятия Были собраны и проанализированы эпидемиологические, демографические, клинические, лабораторные, радиологические и лечебные данные. Сравнивались исходы пациентов в критическом и некритическом состоянии. Предполагаемая передача в больнице подозревалась, если заразилась группа медицинских работников или госпитализированных пациентов в одних и тех же палатах, и можно было отследить возможный источник инфекции.

Результаты Из 138 госпитализированных пациентов с NCIP средний возраст составлял 56 лет (межквартильный размах 42-68; диапазон 22-92 года) и 75 (54,3%) были мужчинами. Связанная с больницей передача подозревалась как предполагаемый механизм инфекции для затронутых медицинских работников (40 [29%]) и госпитализированных пациентов (17 [12,3%]). Общие симптомы включали жар (136 [98,6%]), усталость (96 [69,6%]) и сухой кашель (82 [59,4%]). Лимфопения (количество лимфоцитов 0,8 × 10 9 / л [межквартильный размах {IQR}, 0.6-1.1]) наблюдалось у 97 пациентов (70,3%), увеличенное протромбиновое время (13,0 секунды [IQR, 12,3-13,7]) – у 80 пациентов (58%) и повышенное содержание лактатдегидрогеназы (261 Ед / л [IQR, 182- 403]) у 55 пациентов (39,9%). Компьютерная томография грудной клетки показала двусторонние пятнистые тени или матовое стекло в легких у всех пациентов. Большинство пациентов получали противовирусную терапию (осельтамивир, 124 [89,9%]), и многие получали антибактериальную терапию (моксифлоксацин, 89 [64,4%], цефтриаксон, 34 [24,6%], азитромицин, 25 [18.1%]) и глюкокортикоидной терапии (62 [44,9%]). Тридцать шесть пациентов (26,1%) были переведены в отделение интенсивной терапии (ОИТ) из-за осложнений, включая синдром острого респираторного дистресс-синдрома (22 [61,1%]), аритмию (16 [44,4%]) и шок (11 [30,6%]). %]). Среднее время от появления первых симптомов до одышки составляло 5,0 дней, до госпитализации – 7,0 дней и до ОРДС – 8,0 дней. Пациенты, проходившие лечение в отделении интенсивной терапии (n = 36), по сравнению с пациентами, не проходившими лечение в отделении интенсивной терапии (n = 102), были старше (средний возраст 66 лет против 51 года), с большей вероятностью имели сопутствующие заболевания (26 [72.2%] против 38 [37,3%]), и у них чаще была одышка (23 [63,9%] против 20 [19,6%]) и анорексия (24 [66,7%] против 31 [30,4%]). Из 36 пациентов в отделении интенсивной терапии 4 (11,1%) получали высокопоточную кислородную терапию, 15 (41,7%) получали неинвазивную вентиляцию и 17 (47,2%) получали инвазивную вентиляцию (4 были переведены на экстракорпоральную мембранную оксигенацию). По состоянию на 3 февраля 47 пациентов (34,1%) были выписаны и 6 умерли (общая летальность 4,3%), но остальные пациенты все еще госпитализированы. Среди выписанных живыми (n = 47) средняя продолжительность пребывания в больнице составила 10 дней (IQR, 7.0-14,0).

Выводы и значимость В этой одноцентровой серии случаев из 138 госпитализированных пациентов с подтвержденным NCIP в Ухане, Китай, предполагаемая госпитальная передача 2019-nCoV подозревалась у 41% пациентов, 26% пациентов получали помощь в отделении интенсивной терапии, а смертность составила 4,3%.

Quiz Ref ID В декабре 2019 года в Ухане, провинция Хубэй, Китай, произошел кластер острых респираторных заболеваний, ныне известных как пневмония, инфицированная новым коронавирусом (NCIP). 1 -5 Болезнь быстро распространилась из Ухани в другие районы. По состоянию на 31 января 2020 года в Китае подтверждено 9692 случая заболевания NCIP. На международном уровне случаи заболевания зарегистрированы в 24 странах и 5 континентах. 6 3 января 2020 года новый коронавирус 2019 года (2019-nCoV) был идентифицирован в образцах жидкости бронхоальвеолярного лаважа от пациента из Ухани и был подтвержден как причина NCIP. 7 Полногеномное секвенирование и филогенный анализ показали, что 2019-nCoV отличается от бета-коронавирусов, связанных с тяжелым острым респираторным синдромом (SARS) и ближневосточным респираторным синдромом (MERS) у человека. 7 2019-nCoV имеет черты, типичные для семейства коронавирусов, и был отнесен к линии бета-коронавируса 2b. 2019-nCoV очень похож на коронавирусы летучих мышей, и было высказано предположение, что летучие мыши являются основным источником. Хотя происхождение 2019-nCoV все еще исследуется, имеющиеся данные свидетельствуют о том, что его распространение среди людей произошло через передачу от диких животных, незаконно продаваемых на оптовом рынке морепродуктов Хуанани. 8

Хуанг и др. 9 впервые сообщили о 41 случае NCIP, в котором большинство пациентов в анамнезе контактировали с оптовым рынком морепродуктов Хуанань.Клинические проявления пациентов включали лихорадку, непродуктивный кашель, одышку, миалгию, утомляемость, нормальное или пониженное количество лейкоцитов и рентгенологические признаки пневмонии. В тяжелых случаях может наступить дисфункция органов (например, шок, острый респираторный дистресс-синдром [ОРДС], острое повреждение сердца и острое повреждение почек) и смерть. 9 Впоследствии Чен и др. 8 сообщили о результатах 99 случаев NCIP в той же больнице, и результаты показали, что инфекция 2019-nCoV, сгруппированная в группах людей, находящихся в тесном контакте, с большей вероятностью поражала пожилых мужчин с сопутствующими заболеваниями. , и может привести к ОРДС.Однако о различиях в клинических характеристиках тяжелых и нетяжелых случаев не сообщалось. Отчеты о случаях подтвердили передачу NCIP от человека к человеку. 10 , 11 В настоящее время нет эффективных методов лечения или вакцин против NCIP. Цель этой серии случаев состояла в том, чтобы описать клинические характеристики 138 госпитализированных пациентов с NCIP и сравнить тяжелые случаи, которые получали лечение в отделении интенсивной терапии (ICU), с нетяжелыми случаями, которые не получали помощь ICU.

Дизайн исследования и участники

Quiz Ref ID Эта серия случаев была одобрена институциональным советом по этике больницы Чжуннань Уханьского университета (№ 2020020). Были зачислены все последовательные пациенты с подтвержденным NCIP, госпитализированные в больницу Чжуннань Уханьского университета с 1 по 28 января 2020 г.Устное согласие было получено от пациентов. Больница Чжуннань, расположенная в Ухане, провинция Хубэй, эндемичных районах NCIP, является одной из основных больниц третичного уровня обучения и отвечает за лечение для NCIP, назначенное правительством. Всем пациентам с NCIP, включенным в это исследование, был поставлен диагноз в соответствии с временными рекомендациями Всемирной организации здравоохранения. 12 Клинические исходы (т.е. выписки, смертность, продолжительность пребывания) отслеживались до 3 февраля 2020 г., последней даты наблюдения.

Медицинские карты пациентов были проанализированы исследовательской группой отделения реанимации больницы Чжуннань Уханьского университета. Эпидемиологические, клинические, лабораторные и радиологические характеристики, а также данные о лечении и исходах были получены с помощью форм для сбора данных из электронных медицинских карт. Данные были проанализированы обученной командой врачей. Записанная информация включала демографические данные, историю болезни, историю воздействия, сопутствующие заболевания, симптомы, признаки, лабораторные данные, компьютерную томографию (КТ) грудной клетки и меры лечения (например, противовирусную терапию, кортикостероидную терапию, респираторную поддержку, заместительную почечную терапию).Датой начала заболевания считали день, когда был замечен симптом. Были собраны симптомы, признаки, лабораторные показатели, компьютерная томография грудной клетки и меры лечения во время пребывания в больнице. ОРДС был определен в соответствии с берлинским определением. 13 Острое повреждение почек было идентифицировано в соответствии с определением «Болезнь почек: улучшение глобальных результатов». 14 Поражение сердца определялось, если уровни сердечных биомаркеров (например, тропонина I) в сыворотке крови превышали верхний референсный предел 99-го перцентиля или при электрокардиографии и эхокардиографии были обнаружены новые отклонения от нормы. 9 Для пациентов, поступивших в отделение интенсивной терапии, в день поступления в отделение интенсивной терапии определялись баллы по шкале комы Глазго, оценке последовательной органной недостаточности и оценке острой физиологии и хронического здоровья. Регистрировали продолжительность от начала заболевания до госпитализации, одышки, ОРДС и поступления в ОИТ.

Предполагаемая передача инфекции в больнице подозревалась, если в течение определенного периода времени заразилась группа медицинских работников или госпитализированных пациентов в одних и тех же палатах, и возможный источник инфекции можно было отследить.

Анализ полимеразной цепной реакции с обратной транскрипцией в реальном времени для nCoV

Было собрано

образцов мазка из горла для извлечения РНК 2019-nCoV у пациентов с подозрением на инфекцию 2019-nCoV. После сбора мазки из зева помещали в пробирку для сбора с 150 мкл раствора для защиты от вирусов, и общую РНК экстрагировали в течение 2 часов с использованием набора для выделения РНК из респираторного образца (Zhongzhi, Wuhan, China).Вкратце, 40 мкл клеточных лизатов переносили в пробирку для сбора с последующим перемешиванием на вортексе в течение 10 секунд. После стояния при комнатной температуре в течение 10 минут пробирку для сбора центрифугировали при 1000 об / мин в течение 5 минут. Суспензию использовали для анализа РНК 2019-nCoV с помощью полимеразной цепной реакции с обратной транскрипцией (ОТ-ПЦР). Два гена-мишени, включая открытую рамку считывания 1ab ( ORF1ab ) и белок нуклеокапсида (N), были одновременно амплифицированы и протестированы в ходе анализа ОТ-ПЦР в реальном времени.Мишень 1 ( ORF1ab ): прямой праймер CCCTGTGGGTTTTACACTTAA; обратный праймер ACGATTGTGCATCAGCTGA; и зонд 5′-VIC-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3 ‘. Мишень 2 (N): прямой праймер GGGGAACTTCTCCTGCTAGAAT; обратный праймер CAGACATTTTGCTCTCAAGCTG; и зонд 5’-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3 ‘. Анализ ОТ-ПЦР в реальном времени выполняли с использованием набора для обнаружения нуклеиновых кислот 2019-nCoV в соответствии с протоколом производителя (Shanghai bio-germ Medical Technology Co Ltd). Реакционная смесь содержит 12 мкл реакционного буфера, 4 мкл раствора фермента, 4 мкл раствора праймеров для зонда, 3 мкл воды, обработанной диэтилпирокарбонатом, и 2 мкл матрицы РНК.Анализ ОТ-ПЦР выполняли в следующих условиях: инкубация при 50 ° C в течение 15 минут и 95 ° C в течение 5 минут, 40 циклов денатурации при 94 ° C в течение 15 секунд и увеличение и сбор сигнала флуоресценции при 55 ° C в течение 45 секунд. Пороговое значение цикла (значение Ct) менее 37 было определено как положительный результат теста, а значение Ct 40 или более было определено как отрицательный результат теста. Эти диагностические критерии были основаны на рекомендации Национального института по контролю и профилактике вирусных заболеваний (Китай) (http: // ivdc.chinacdc.cn/kyjz/202001/t20200121_211337.html). Средняя нагрузка, определяемая как значение Ct от 37 до менее 40, требовала подтверждения повторным тестированием.

Категориальные переменные были описаны как частота и проценты, а непрерывные переменные были описаны с использованием значений среднего, медианного и межквартильного диапазона (IQR). Средние значения для непрерывных переменных сравнивались с использованием независимой группы тестов t , когда данные были нормально распределены; в противном случае использовали тест Манна-Уитни.Данные (ненормальное распределение) от повторных измерений сравнивались с использованием обобщенной линейной смешанной модели. Пропорции категориальных переменных сравнивались с использованием критерия χ 2 , хотя точный критерий Фишера использовался, когда данные были ограничены. Все статистические анализы были выполнены с использованием программного обеспечения SPSS (Статистический пакет для социальных наук) версии 13.0 (SPSS Inc). Для нескорректированных сравнений двусторонний α менее 0,05 считался статистически значимым. Анализы не корректировались для множественных сравнений, и, учитывая возможность ошибки типа I, результаты следует интерпретировать как исследовательские и описательные.

Представление характеристик

В исследуемую популяцию вошли 138 госпитализированных пациентов с подтвержденным NCIP. Средний возраст составлял 56 лет (IQR, 42-68; диапазон, 22-92 года), и 75 (54,3%) были мужчинами. Из них 102 (73,9%) были помещены в изоляторы, 36 (26.1%) поступили и переведены в ОИТ из-за развития органной дисфункции (таблица 1). Средняя продолжительность от первых симптомов до одышки, госпитализации и ОРДС составляла 5 дней (IQR, 1-10), 7 дней (IQR, 4-8) и 8 дней (IQR, 6-12), соответственно (Таблица 1 ). Из 138 пациентов 64 (46,4%) имели одно или более сопутствующих заболеваний. Гипертония (43 [31,2%]), диабет (14 [10,1%]), сердечно-сосудистые заболевания (20 [14,5%]) и злокачественные новообразования (10 [7,2%]) были наиболее частыми сопутствующими состояниями.

Наиболее частыми симптомами в начале болезни были лихорадка (136 [98,6%]), усталость (96 [69,6%]), сухой кашель (82 [59,4%]), миалгия (48 [34,8%]) и одышка ( 43 [31,2%]). Менее распространенными симптомами были головная боль, головокружение, боль в животе, диарея, тошнота и рвота (Таблица 1). В общей сложности 14 пациентов (10,1%) первоначально поступили с диареей и тошнотой за 1-2 дня до развития лихорадки и одышки.

По сравнению с пациентами, которые не получали помощь в ОИТ (n = 102), пациенты, которым требовалась помощь в ОИТ (n = 36), были значительно старше (средний возраст 66 лет [IQR, 57-78] по сравнению с 51 годом [IQR, 37- 62]; P <.001) и чаще имели сопутствующие заболевания, включая артериальную гипертензию (21 [58,3%] против 22 [21,6%], диабет (8 [22,2%] против 6 [5,9%])), сердечно-сосудистые заболевания (9 [25,0%] против 11 [10,8%]) и цереброваскулярных заболеваний (6 [16,7%] против 1 [1,0%]). По сравнению с пациентами, не получавшими ОИТ, пациенты, поступившие в ОИТ, чаще жаловались на боль в глотке, одышку, головокружение, брюшную полость. боль и анорексия.

Показатели жизнедеятельности и лабораторные параметры у пациентов в отделениях интенсивной терапии и не в отделениях интенсивной терапии

Частота сердечных сокращений, частота дыхания и среднее артериальное давление не различались между пациентами, которые получали помощь в отделении интенсивной терапии, и пациентами, которые не получали помощь в отделении интенсивной терапии.Эти показатели регистрировались в день поступления в больницу для всех пациентов, а затем разделялись на тех, кто позже был помещен в отделение интенсивной терапии или нет. Были обнаружены многочисленные различия в лабораторных результатах между пациентами, поступившими в отделение интенсивной терапии, и теми, кто не поступил в отделение интенсивной терапии (таблица 2), включая более высокие уровни лейкоцитов и нейтрофилов, а также более высокие уровни D-димера, креатинкиназы и креатина. Все 138 включенных пациентов показали двустороннее поражение при КТ грудной клетки (рис. 1). Среднее время от появления симптомов до поступления в ОИТ составляло 10 дней (IQR, 6–12) (Таблица 3).В день поступления в ОИТ – медиана шкалы комы Глазго; Острая физиология и оценка хронического здоровья II; и оценка последовательной органной недостаточности составила 15 (IQR, 9-15), 17 (IQR, 10-22) и 5 ​​(IQR, 3-6), соответственно (Таблица 3). Среднее парциальное давление уровня кислорода составляло 68 мм рт. Ст. (IQR, 56–89), а медиана отношения парциального давления кислорода к фракции вдыхаемого кислорода составляла 136 мм рт.

Дисфункции органов и основные вмешательства

Дисфункция органов и лечение 138 пациентов показаны в таблице 4.По состоянию на 3 февраля 2020 года 85 пациентов (61,6%) все еще были госпитализированы. Выписаны 47 пациентов (34,1%), 6 пациентов (4,3%) умерли. Из 36 пациентов, поступивших в отделение интенсивной терапии, 11 все еще находились в отделении интенсивной терапии, 9 были выписаны домой, 10 переведены в общие палаты и 6 умерли. Из 11 пациентов, оставшихся в отделении интенсивной терапии, 6 получали инвазивную вентиляцию легких (1 перешел на экстракорпоральную мембранную оксигенацию) и 5 ​​- на неинвазивную вентиляцию легких). Среди 138 пациентов частыми осложнениями был шок (12 [8.7%]), ОРДС (27 [19,6%]), аритмии (23 [16,7%]) и острого сердечного повреждения (10 [7,2%]). Пациенты, которые получали лечение в отделении интенсивной терапии, имели больше шансов иметь одно из этих осложнений, чем пациенты, не находящиеся в отделении интенсивной терапии.

Большинство пациентов получали противовирусную терапию (осельтамивир, 124 [89,9%]), и многие получали антибактериальную терапию (моксифлоксацин, 89 [64,4%]; цефтриаксон, 34 [24,6%]; азитромицин, 25 [18,1%]) и терапию глюкокортикоидами ( 62 [44,9%]). В отделении интенсивной терапии 4 пациента (11,1%) получали высокопоточный кислород, а 15 (44.4%) получали неинвазивную вентиляцию легких. Инвазивная механическая вентиляция легких потребовалась 17 пациентам (47,2%), 4 из которых получали экстракорпоральную мембранную оксигенацию в качестве неотложной терапии. В общей сложности 13 пациентов получали вазопрессоры, а 2 пациента получали заместительную почечную терапию.

Динамический профиль лабораторных данных у пациентов с NCIP

Для определения основных клинических признаков, которые проявлялись во время прогрессирования NCIP, динамические изменения 6 клинических лабораторных параметров, включая гематологические и биохимические параметры, отслеживались с 1 по 19 день после начала заболевания с двухдневными интервалами.В конце 28 января 2020 г. были проанализированы данные 33 пациентов с полным клиническим течением (рис. 2). Во время госпитализации у большинства пациентов наблюдалась выраженная лимфопения, а у не выживших со временем развивалась более тяжелая лимфопения. Количество лейкоцитов и нейтрофилов у не выживших было выше, чем у выживших. Уровень D-димера был выше у выживших, чем у выживших. Точно так же по мере прогрессирования заболевания и ухудшения клинического статуса уровни мочевины и креатинина в крови прогрессивно повышались перед смертью.

Предполагаемая передача и инфекция в больнице

Из 138 пациентов 57 (41,3%) предположительно были инфицированы в больнице, в том числе 17 пациентов (12,3%), которые уже были госпитализированы по другим причинам, и 40 медицинских работников (29%). Из госпитализированных пациентов 7 пациентов были из хирургического отделения, 5 – из терапевтического и 5 – из онкологического.Из инфицированных медицинских работников 31 (77,5%) работали в палатах общего профиля, 7 (17,5%) – в отделении неотложной помощи и 2 (5%) – в отделении интенсивной терапии. У одного пациента в текущем исследовании появились абдоминальные симптомы, и он был госпитализирован в хирургическое отделение. Предположительно, более 10 медицинских работников в этом отделении заразились этим пациентом. Также предполагалось, что произошла передача инфекции от пациента к пациенту, и по крайней мере 4 госпитализированных пациента в одной палате были инфицированы, и у всех были выявлены атипичные абдоминальные симптомы.У одного из 4 пациентов была лихорадка, и во время госпитализации у него была диагностирована инфекция nCoV. Затем пациент был изолирован. Впоследствии у других 3 пациентов в том же отделении поднялась температура, появились абдоминальные симптомы, и им был поставлен диагноз инфекции nCoV.

Quiz Ref ID Этот отчет, насколько нам известно, представляет собой крупнейшую на сегодняшний день серию случаев госпитализированных пациентов с NCIP. По состоянию на 3 февраля 2020 года из 138 пациентов, включенных в это исследование, 26% нуждались в отделении интенсивной терапии, 34.1% были выписаны, 6 умерли (4,3%), 61,6% остаются госпитализированными. Для выписанных (n = 47) пребывание в стационаре составило 10 дней (IQR, 7,0–14,0). Время от появления одышки составляло 5,0 дней, 7,0 дней до госпитализации и 8,0 дней до ОРДС. Обычными симптомами в начале болезни были лихорадка, сухой кашель, миалгия, утомляемость, одышка и анорексия. Однако у значительной части пациентов изначально наблюдались атипичные симптомы, такие как диарея и тошнота. Основные осложнения во время госпитализации включали ОРДС, аритмию и шок.Двустороннее распределение пятнистых теней и непрозрачность матового стекла были типичным признаком компьютерной томографии для NCIP. Большинство пациентов в критическом состоянии были старше и имели больше сопутствующих заболеваний, чем пациенты, не госпитализированные в отделение интенсивной терапии. Большинству пациентов требовалась кислородная терапия, а меньшинство пациентов нуждались в инвазивной вентиляции или даже экстракорпоральной мембранной оксигенации.

Quiz Ref ID Данные этого исследования свидетельствуют о возможности быстрой передачи вируса 2019-nCoV от человека к человеку. Основная причина заключается в оценке основного репродуктивного числа (R 0 ) на основе предыдущего исследования. 15 R 0 указывает, насколько заразно инфекционное заболевание. Когда инфекция распространяется среди новых людей, она воспроизводится; R 0 указывает среднее количество дополнительных лиц, которых заражает один больной в течение его болезни, и конкретно относится к группе людей, которые ранее не были инфицированы и не были вакцинированы. Согласно отчету, R 0 от nCoV составляет 2,2, что означает, что в среднем каждый пациент распространял инфекцию на 2.2 других человека. 15 Одна из причин быстрого распространения может быть связана с нетипичными симптомами на ранней стадии у некоторых пациентов, инфицированных nCoV.

Недавнее исследование показало, что нКоВ был обнаружен в образцах стула пациентов с абдоминальными симптомами. 16 Однако трудно дифференцировать и обследовать пациентов с атипичными симптомами. Тем не менее, быстрая передача от человека к человеку среди близких контактов является важной особенностью пневмонии nCoV. 10 , 11,15

Пациенты, госпитализированные в отделение интенсивной терапии, были старше и имели большее количество сопутствующих заболеваний, чем пациенты, не госпитализированные в отделение интенсивной терапии. Это говорит о том, что возраст и сопутствующие заболевания могут быть факторами риска неблагоприятного исхода. Однако не было никакой разницы в доле мужчин и женщин между пациентами ОИТ и пациентами, не получавшими ОИТ. Эти данные отличаются от недавнего отчета, который показал, что инфекция 2019-nCoV чаще поражает мужчин. 8 Возможное объяснение состоит в том, что инфекция nCoV у пациентов в предыдущем отчете была связана с воздействием, связанным с оптовым рынком морепродуктов Хуанань, и большинство пострадавших пациентов были работниками-мужчинами.По сравнению с симптомами у пациентов, не находящихся в отделении интенсивной терапии, симптомы чаще встречались у пациентов в критическом состоянии, включая одышку, боль в животе и анорексию. Появление симптомов может помочь врачам идентифицировать пациентов с плохим прогнозом. В этой когорте общие показатели тяжелой гипоксии и инвазивной вентиляции были выше, чем в предыдущем исследовании, 9 , вероятно, потому что случаи в предыдущем исследовании относились к ранней эпидемической стадии NCIP, а текущие случаи – из стадия вспышки.

Наиболее частыми лабораторными отклонениями, наблюдаемыми в этом исследовании, были пониженное количество лимфоцитов, увеличенное протромбиновое время и повышенная лактатдегидрогеназа. По сравнению с пациентами, не входящими в ОИТ, пациенты, которые получали лечение в ОИТ, имели многочисленные лабораторные отклонения. Эти отклонения предполагают, что инфекция 2019-nCoV может быть связана с клеточным иммунодефицитом, активацией коагуляции, повреждением миокарда, повреждением печени и почек. Эти лабораторные отклонения аналогичны тем, которые ранее наблюдались у пациентов с инфекцией БВРС-КоВ и ТОРС-КоВ.

Динамический профиль лабораторных данных отслеживался у 33 пациентов с NCIP (5 выживших и 28 выживших). У не выживших количество нейтрофилов, D-димер, уровни мочевины в крови и креатинина продолжали расти, а количество лимфоцитов продолжало снижаться до наступления смерти. Нейтрофилия может быть связана с цитокиновым штормом, вызванным вирусной инвазией, активация коагуляции могла быть связана с устойчивым воспалительным ответом, а острое повреждение почек могло быть связано с прямым воздействием вируса, гипоксией и шоком.Три патологических механизма могут быть связаны со смертью пациентов с NCIP.

Quiz Ref ID До настоящего времени не рекомендовалось никакого специального лечения коронавирусной инфекции, кроме тщательной поддерживающей терапии. 17 В настоящее время подход к этой болезни заключается в борьбе с источником инфекции; использование мер индивидуальной защиты для снижения риска передачи; и ранняя диагностика, изоляция и поддерживающее лечение пораженных пациентов. Антибактериальные средства неэффективны.Кроме того, не было обнаружено, что противовирусные агенты приносят пользу при лечении SARS и MERS. Все пациенты в этом исследовании получали антибактериальные препараты, 90% получали противовирусную терапию и 45% получали метилпреднизолон. Доза осельтамивира и метилпреднизолона варьировалась в зависимости от тяжести заболевания. Однако никаких эффективных результатов не наблюдалось.

Это исследование имеет несколько ограничений. Во-первых, образцы дыхательных путей были использованы для диагностики NCIP с помощью RT-PCR.Сыворотка пациентов для оценки виремии не бралась. Вирусная нагрузка является потенциально полезным маркером, связанным с тяжестью заболевания коронавирусной инфекцией, и ее следует определять в NCIP. Во-вторых, передача / инфекция в больницах не могла быть окончательно доказана, но предполагалась и предполагалась на основании времени и характера контакта с инфицированными пациентами и последующего развития инфекции. В-третьих, из 138 случаев большинство пациентов все еще госпитализированы на момент подачи рукописи.Следовательно, трудно оценить факторы риска неблагоприятного исхода, и необходимы постоянные наблюдения за естественным течением болезни.

В этой одноцентровой серии случаев из 138 госпитализированных пациентов с подтвержденным NCIP в Ухане, Китай, предполагаемая госпитальная передача 2019-nCoV подозревалась у 41% пациентов, 26% пациентов получали помощь в отделении интенсивной терапии, а смертность составила 4,3%. .

Авторы, отвечающие за переписку: Чжиюн Пэн, доктор медицины, отделение интенсивной терапии (pengzy5 @ hotmail.com) и Синхуан Ван, доктор медицины, отделение урологии ([email protected]), больница Чжуннань Уханьского университета, Ухань 430071, Хубэй, Китай.

Принято к публикации: 3 февраля 2020 г.

Опубликовано в Интернете: 7 февраля 2020 г. doi: 10.1001 / jama.2020.1585

Исправление: Эта статья была исправлена ​​20 февраля 2020 г., чтобы добавить правильные данные для пациенток в Таблице 1.

Вклад авторов: Доктора Д.Ван и Пэн имели полный доступ ко всем данным в исследовании и несли ответственность за целостность данных и точность анализа данных. Доктора Д. Ван и Б. Ху внесли равный вклад и имеют первое авторство. Доктора Пэн и X. Ван внесли равный вклад в эту статью.

Концепция и дизайн: D. Wang, B. Hu, C. Hu, Xiong, Zhao, Li, X. Wang, Peng.

Сбор, анализ или интерпретация данных: Д. Ван, К. Ху, Чжу, Лю, Чжан, Б. Ван, Сян, Чэн, Сюн, Пэн.

Составление рукописи: Д. Ван, К. Ху, Сян, Сюн, Ли, Пэн.

Критический пересмотр рукописи на предмет важного интеллектуального содержания: Д. Ван, Б. Ху, Чжу, Лю, Чжан, Б. Ван, Чэн, Сюн, Чжао, X. Ван, Пэн.

Статистический анализ: К. Ху, Чжу, Лю, Б. Ван, Сюн.

Получено финансирование: Д. Ван, Пэн.

Административная, техническая или материальная поддержка: B. Hu, Xiang, Cheng, Xiong, Li, X.Ван.

Наблюдение: Б. Ху, Сюн, Чжао, X. Ван, Пэн.

Раскрытие информации о конфликте интересов: Не сообщалось.

Финансирование / поддержка: Эта работа была поддержана Национальным фондом естественных наук (грант 81701941 доктору Д. Вангу; гранты 81772046 и 81971816 доктору Пэну) и Специальным проектом по значительным исследованиям и разработкам новых лекарственных средств в крупном национальном масштабе. Научно-технические проекты Китая (2020ZX09201007 доктору Пэну).

Роль спонсора / спонсора: Спонсоры не играли никакой роли в разработке и проведении исследования; сбор, управление, анализ и интерпретация данных; подготовка, рецензирование или утверждение рукописи; и решение представить рукопись для публикации.

1.Lu H, Страттон CW, Тан YW. Вспышка пневмонии неизвестной этиологии в Ухане, Китай: тайна и чудо [опубликовано 16 января 2020 г.]. J Med Virol . 2020. doi: 10.1002 / jmv.25678PubMedGoogle Scholar2.Hui DS, я Азхар Э, Мадани TA, и другие. Сохраняющаяся угроза эпидемии нового коронавируса 2019-nCoV для глобального здравоохранения: последняя вспышка нового коронавируса 2019 года в Ухане, Китай [опубликовано 14 января 2020 г.]. Int J Infect Dis . 2020; 91: 264-266. DOI: 10.1016 / j.ijid.2020.01.009PubMedGoogle ScholarCrossref 7.Zhu Н, Чжан Д, Ван W, и другие; Китайская группа по расследованию и исследованию нового коронавируса.Новый коронавирус от пациентов с пневмонией в Китае, 2019 г. [опубликовано 24 января 2020 г.]. N Engl J Med . DOI: 10.1056 / NEJMoa2001017PubMedGoogle Scholar8.Chen Н, Чжоу М, Донг ИКС, и другие. Эпидемиологические и клинические характеристики 99 случаев новой коронавирусной пневмонии 2019 г. в Ухане, Китай: описательное исследование [опубликовано 29 января 2020 г.]. Ланцет . DOI: 10.1016 / S0140-6736 (20) 30211-7PubMedGoogle Scholar10.Chan JF-W, юань S, Кок К-Х, и другие.Семейный кластер пневмонии, связанный с новым коронавирусом 2019 года, указывающий на передачу от человека к человеку: исследование семейного кластера [опубликовано 24 января 2020 года]. Ланцет . 2020; S0140-6736 (20) 30154-9. DOI: 10.1016 / S0140-6736 (20) 30154-9PubMedGoogle Scholar11.Phan LT, Нгуен ТВ, Луонг QC, и другие. Ввоз и передача от человека к человеку нового коронавируса во Вьетнаме [опубликовано 28 января 2020 г.]. N Engl J Med . DOI: 10.1056 / NEJMc2001272PubMedGoogle Scholar13.Ranieri В.М., Рубенфельд GD, Томпсон BT, и другие; Рабочая группа по определению ARDS. Синдром острого респираторного дистресс-синдрома: берлинское определение. JAMA . 2012; 307 (23): 2526-2533. doi: 10.1001 / jama.2012.5669PubMedGoogle Scholar 14. Заболевание почек: улучшение глобальных результатов (KDIGO) Рабочая группа по острой травме почек. Руководство KDIGO по клинической практике при острой травме почек. Почки Int Suppl . 2012; 2: 1.Google ScholarCrossref 15.Ли Q, Гуань X, Wu П, и другие. динамика ранней передачи новой пневмонии, инфицированной коронавирусом, в Ухане, Китай. [опубликовано 29 января 2020 г.]. N Engl J Med . 2020. doi: 10.1056 / NEJMoa2001316PubMedGoogle Scholar16.Zhang H, Кан ZJ, Гонг Привет, и другие. Пищеварительная система – потенциальный путь заражения нКоВ 2019: биоинформатический анализ, основанный на одноклеточных транскриптомах. Препринт. Опубликовано 31 января 2020 г.bioRxiv 927806. DOI: 10.1101 / 2020.01.30.927806

Сотни экстремально цитирующих ученых обнаружены в новой базе данных

Согласно недавно опубликованным данным, самые цитируемые исследователи в мире – удивительно эклектичная группа. Нобелевские лауреаты и выдающиеся эрудиты соседствуют с менее знакомыми именами, такими как Сундарапандиан Вайдьянатан из Ченнаи в Индии. Что бросается в глаза о Вайдьянатане и сотнях других исследователей, так это то, что многие ссылки на их работы взяты из их собственных статей или из статей их соавторов.

Вайдянатан, ученый-компьютерщик из частного института Vel Tech R&D, является ярким примером: 94% цитирований он получал от себя или своих соавторов до 2017 года, согласно исследованию в PLoS Biology в этом месяце 1 . Он не одинок. Набор данных, который насчитывает около 100000 исследователей, показывает, что по крайней мере 250 ученых собрали более 50% своих цитирований от самих себя или своих соавторов, в то время как средний уровень самоцитирования составляет 12.7%.

Исследование может помочь выявить потенциальных крайних саморекламы и, возможно, «фермы цитирования», в которых группы ученых массово цитируют друг друга, говорят исследователи. «Я думаю, что фермы самоцитирования встречаются гораздо чаще, чем мы думаем», – говорит Джон Иоаннидис, врач из Стэнфордского университета в Калифорнии, который специализируется на мета-науке – изучении того, как делается наука, – и руководил этой работой. «Те, у кого самоцитируется более 25%, не обязательно ведут себя неэтично, но может потребоваться более тщательное изучение», – говорит он.

Эти данные, безусловно, являются самой большой когда-либо опубликованной коллекцией показателей самоцитирования. И они прибывают в то время, когда финансирующие агентства, журналы и другие организации больше сосредотачиваются на потенциальных проблемах, вызванных чрезмерным самоцитированием. В июле Комитет по этике публикаций (COPE), консультативный орган издателей в Лондоне, выделил крайнее самоцитирование как одну из основных форм манипулирования цитированием. Этот вопрос вписывается в более широкие опасения по поводу чрезмерной зависимости от показателей цитируемости при принятии решений о найме, продвижении по службе и финансировании исследований.

«Когда мы связываем профессиональный рост и слишком сильно обращаем внимание на показатели, основанные на цитировании, мы стимулируем самоцитирование», – говорит психолог Санджай Шривастава из Орегонского университета в Юджине.

Хотя многие ученые согласны с тем, что чрезмерное самоцитирование является проблемой, нет единого мнения о том, сколько это слишком много и что делать с этой проблемой. Отчасти это связано с тем, что у исследователей есть много законных причин цитировать свои собственные работы или работы коллег. Иоаннидис предупреждает, что его исследование не должно приводить к очернению конкретных исследователей за их уровень самоцитирования, не в последнюю очередь потому, что он может варьироваться в зависимости от дисциплины и этапа карьеры.«Он просто предлагает полную и прозрачную информацию. Его не следует использовать для вынесения вердиктов, например, о том, что слишком высокое самоцитирование приравнивается к плохому ученому », – говорит он.

Диск данных

Иоаннидис и его соавторы не публиковали свои данные, чтобы сосредоточиться на самоцитировании. Это всего лишь часть их исследования, которое включает в себя множество стандартизированных показателей на основе цитирования для 100 000 или около того наиболее цитируемых исследователей за последние два десятилетия в 176 научных областях. Он собрал данные вместе с Ричардом Клавансом и Кевином Бояком из аналитической фирмы SciTech Strategies в Альбукерке, штат Нью-Мексико, и Йеруном Баасом, директором по аналитике амстердамского издательства Elsevier; все данные взяты из собственной базы данных Scopus компании Elsevier.Команда надеется, что ее работа позволит выявить факторы, которые могут стимулировать цитирование.

Но самая привлекательная часть набора данных – это показатели самоцитирования. Уже можно увидеть, сколько раз автор цитировал свои собственные работы, просмотрев записи о цитировании в базах данных подписки, таких как Scopus и Web of Science. Но без обзора областей исследований и этапов карьеры трудно поместить эти цифры в контекст и сравнить одного исследователя с другим.

Рекорд Вайдьянатана выделяется как один из самых экстремальных – и он принес определенные награды. В прошлом году индийский политик Пракаш Джавадекар, который в настоящее время является министром окружающей среды страны, но в то время отвечал за высшее образование, вручил Вайдьянатану награду в размере 20000 рупий (280 долларов США) за то, что он был одним из лучших исследователей страны по показателям производительности и производительности. показатели цитирования. Вайдьянатан не ответил на запрос Nature о комментариях, но ранее он защищал свою запись цитирования в ответ на вопросы о Vel Tech, размещенные на Quora, онлайн-платформе вопросов и ответов.В 2017 году он написал, что, поскольку исследование – это непрерывный процесс, «следующая работа не может быть продолжена без ссылки на предыдущую», и что самоцитирование не было сделано с намерением ввести других в заблуждение.

Двое других исследователей, получивших аплодисменты и много цитирующих себя, – это Теодор Симос, математик, на веб-сайте которого указаны филиалы Университета короля Сауда в Эр-Рияде, Уральского федерального университета в Екатеринбурге, Россия, и Университета Демокрита во Фракии в Комотини, Греция; и Клаудиу Супуран, медицинский химик из Университета Флоренции, Италия, который также указал свою принадлежность к Университету короля Сауда.И Симос, который собрал около 76% цитирований от себя или своих соавторов, и Супуран (62%) были в прошлом году включены в список из 6000 «исследователей мирового уровня, отобранных за их исключительную исследовательскую эффективность», подготовленный Clarivate Analytics. , информационная фирма из Филадельфии, штат Пенсильвания, владеющая Web of Science. Ни Симос, ни Супуран не ответили на запросы Nature о комментариях; Clarivate сообщила, что ей известно о проблеме необычных схем самоцитирования и что методология, используемая для расчета ее списка, может измениться.

Что делать с самоцитированием?

В последние несколько лет исследователи стали уделять больше внимания самоцитированию. В препринте 2016 года, например, предполагалось, что ученые-мужчины цитируют свои собственные статьи, в среднем на 56% больше, чем ученые-женщины. авторов любого пола, у которых больше прошлых работ, указать 3 . В 2017 году исследование показало, что ученые в Италии стали более активно цитировать себя после того, как в 2010 году была введена спорная политика, согласно которой ученые должны были соответствовать порогам производительности, чтобы иметь право на продвижение по службе 4 .А в прошлом году министерство исследований Индонезии, которое использует формулу на основе цитирования для выделения средств на исследования и стипендии, заявило, что некоторые исследователи занижали свои оценки, используя неэтичные методы, включая чрезмерное цитирование самих себя и цитирование групп ученых друг на друга. Министерство заявило, что прекратило финансирование 15 исследователей и планирует исключить самоцитирование из своей формулы, хотя исследователи сообщают Nature , что этого еще не произошло.

Но идея публичного перечисления показателей самоцитирования отдельных лиц или их оценки на основе показателей, скорректированных с учетом самоцитирования, является весьма спорной.Например, в дискуссионном документе, выпущенном в прошлом месяце 5 , COPE выступил против исключения самоцитирования из показателей, потому что, по его словам, это «не позволяет детально понять, когда самоцитирование имеет научный смысл».

В 2017 году Джастин Флатт, биолог из Цюрихского университета в Швейцарии, призвал внести больше ясности в записи самоцитируемых ученых 6 . Флатт, который сейчас работает в Университете Хельсинки, предложил опубликовать индекс самоцитирования, или s -index, по аналогии с индикатором продуктивности h -index, используемым многими исследователями. h -индекс, равный 20, означает, что исследователь опубликовал 20 статей с как минимум 20 цитированием; аналогично, s -индекс, равный 10, будет означать, что исследователь опубликовал 10 статей, каждая из которых получила не менее 10 цитирований.

Флатт, получивший грант на сопоставление данных для индекса s , соглашается с Иоаннидисом в том, что в центре внимания этой работы не должно быть установление пороговых значений для приемлемых оценок или называния и осуждения высоких самоцитирующих лиц. .«Речь не идет о криминализации цитирования», – говорит он. Но до тех пор, пока ученые продолжают продвигать себя, используя индекс h , есть основания для включения индекса s в качестве контекста, утверждает он.

Контекст имеет значение

Необычной особенностью исследования Иоаннидиса является широкое определение самоцитирования, которое включает цитирование соавторов. Это предназначено для выявления возможных случаев цитирования; однако это действительно завышает оценки самоцитируемости, говорит Марко Сибер, социолог из Гентского университета в Бельгии.Например, по физике элементарных частиц и астрономии часто есть статьи с сотнями или даже тысячами соавторов, и это повышает средний показатель самоцитирования в этой области.

Иоаннидис говорит, что некоторые систематические различия можно учесть, сравнивая исследователей со средними показателями для их страны, уровня карьеры и дисциплины. Но в более общем плане, по его словам, список привлекает внимание к случаям, которые заслуживают более внимательного рассмотрения. Есть еще один способ выявить проблемы, изучив соотношение полученных цитирований к количеству статей, в которых эти цитаты появляются.Например, Симос получил 10 458 ссылок только из 1029 статей – это означает, что в среднем он получает более 10 ссылок в каждой статье, в которой упоминается его работа. Иоаннидис говорит, что эта метрика в сочетании с метрикой самоцитирования является хорошим признаком потенциально чрезмерного саморекламы.

Источник: Йерун Баас, неопубликованный анализ базы данных Scopus.

В неопубликованной работе Эльзевье Баас говорит, что он применил аналогичный анализ к гораздо большему набору данных о 7 миллионах ученых: то есть ко всем авторам, перечисленным в Scopus, которые опубликовали более 5 статей.В этом наборе данных, говорит Баас, средний уровень самоцитирования составляет 15,5%, но у 7% авторов уровень самоцитирования превышает 40%. Эта доля намного выше, чем среди самых цитируемых ученых, потому что многие из 7 миллионов исследователей имеют лишь несколько ссылок или только начинают свою карьеру. Ученые, начинающие свою карьеру, обычно имеют более высокий уровень самоцитирования, потому что их статьи не успевают собрать много цитат из других (см. «Эффект молодости»).

Источник: Йерун Баас, неопубликованный анализ базы данных Scopus.

По данным Бааса, Россия и Украина отличаются высокими средними показателями самоцитируемости (см. «Страна за страной»). Его анализ также показывает, что некоторые области выделяются – например, ядерная физика и физика элементарных частиц, астрономия и астрофизика – благодаря их многочисленным статьям, написанным несколькими авторами (см. «Физическая зависть?»). Однако Баас говорит, что не планирует публиковать свой набор данных.

Источник: Йерун Баас, неопубликованный анализ базы данных Scopus.

Не годится для науки?

Хотя исследование PLoS Biology выявляет некоторые крайние самоцитирующие лица и предлагает способы поиска других, некоторые исследователи говорят, что они не уверены, что набор данных самоцитирования будет полезен, отчасти потому, что этот показатель сильно различается. по научным дисциплинам и этапам карьеры.«Самоцитирование намного сложнее, чем кажется», – говорит Винсент Ларивьер, специалист по информации из Монреальского университета в Канаде.

Шривастава добавляет, что лучший способ справиться с чрезмерным цитированием – и другими играми с показателями цитирования – не обязательно публиковать все более подробные стандартизированные таблицы и составные показатели для сравнения исследователей друг с другом. По его словам, у них могут быть свои недостатки, и такой подход рискует еще больше затянуть ученых в мир оценки на основе показателей индивидуального уровня – той самой проблемы, которая в первую очередь стимулирует игры.

«Мы должны попросить редакторов и рецензентов не допускать необоснованных цитирований самих себя», – говорит Шривастава. «И, возможно, некоторые из этих приблизительных показателей могут быть полезны в качестве указателя на то, куда следует более внимательно присмотреться. Но, в конечном итоге, решение должно заключаться в том, чтобы согласовать профессиональную оценку с экспертной оценкой коллег, а не удваивать показатели ». Кэссиди Сугимото, специалист по информатике из Университета Индианы в Блумингтоне, согласен с тем, что большее количество показателей может не быть ответом: «Ранжирование ученых вредно для науки.

Иоаннидис, однако, говорит, что его работа необходима. «Люди в любом случае уже сильно полагаются на показатели индивидуального уровня. Вопрос в том, как обеспечить максимальную точность, тщательность и систематичность сбора информации », – говорит он. «Показатели цитирования не могут и не должны исчезнуть. Мы должны использовать их наилучшим образом, полностью осознавая их многочисленные ограничения ».

Другие непечатные источники // Purdue Writing Lab

Справочный список: другие непечатные источники

Примечание: На этой странице отражена последняя версия руководства APA Publication Manual (i.e., APA 7), выпущенный в октябре 2019 года. Аналогичный ресурс для более старого стиля APA 6 можно найти здесь.

Обратите внимание: ниже содержит список наиболее часто цитируемых непечатных источников. Полный список ссылок на непечатные источники см. В издании 7 th Руководства по публикациям APA.

Интервью

Интервью делятся на три категории: опубликованные интервью, личные интервью и интервью с участниками исследования.Однако только опубликованные интервью требуют официальной ссылки в вашем списке литературы.

Опубликованное интервью можно найти в таких местах, как радиопередача, газета или журнал. Чтобы процитировать опубликованное интервью, придерживайтесь формата для этого конкретного ссылочного типа (например, если интервью находится в подкасте, цитируйте подкаст). Для получения дополнительной информации о цитировании источников, в которых может появиться интервью, посетите страницу статей в периодических изданиях или страницу электронных источников.

Личное интервью считается личным общением и не требует официальной ссылки в вашем списке литературы.Смотрите ниже для получения дополнительной информации.

Интервью с участником исследования – это интервью, проводимое в рамках вашего исследовательского проекта. Вы можете обратиться к этому в основной части статьи, сказав что-то вроде: «В рамках своего исследования я опросил пятьдесят участников об их причастности к очным видам спорта». Однако вам не нужно официально цитировать это в вашем списке литературы.

Презентация на конференции или симпозиуме

Если вы цитируете программный доклад, бумажную презентацию в рамках симпозиума или стендовый доклад, следуйте приведенным ниже рекомендациям.Хотя некоторые презентации публикуются после того, как они были сделаны, другие не имеют письменного компонента. Если презентация опубликована, следуйте инструкциям по цитированию, изложенным на странице Другие источники печати . Обязательно укажите URL-адрес, если публикация доступна в Интернете.

Презентация без онлайн-источника

Участник, A. A., Участник, B. B., Участник, C. C., и Участник, D. D. (Год, Месяц, День). Название вклада [Описание вклада].Название симпозиума / конференции, место проведения.

Matson, E. (5 ноября 2018 г.). Дроны и автономные транспортные средства: новейшие технологии с потенциальной угрозой [Конференция]. Конференция Dawn or Doom 2018, Университет Пердью, Западный Лафайет, Индиана, США.

Презентация с онлайн-исходниками

Участник, A. A., Участник, B. B., Участник, C. C., и Участник, D. D. (Год, Месяц, День). Название вклада [Описание вклада].Название симпозиума / конференции, место проведения. URL

Индивидуальная презентация на большом симпозиуме / Панельная дискуссия

Участник, A. A., Участник, B. B., Участник, C. C., и Участник, D. D. (Год, Месяц, День). Название статьи. В Е. Е. Председатель и Ф. Ф. Председатель (председатели), Название более крупного симпозиума / панели [Описание симпозиума / панели] Название симпозиума / конференции, Место проведения. URL, если доступен

Фабиан, Дж. Дж. (14 мая 2020 г.). UX в бесплатном образовательном контенте.В J. S. Doe (председатель), Дело Purdue OWL: доступность и разработка онлайн-контента [Панельная презентация] Computers and Writing 2020, Гринвилл, Северная Каролина, США.

Неопубликованные работы

Возможно, вам понадобится процитировать диссертацию или рукопись, которые еще не были официально опубликованы. Чтобы правильно классифицировать работу, опишите работу и заключите это описание в квадратные скобки. Убедитесь, что указанная вами дата – это год завершения работы, независимо от того, является ли это окончательной версией или нет.

Неопубликованная рукопись

Баркли, С., Чен, М., и Макдональд, П. (2018). Влияние натрия на здоровье детей [Неопубликованная рукопись]. Биологический факультет Цинциннати.

Рукопись в стадии подготовки

Гласс, А. (2019). Как авокадо изменили Америку [Рукопись в разработке]. Департамент социологии Мичиганского государственного университета.

Рукопись представлена ​​для публикации

Джонс, Р.(2019). Уолт Уитмен и американская мечта [Рукопись отправлена ​​в публикацию]. Факультет английского языка Университета Миссисипи.

Личное общение

Любое сообщение, которое читатель не может получить напрямую, считается «личным сообщением». Электронная почта, телефонные разговоры, текстовые сообщения и сообщения в социальных сетях – все это примеры личного общения. Вы не включаете личное общение в свой список ссылок; вместо этого укажите в скобках имя коммуникатора, фразу «личное сообщение» и дату общения только в основном тексте.

(Э. Роббинс, личное сообщение, 4 января 2019 г.).

Если вы ссылаетесь на личное общение в сноске, что является обычной практикой в ​​определенных областях и публикациях, вы можете задокументировать это таким же образом.

1. П. Смит (личное сообщение, 3 ноября 2019 г.) также утверждала, что у многих ее учеников были трудности со стилем APA.

Хотя вам не нужно цитировать личные сообщения, все же постарайтесь найти источник, когда это возможно. Например, если ваш друг рассказал вам об исследовании, которое он услышал в подкасте, и вы хотите включить эту информацию в свое эссе, лучше процитировать исходный подкаст, чем общение с другом.

Что такое культура отмены? Почему мы продолжаем бороться из-за исключения людей

Примечание редактора, 10 мая 2021 г. : Информация в этой истории последний раз обновлялась в августе 2020 года. Этот взгляд на истоки и актуальность культуры отмены по-прежнему актуален, но дискурс вокруг культуры отмены эволюционировал. См. Объяснение Vox 2021 по дебатам об отмене культуры, чтобы узнать больше по этому поводу.


В последние несколько неспокойных лет идея о том, что человека можно «исключить» – другими словами, запретить в культурном отношении иметь видную общественную платформу или карьеру – стала предметом поляризующих дискуссий.Возникновение «культуры отмены» и идеи отменить кого-то совпадает со знакомой закономерностью: знаменитость или другой общественный деятель делает или говорит что-то оскорбительное. Возникает общественная реакция, часто подогреваемая политически прогрессивными социальными сетями.

Затем раздаются призывы отменить человека, то есть прекратить его карьеру или лишить его культурного наследия, будь то бойкот его работы или дисциплинарные меры со стороны работодателя.

Для многих людей этот процесс публичных призывов к ответственности и бойкота, если ничто другое не работает, стал важным инструментом социальной справедливости – способом борьбы с помощью коллективных действий с некоторыми из огромных дисбалансов сил, которые часто существуют между общественные деятели с далеко идущими платформами и аудиториями, а также люди и сообщества, их слова и действия могут причинить вред.

Но консервативные политики и ученые мужи все чаще принимают аргумент о том, что отмена культуры, а не способ говорить правду власти, вышла из-под контроля и стала бессмысленной формой правления толпы в социальных сетях. Например, на Республиканском национальном съезде 2020 года многочисленные выступающие, в том числе президент Трамп, напрямую обратились к отмене культуры, а одна резолюция делегата даже прямо нацелена на это явление, описывая его как «переросшее в стирание истории, поощрение беззакония, подавление граждан и нарушение свободного обмена идеями, мыслями и речью.”

На самом деле трудно прервать чью-то карьеру из-за негативной реакции общества. Немногие артисты или другие общественные деятели действительно были отменены – то есть, хотя они, возможно, столкнулись со значительной негативной критикой и призывами нести ответственность за свои заявления и действия, очень немногие из них действительно испытали на себе последствия, приводящие к прекращению карьеры.

Гарри Поттер автор J.K. Роулинг, например, столкнулась с интенсивной критикой со стороны своих поклонников с тех пор, как она начала высказывать трансфобные убеждения, что сделало ее одной из наиболее заметных «отверженных» личностей в центре дебатов о культуре отмены.Но после публикации Роулинг в июне 2020 года трансфобного манифеста продажи книг автора в ее родной стране Великобритании резко выросли.

Постоянная поддержка тех, кто якобы сталкивается с отменой, демонстрирует, что вместо того, чтобы разрушать чьи-то средства к существованию, становление объектом критики и негативной реакции может вместо этого вызвать сочувствие общественности. Тем не менее, услышав Шейна Гиллиса (который потерял работу в Saturday Night Live в 2019 году после того, как стали известны прошлые расистские и гомофобные шутки) и многих других, кто говорит о культуре отмены, вы можете подумать, что это своего рода «сезон охоты на знаменитостей» – непреодолимая сила, стремящаяся разрушить карьеру любого, кто осмелится раздвинуть моральные границы общества.В этом кадре преступник часто изображается как жертва безрассудного правосудия.

«Очень немногие люди прошли через то, что у них есть, потеряв все за один день», – сказал комик Норм Макдональд в интервью 2018 года, имея в виду таких комиков, как Луи С.К. и Розанна Барр, потерявшая в том году работу и поклонников, С.К. после признания в сексуальных домогательствах и Барра после расистского твита. «Конечно, люди скажут:« А как насчет жертв? »Но знаете что? Жертвам не пришлось через это проходить.”

Так что это? Является ли культура отмены важным инструментом социальной справедливости или новой формой беспощадного запугивания толпы? Если отмена кого-то обычно не имеет большого измеримого эффекта, существует ли вообще культура отмены? Или сама идея отмены работает для предотвращения потенциально плохого поведения?

Эти вопросы получают все более широкое внимание, поскольку сама идея отмены культуры эволюционирует из своих юмористических корней в более широкий и серьезный разговор о том, как привлечь к ответственности общественных деятелей за плохое поведение.И речь идет не только о том, когда и как общественные деятели должны потерять свой статус и средства к существованию. Это также касается установления новых этических и социальных норм и выяснения того, как коллективно реагировать на их нарушение.

«Отмена» вышла из самого неожиданного места: женоненавистническая шутка

Учитывая, как часто его используют для опровержения сексизма и женоненавистничества, парадоксально, что концепция «отмена» имеет свою ДНК с женоненавистнической шуткой. Одно из первых упоминаний об отмене кого-либо происходит в фильме 1991 года New Jack City , в котором Уэсли Снайпс играет гангстера по имени Нино Браун.В одной из сцен, после того, как его девушка терпит неудачу из-за насилия, которое он вызывает, он бросает ее, говоря: «Отмени эту суку. Я куплю еще одну. (Сообщается, что этим остроумием мы обязаны сценаристу Барри Майклу Куперу.)

Перейти в 2010 год, когда Лил Уэйн упомянул фильм в строчке из своей песни «I’m Single»: «Да, я холост / ниггер должен был отменить эту суку, как Нино». Этот обратный вызов более ранней сексистской шутке об отмене, вероятно, на время помог фразе распространиться.

Но отмена, похоже, получила свой первый большой импульс в духе времени в эпизоде ​​реалити-шоу Vh2 Love and Hip-Hop: New York , которое транслировалось в декабре 2014 года, в котором актер Сиско Росадо рассказывает о своем любовном увлечении Diamond Strawberry во время бой, «ты отменен.”Даже без контекста это забавный момент:

Цитата стала появляться в социальных сетях вскоре после выхода в эфир эпизода.

ИМА начинает говорить людям: “Вы отменили, мое лицо”

– Скотти (@ scotty2thotty_) 23 декабря 2014 г.

С этого момента идея отмены стала распространяться через Black Twitter в течение 2015 года, как реакция на то, что кто-то делает что-то, что вы не одобряете – шутливо или серьезно.

Однако, когда он стал популярным, этот термин начал превращаться в способ реагирования не только на друзей или знакомых, но и на знаменитостей или сущностей, поведение которых вас оскорбляло.

И даже на раннем этапе отмена кого-то часто требовала профессионального бойкота, как показывают приведенные ниже твиты:

Трэвис Скотт – гомофобный мусор. Его музыку отменили … Он отменил, ребята !! Если он тебе все еще нравится, пожалуйста, отписывайся от меня

– yve. (@ mads4pres) 7 сентября 2015 г.

Я работал над фейдом Канье, а потом вспомнил, что он отменил и изменил

– Malek (@offlinemalek) 15 декабря 2016 г.

Несмотря на то, что эти ранние примеры отличаются друг от друга, они содержали семена того, чем стала бы культура отмены: тенденция общинных призывов бойкотировать знаменитость, поведение которой было воспринято как слишком далеко идущее.

Принято сравнивать культуру отмены с «культурой призыва», но ее настоящие корни могут лежать в движении за гражданские права.

По мере того, как культура отмены набирала обороты, многие представители общественности, а также средства массовой информации часто объединяли ее с другими смежными тенденциями, особенно с «культурой призыва». Культуру отмены можно рассматривать как продолжение культуры вызова: естественная эскалация от указания проблемы к вызову главы человека, который ее вызвал.

Культура отмены и культура призыва часто путают не только друг с другом, но и с более широкими тенденциями публичного позора, как часть коллективного повествования о том, что все эти вещи являются примерами троллинга и преследования.СМИ иногда называют это коллективное повествование «культурой возмущения».

Но хотя на первый взгляд эти идеи кажутся взаимозаменяемыми, они существенно отличаются друг от друга. Культура выкладывания возникла раньше, чем культура отмены как концепции, с онлайн-корнями в блогах фандома Tumblr начала 2010-х годов, такими как Your Fave is Problematic, и распространившимися оттуда. Культура криков – это термин, возникший в фандоме, и этот подход использовался всеми фанатами для критики поп-культуры или общественных деятелей в качестве неотъемлемой части противодействия ядовитым мобам, преследующим в сети, таким как Gamergate.Между тем культура отмены зародилась в культуре чернокожих и, похоже, стала направлением движений за расширение прав и возможностей чернокожих, восходящих к бойкотам за гражданские права 1950-х и 60-х годов.

«Хотя терминология культуры отмены может быть новой и наиболее применимой к социальным сетям через Black Twitter, в частности, концепция отмены не нова для черной культуры», – сказала Энн Чарити Хадли, заведующая кафедрой лингвистики Африканской Америки в Университете. Калифорнии, Санта-Барбара, сказал Vox. Хадли, изучающий разговорный язык чернокожих и использование языка в культурных беседах, подобных этому, описал отмену как «навык выживания, такой же старый, как и использование бойкота черными южанами.”

Благотворительность Хадли сравнил аннулирование кого-либо с бойкотом, но человека, а не бизнеса. По ее словам, это также продвигает идею о том, что чернокожие должны иметь возможность отвергать поп-культуру, распространяющую вредные идеи. «Если у вас нет возможности остановить что-то политическими средствами, вы можете отказаться от участия», – сказала она.

Благодаря социальным сетям, культура чернокожих, в частности, получила более широкое признание как доминирующая сила, стоящая за большей частью поп-культуры.Такие платформы, как Twitter, дают более громкий коллективный голос темнокожим людям и членам других маргинализированных сообществ, которые традиционно были отодвинуты на второй план, в то время как такие платформы, как YouTube и Netflix, помогают диверсифицировать и расширять типы медиа и поп-культуры, которые мы потребляем. И в обществе, где участие в культурной жизни все более демократизируется, отказ от участия также становится более важным.

«Отмена – это способ признать, что у вас не обязательно должна быть сила, чтобы изменить структурное неравенство», – сказала Чарити Хадли.«Вам даже не обязательно иметь власть изменить все общественные настроения. Но как личность вы все равно можете обладать властью сверх меры.

«Когда вы видите, как люди отменяют Канье, отменяют других людей, это коллективный способ сказать:« Мы повысили ваш социальный статус, ваше экономическое мастерство, [и] мы не собираемся обращать на вас внимание так, как когда-то делал. … «Возможно, у меня нет власти, но у меня есть сила [игнорировать] вас».

С этой точки зрения культура отмены может служить корректором чувства бессилия, которое испытывают многие люди.Но по мере того, как она привлекла всеобщее внимание, культура отмены, похоже, также приобрела более материальную силу – по крайней мере, в глазах многих людей, которые хотели бы ее отменить.

Очень немногие знаменитости, которых отменили, терпят длительные неудачи в карьере. Но наблюдение за негативной реакцией культуры отмены, похоже, вызывает у некоторых людей панику.

Это правда, что некоторые знаменитости были фактически уволены в том смысле, что их действия привели к серьезным последствиям, включая потерю рабочих мест и серьезное ухудшение репутации, если не полное прекращение их карьеры.

Рассмотрим Харви Вайнштейна, Билла Косби и Кевина Спейси, которые столкнулись с обвинениями в изнасиловании и сексуальном насилии, которые стало невозможно игнорировать, и которым были предъявлены обвинения в совершении преступлений. Все они фактически «отменены» – Вайнштейн и Косби, потому что они теперь осужденные преступники, и Спейси, потому что, хотя все обвинения против него на сегодняшний день сняты, он слишком испорчен, чтобы нанимать.

Вместе с Розанной Барр, потерявшей свое популярное телешоу из-за расистского твита, и Луи К.К., который столкнулся с серьезными профессиональными неудачами после того, как признался в годах сексуальных проступков по отношению к коллегам-женщинам, их преступления были достаточно серьезными, чтобы нанести непоправимый ущерб их карьере, наряду с толчком к уменьшению их культурного влияния. Но даже перерыв в карьере СиКей продлился всего около 10 месяцев, прежде чем он вернулся в стендап-комедию и отыграл десятки аншлаговых, неоднозначных шоу. И, конечно же, J.K. Роулинг продолжает писать и публиковать новые книги и получать прибыль от неизменно прибыльной империи Гарри Поттера.

«Я думаю, очевидно, что кампания« отменить »более эффективна, если [вовлечено] существенное затруднение», – сказала Vox Кэтрин Сквайрс, автор книги «Пострасовая мистика » и профессор коммуникационных исследований в Университете Миннесоты. в электронном письме.

Однако это потенциальное замешательство сопровождается высокой степенью тревоги. Возьмем, к примеру, комика Кевина Харта, который стал предметом негативной реакции после того, как его выбрали ведущим Оскара 2019 года, когда критики указывали на гомофобные шутки и твиты, которые Харт делал в прошлом.Когда Академия кинематографических искусств и наук призвала к публичному обсуждению этого вопроса, Харт немедленно ушел с выступления, сказав, что не будет извиняться, потому что ранее он отвечал на гомофобные шутки, которые он делал с 2009 по 2011 год, и считал, что он изменился. «Я ушел, и я нахожусь в совершенно другом пространстве своей жизни», – сказал Харт в видео в Instagram в то время. «Вы кормите интернет-троллей, вы их награждаете. Я не буду этого делать ».

Харт в конце концов принес новые извинения, а затем провел недели, обсуждая инцидент, как будто он стал жертвой безжалостного публичного позора, отвергая реальную жестокость, присущую его старой комедийной риторике, и обвиняя цели этой жестокости – странных людей – в том, что они указали на нее. .

Статья в Digiday 2019 года о влиянии культуры отмены на бренды и бизнес сформулировала это как «правило мафии», а один анонимный PR-директор заявил, что «отменяются даже благие намерения». В том же году Осита Нваневу из Новой Республики заметил, как часто средства массовой информации сравнивали культуру отмены с жестокими политическими восстаниями, от этноцида до пыток при диктаторских режимах.

Такие гиперболические сравнения могут показаться разумными для тех, кто сталкивается с огромной общественной реакцией, но сторонникам культуры отмены они кажутся скорее неискренним скользким спуском, который на самом деле работает только для маргинализации жертв.Например: В 2018 году художница-феминистка Эмма Сулкович разработала акцию протеста в ответ на статью в New York Times. В статье, как она позже объяснила Teen Vogue, спрашивалось у директоров музеев, удалят ли они работы знаменитого художника Чака Клоуса из своих галерей после того, как несколько женщин обвинили Клоуз в сексуальных домогательствах.

«Я так расстроился, что голоса выживших не были включены в разговор», – сказал Сулкович. «Один директор музея сказал:« Если мы пойдем по этой дороге, стены нашего музея останутся голыми.«И я подумал:« Вы показываете только работы злых людей? »

Споры вокруг культуры отмены частично связаны с тем, как мы относимся друг к другу, а частично из-за разочарования в связи с отсутствием реальных последствий для влиятельных людей

Вся эта драматическая риторика обеих сторон дискуссии показывает, насколько зажигательной стала культура отмены. По мере того как идеологические разногласия кажутся все более и более непреодолимыми, грань между личным и политическим исчезает для многих людей. Несмотря на то, что культура отмены, кажется, не имеет долгосрочных последствий для знаменитостей и их карьеры, некоторые люди рассматривают ее как часть более широкой тенденции, которую они находят глубоко тревожной: неспособность простить и двигаться дальше.

Аарон Роуз, консультант по корпоративному разнообразию и инклюзивности, привык идентифицировать прогрессистов, которые участвуют в культуре вызова и отмены. Но теперь, по его словам, он сосредоточен на таких задачах, как «трансформация конфликта», движимый вопросом «как мы действительно общаемся [и] относимся друг к другу, как люди?»

«Мейнстримный интернет-активизм – это много криков, обвинений и стыда», – сказала Роуз Vox по электронной почте. «Мы должны быть честны с самими собой в отношении того, дает ли вызов и отмена нечто большее, чем краткосрочное высвобождение катарсического гнева.”

Роуз «раньше думал, что эта тактика приводит к изменениям», – сказал он, но в конце концов понял, «что я не вижу истинных изменений, которых желал. … Мы все еще были грустны и злы. А плохие люди оставались плохими. И все по-прежнему были травмированы ». Он говорит, что теперь хочет «создавать больше историй о трансформации, а не о наказаниях и отлучении».

Лоретта Росс – самопровозглашенная либералка, занявшая аналогичную позицию. В статье, опубликованной в New York Times в 2019 году, она написала, что как черная феминистка считает культуру отмены и критики «токсичной» практикой, когда «люди пытаются изгнать всех, с кем они не полностью согласны, вместо того, чтобы оставаться сосредоточены на тех, кто наживается на дискриминации и несправедливости.”

Росс далее писал, что «в большинстве случаев публичное осуждение носит горизонтальный характер», то есть это делается не для того, чтобы оправданно критиковать людей, которые серьезно опасны, а для того, чтобы набрать баллы против людей, которые не хотят причинять вреда. Она утверждала, что люди, производящие отмену, «становятся самопровозглашенными блюстителями политической чистоты».

Но среди сторонников отмены есть ощущение, что любые потери, которые терпит отмененный человек, перевешиваются более высокой культурной потребностью изменить поведение, которое он воплощает.«Простите меня, если меня меньше волнует комик, который заправил себе постель, а не люди, пострадавшие от анти-квир-климата, который он помог создать», – написал Майкл Арсено из Esquire в 2018 году в ответ на предыдущие комментарии Кевина Харта, которые в конечном итоге потеряли его. концерт на церемонии вручения Оскара.

«То, что люди делают, когда вызывают собачьи свистки, такие как« отменить культуру »и« культурные войны », – написала Даниэль Батлер для Root в 2018 году, -« иллюстрирует их дискомфорт с людьми, у которых теперь есть право голоса и их смелость направить его к фигурам с большей заметностью и силой.”

Но в глазах сторонников прогресса, таких как Роуз, отказ от культуры отмены не должен означать отказ от принципов социальной справедливости и подпитывающего ее стремления к равенству. «Это не означает подавление нашей реакции или отказ от ответственности», – сказал он Vox. «Напротив, это означает дать себе возможность искренне уважать наши чувства печали и гнева, при этом не реагируя таким образом, который подразумевает, что другие … неспособны к состраданию и изменениям».

Для Роуза и для многих противников культуры отмены жизненно важным элементом дебатов является вера в то, что другие люди могут измениться.Разница между культурой отмены и более примирительным, трансформирующим подходом к разногласиям заключается в «различии между ожиданием исправления и никогда не позволять ране закрыться», – сказал Роуз. «Между выражением гнева и вечным отождествлением с ним».

«Я понимаю, но это действительно привилегированный способ для среднего класса белых», – возразила Черити Хадли, когда я изложил ей точку зрения Роуз. «С моей точки зрения, для культуры чернокожих и культур людей с низким доходом и бесправных, это первый раз, когда вы, , имеете право голоса в таких разговорах.”

Благотворительность Хадли подчеркивает то, что многим кажется основным в разговоре о культуре отмены: для тех, кто делает вызов или отмену, шансы по-прежнему невысоки. Они по-прежнему не обладают социальной, политической или профессиональной властью, чтобы заставить кого-то совершить значимое искупление, сделать гораздо больше, чем организовать коллективный бойкот.

«Думаю, именно поэтому люди считают [отмена культуры] угрозой или продолжением разногласий», – сказала она.«Разделение уже было».

Тем не менее, этот разрыв, кажется, расширяется и становится все более заметным. И это разделение не только между идеологиями, но и между тактическими подходами к преодолению идеологических разногласий и борьбе с проступками. Мнение о том, что традиционного подхода – извинения, искупления и прощения – уже недостаточно, может быть поразительным. Но для тех, кто считает культуру отмены продолжением стремления борцов за гражданские права к значимым изменениям, это важный инструмент.И ясно, что, как бы противоречива ни была культура отмены, она никуда не денется.

Исправление: В более ранней версии этой статьи сценарист New Jack City Томас Ли Райт написал фразу «отмени эту суку». Соавтор сценария Барри Майкл Купер заявил, что написал эту сцену.


У нас есть запрос

В такие моменты, когда люди пытаются понять варианты и вакцины, а дети возвращаются в школу, многие торговые точки отключают свой платный доступ.Контент Vox всегда бесплатный, отчасти благодаря финансовой поддержке наших читателей. Мы освещаем пандемию Covid-19 более полутора лет. С самого начала нашей целью было внести ясность в хаос. Чтобы предоставить людям информацию, необходимую для обеспечения безопасности. И мы не останавливаемся.

К нашему удовольствию, вы, наши читатели, помогли нам достичь нашей цели – добавить 2500 финансовых взносов в сентябре всего за 9 дней. Итак, мы ставим новую цель: добавить 4500 взносов к концу месяца.Поддержка читателей помогает обеспечить бесплатное покрытие и является важной частью нашей ресурсоемкой работы. Поможете ли вы нам достичь нашей цели, сделав взнос в Vox всего за 3 доллара?

Как записать пробег для уплаты налогов за 8 простых шагов

Если вы должны водить машину по работе, вы можете иметь право вычесть расходы из своей федеральной налоговой декларации. Если вы соответствуете требованиям, будьте готовы задокументировать свои поездки в качестве подтверждающего доказательства в случае проверки ваших налогов.

1. Убедитесь, что вы имеете право на списание миль

Налогоплательщик может вычесть мили за поездку из офиса на рабочее место, из офиса во второе место работы или за поездку по служебным делам.

Ключевые выводы

  • Существует два метода списания пробега.
  • Чтобы использовать стандартный вычет, вы должны вести журнал миль, которые вы проехали на работу.
  • Чтобы использовать метод фактических расходов, вы должны сохранить все квитанции о расходах, связанных с вождением на работу.

2. Определите свой метод расчета

Налогоплательщик может выбрать один из двух способов учета суммы вычета миль:

  • Для стандартного вычета пробега требуется только ведение журнала квалифицируемого пройденного пробега. В 2019 налоговом году ставка составляет 58 центов за милю. Ставка на 2021 налоговый год составляет 56 центов (по сравнению с 57,5 ​​центами в 2020 году).
  • Для вычета фактических расходов на транспортное средство необходимо сохранить все квитанции и другую соответствующую документацию, относящуюся к расходам на управление транспортным средством.

3. Запишите одометр в начале налогового года

Налоговая служба (IRS) требует, чтобы налогоплательщик сообщал общее количество миль, которое транспортное средство проехало за налоговый год. Общий пробег будет указан в форме 2106. Таким образом, налогоплательщик должен записывать одометр транспортного средства в начале налогового года.

56 центов за милю

– это стандартный вычет пробега на 2021 год.

Если автомобиль приобретен в течение года и не является новым, запишите показания одометра с первого дня его использования.

4. Ведение журнала вождения (при необходимости)

Если вы выберете стандартный вычет пробега, вы должны вести журнал пройденных миль. IRS довольно конкретен по этому поводу:

  • В начале каждой поездки налогоплательщик должен записывать показания одометра и указывать цель, место начала, место окончания и дату поездки.
  • По завершении поездки необходимо записать окончательный одометр, а затем вычесть его из начального значения, чтобы определить общий пробег за поездку.

Этот журнал необходимо регулярно обновлять. IRS не заботится о приблизительных цифрах.

5. Вести учет поступлений (при необходимости)

Если вы выберете фактический вычет расходов, журнал пробега не понадобится. Вместо этого сохраните копии соответствующих квитанций и документации. Каждый документ должен включать дату, сумму в долларах США за приобретенную услугу или услугу и описание необходимого продукта или услуги.

6. Запишите одометр на конец налогового года

В конце налогового года налогоплательщик должен записать окончательные показания одометра.Этот показатель используется вместе с показаниями одометра в начале года для расчета общего количества миль, пройденных автомобилем за год. Информация, в том числе процент пройденных миль, был использован в коммерческих целях, требуется в форме 2106.

7. Записать пробег в налоговой декларации

При заполнении налоговой декларации вы укажете общее количество пройденных миль в форме 2106, строка 12. Эта цифра рассчитывается по стандартной годовой ставке миль для определения суммы вычета в долларах.

Если вы используете метод фактических расходов, вам необходимо организовать поступления расходов по группам, включая бензин, масло, ремонт, страховку, аренду автомобиля и амортизацию.

8. Сохраните документацию

Вы должны хранить документацию, касающуюся списания миль, не менее трех лет.