Содержание

Расчет страховых взносов за 2 квартал 2021 года: инструкция, сроки сдачи, образец заполнения и новая форма

С IV квартала 2020 года все компании должны использовать новую форму Расчёт по страховым взносам (РСВ), КНД 1151111. В статье расскажем когда нужно сдать расчёт, покажем образец заполнения и дадим подробную инструкцию по корректному заполнению.

Периодичность представления — ежеквартально. Отчитываться по форме РСВ должны все компании и ИП, если они являются страхователями в части пенсионного, медицинского и социального страхования  наёмного персонала. Бланк РСВ за 2020 год утверждён приказом ФНС от 18 сентября 2019 года № ММВ-7-11/470 в редакции приказа ФНС от 15 октября 2020 года № ЕД-7-11/751.

Срок сдачи отчёта по форме РСВ

Ежеквартальный расчёт по страховым взносам предоставляется в налоговые органы не позднее 30 числа месяца, который следует за отчётным периодом. Если установленный день сдачи отчёта выпадает на выходной, то в соответствии с законодательством он переносится на первый рабочий день (п.

7 ст. 6.1 НК РФ).

На 2021 год установлены следующие сроки предоставления ежеквартальных расчётов:

  • за 2020 год до 30 января (1 февраля) 2021 года
  • за I квартал до 30 апреля 2021 года
  • за полугодие до 30 июля 2021 года
  • за 9 месяцев до 30 октября (1 ноября) 2021 года

Предприниматели, ведущие крестьянско-фермерское хозяйство, ежеквартальную отчётность не представляют, срок сдачи годового отчёта установлен как и для прочих организаций не позднее 30 января, следующего года. Но поскольку 30 число выпадает на субботу, то крайний срок переносится на ближайший рабочий день 1 февраля 2021 года.

Способ сдачи отчёта — на бумаге или через интернет

С 2020 года правила, по которым определялась возможность сдачи декларации в электронном или бумажном виде, изменились. С 1 квартала 2020 года в соответствии с п. 4 ст.80, п. 10 ст. 431 НК РФ устанавливается новый предел численности сотрудников:

  • компании, численность сотрудников которых превышает 10 человек, обязаны предоставлять отчёт в электронном виде, ранее этот параметр составлял 25 человек
  • компании, созданные в отчётном периоде, в том числе путём реорганизации, обязаны отчитываться в электронном виде при численности сотрудников, превышающей 10 человек, а не 25, как было ранее

Юридические лица и ИП, у которых численность сотрудников менее 10 человек, могут выбирать способ сдачи отчёта самостоятельно: предоставить расчёт на бумажном носителе лично, отправить его заказным письмом с описью вложения по почте или сдать по электронным каналам связи.

Контрольные соотношения при проверке расчёта

Налоговая служба изменила правила проверки контрольных соотношений (КС) начисленных сумм в расчёте по страховым взносам. Теперь действия проверяющих органов регламентированы письмом ФНС № БС-4-11/[email protected] от 07.02.2020 г. В документе все изменения представлены в виде подробной таблицы. Новые КС позволяют более качественно сравнивать начисленные в рамках трудовых договоров суммы выплат сотрудникам не только с размером установленного регионом МРОТ, но и со средними показателями заработной платы в определённых отраслях за предыдущий период. Такая методика позволит более эффективно выявлять «чёрные» зарплаты. В общей сложности список контрольных соотношений сократился, но при это стал более эффективным.

В Контур.Экстерне проверки на новые контрольные соотношения уже встроены: если обнаружится ошибка, система не даст отправить расчёт.

Большинство контрольных соотношений отчёта оценивается в соответствии с кодом тарифа. При обнаружении ошибки проверяющий высылает уведомление о несоответствии, которое нужно устранить в указанные сроки.

Обособленные подразделения и филиалы

Обособленные подразделения и филиалы, у которых открыт отдельный расчётный счёт, должны предоставлять расчёт по страховым взносам в местный налоговый орган (п. 11 ст. 431 НК РФ). С 2020 года наличие счёта в банке стало определяющим условием. Благодаря такой доработке было достигнуто соответствие НК РФ с законом о пенсионном страховании, в котором постановка подразделения на учёт в качестве страхователя возможно только при наличии отдельного расчётного счёта.

Для компаний, имеющих обособленные подразделения без расчётного счёта, которые в период 2017—2019 гг. имели право сдавать отчётность по страховым взносам в местную налоговую, предусмотрено два варианта действий:

  1. Открыть расчётный счёт и продолжить отчитываться по старой схеме.
  2. Предоставить в налоговые органы заявление о лишении подразделения полномочий предоставлять консолидированную отчётность, в которую входят сведения о начислениях филиала, по месту нахождения.

Таким образом, в соответствии с пп. «а», «в» п. 85 ст. 2, ч. 3 ст. 3 закона № 325-ФЗ с 1 января 2020 г. перечислять страховые взносы и предоставлять по ним декларацию могут только те обособленные подразделения, которые осуществляют выплаты в пользу сотрудников и имеют отдельный расчётный счёт.

Форма расчёта и порядок заполнения формы РСВ

Для того чтобы отчитаться по социальным взносам за IV квартал 2020 придется использовать новую форму, утвержденную Приказом ФНС РФ от 15.10.2020 N ЕД-7-11/[email protected]

Читайте подробнее Новая форма РСВ 2020 года

Форма расчёта стала более простой, однако новые изменения нельзя назвать кардинальными. Заполнять документ наиболее удобно в следующем порядке: сначала оформляется титульный лист, затем Раздел 3 и остальные приложения, и только в самом конце переходить к заполнению первого раздела.

Титульный лист

Главным новшеством титульного листа является появление поля для отражения информации о среднесписочной численности персонала. Подобное новшество освободило компании и ИП от представления в органы ФНС самостоятельного отчёта о численности.

Разберём построчное заполнение.

ИНН — 10-значный номер налогоплательщика (12-значный для ИП)

КПП — 9-значный код, который присвоен инспекцией, куда подается декларация

Номер корректировки — при первичной подаче отчета «0--», при уточненном отчете — порядковый номер корректировки.
Расчётный период — указывается код периода (см. таблицу)

Налоговый период Для юридических лиц и ИП В случае реорганизации (ликвидации)
I квартал
21
51
полугодие 31 52
9 месяцев 33 53
год 34 90

По месту нахождения (учёта) (код) — полный перечень приведён в Приложении № 4 к Порядку заполнения, наиболее распространёнными являются « 120» для ИП и «214» для организаций.

Наименование организации — полное наименование налогоплательщика из учредительных документов.

Среднесписочная численность — указывается численность персонала, которая рассчитывается в соответствии п. 76—79.11 приказа Росстата от 27 ноября 2019 года № 711.

Код по ОКВЭД2 — значение из классификатора ОКВЭД2, соответствующее виду осуществляемой деятельности.

Далее представлен блок, заполняемый в случае реорганизации (ликвидации) организации.

Номер контактного телефона отражается с кодом страны и города. Все цифры прописываются подряд без пропусков и иных символов.

Отражается количество листов декларации

, а при наличии — количество листов подтверждающих документов.

В завершении указывается ФИО лица, удостоверяющего достоверность и полноту представленных сведений.

Подпись и дата.

Титульный лист

Раздел 1

Если компания в отчётном периоде проводила выплаты своим сотрудникам, то по строке 001 «Тип плательщика (код)» указывается цифра 1, для тех кто не производил выплаты предусмотрен код 2. Соответственно, в первом случае в строках 031-033 должны быть указаны соответствующие начисления, во втором – проставлены нулевые значения.

Для строк 111-113 предусмотрены исключения. Это сделано для возможности отражения в расчёте возмещения расходов в связи с временной нетрудоспособностью сотрудников, даже в том случае, когда заработная плата не начислялась.

Нулевая отчётность должна состоять из титульного листа, Раздела 1 без приложений, в котором будет указан код 2, и Раздел 3 без таблицы 3.2.

Раздел 1  состоит из 9 приложений.

Если в отчётном периоде компанией применялось несколько тарифов, то Приложение 1 к Разделу 1, как и прежде заполняется в нескольких экземплярах. Код тарифа указывается в соответствии с проведёнными изменениями в классификаторе. Обратите внимание, что в новой форме исключены коды 02 и 03. Для тех, кто применяет основной тариф начисления страховых платежей, предусмотрен код 01, который указывается независимо от выбранной системы налогообложения. Также из реестра убраны коды 04 и 05, которые проставлялись в случае использования пониженных тарифных ставок. В связи с внесёнными изменениями в законодательство действие таких льгот прекращено.

В реестр в течение года были введены следующие коды:

Новый код Кто указывает
17 Организации из единого реестра резидентов Особой экономической зоны в Калининградской области (Федеральный закон от 10.01.2006 № 16-ФЗ)
18 Российские компании, которые производят и продают свою анимационную аудиовизуальную продукцию независимо от вида договора и (или) оказание услуг (выполнение работ) по созданию анимационной аудиовизуальной продукции
19 Плательщики взносов со статусом участника специального административного района (Федеральный закон от 03.08.2018 № 291-ФЗ), которые платят членам экипажа судна за исполнение трудовых обязанностей. Суда должны быть зарегистрированы в Российском открытом реестре судов

В Подразделе 1.1 и 1.2 Приложения 1 присутствует строка 045, которая  предназначена для формирования суммы расходов, принимаемых к вычету, которые имеют отношение к получению дохода по договорам, перечисленным в п. 8 ст. 421 НК РФ. В данной строке отражаются расходы, которые имеют документальное подтверждение, а также те, что принимаются к вычету в установленных размерах, независимо от наличия документального подтверждения.

В новой форме Расчёт по страховым взносам в Приложении 2 появилась новая строка «Код тарифа плательщика». Теперь, при одновременном использовании разных тарифов данный раздел нужно будет заполнять на нескольких листах, по аналогии с Приложением 1. Также в форму добавлена новая

строка 015 для отражения количества людей, с выплат которых начислены страховые платежи.

Блок строк 001-006 предназначен для указания начислений по каждому отдельному тарифу. В строках 070-090 указываются общие суммы по всем применяемым тарифам. Строка 055 предназначена для указания налоговой базы, с которой начисляются взносы лицам без гражданства по ставке 1,8%.

Приложение 5 разработано для расчёта соответствия условий применения IT-компаниями пониженного тарифа в соответствии с пп. 3 п. 1 ст. 427 НК РФ.  При заполнении раздела в новой РСВ нужно использовать новые коды тарифов. В таблицу также добавлена новая строка 060 для отражения сведений о регистрации компании в форме резидента особой зоны.

Добавлено Приложение № 5.1, которое заполняется в случае применения пониженного тарифа.

Приложение 6 также предназначено для определения правомерности применения пониженного тарифа для некоммерческих организаций, применяющих УСН и тарифы, установленные пп. 3 п. 2 ст. 427 НК РФ.

Приложение 7 заполняют организации, которые заняты производством анимационной и аудиовизуальной продукции с применением пониженного тарифа, установленного пп. 6 п. 2 ст. 427 НК РФ. В новой редакции расширен перечень кодов (см. Приложение № 7 РСВ)

Приложение 8 предназначено для информации по временно пребывающим иностранным гражданам, которые уплачивают взносы по ставке 1,8%. Ранее такие сведения отражались в приложении 9.

Приложение 9 заполняют страхователи, имеющие сотрудников, которые проходят обучение или работают в студенческих отрядах. Пенсионные взносы с данных выплат не начисляются. В предыдущей редакции для таких страхователей отводилось приложение 10.

Раздел 2

Данный раздел формы Расчёт по страховым взносам полностью предназначен для крестьянских и фермерских хозяйств. Новые изменения коснулись только Приложения 1, где при указании личных данных членов хозяйства теперь нужно будет прописывать паспортные данные, пол и дату рождения и полностью. Заполнение данного раздела не представляет особой сложности.

Раздел 3

Рассматриваемая форма предназначена для отражения персонифицированных сведений. Для подраздела 3.2.2 разработана новая кодировка, устанавливающая основание начисления взносов по дополнительному тарифу и в соответствии с условиями труда.

Новые коды застрахованных лиц в подразделе 3.2.2
Код Наименование
110 Занятые на видах работ, указанных в п. 1 ч. 1 ст. 30 400-ФЗ, в отношении выплат которых применён доптариф (п. 1 ст. 428 НК РФ)
120 Занятые на видах работ, указанных в п. 2–18 ч. 1 ст. 30 400-ФЗ, в отношении выплат которых применён доптариф (п. 2 ст. 428 НК РФ)
131 Занятые на видах работ, указанных в п. 1 ч. 1 ст. 30 400-ФЗ, класс условий труда — вредный, подкласс условий труда — 3.1
132 Занятые на видах работ, указанных в п. 1 ч. 1 ст. 30 400-ФЗ, класс условий труда — вредный, подкласс условий труда — 3.2
133 Занятые на видах работ, указанных в п.  1 ч. 1 ст. 30 400-ФЗ, класс условий труда — вредный, подкласс условий труда — 3.3
134 Занятые на видах работ, указанных в п. 1 ч. 1 ст. 30 400-ФЗ, класс условий труда — вредный, подкласс условий труда — 3.4
140 Занятые на видах работ, указанных в п. 1 ч. 1 ст. 30 400-ФЗ, класс условий труда — опасный, подкласс условий труда — 4
231 Занятые на видах работ, указанных в п. 2–18 ч. 1 ст. 30 400-ФЗ, класс условий труда — вредный, подкласс условий труда — 3.1
232 Занятые на видах работ, указанных в п. 2–18 ч. 1 ст. 30 400-ФЗ, класс условий труда — вредный, подкласс условий труда — 3.2
233 Занятые на видах работ, указанных в п. 2–18 ч. 1 ст. 30 400-ФЗ, класс условий труда — вредный, подкласс условий труда — 3.3
234 Занятые на видах работ, указанных в п. 2–18 ч. 1 ст. 30 400-ФЗ, класс условий труда — вредный, подкласс условий труда — 3. 4
240 Занятые на видах работ, указанных в п. 2–18 ч. 1 ст. 30 400-ФЗ, класс условий труда — опасный, подкласс условий труда — 4

Раздел 3

Правила предоставления корректировочных сведений

При обнаружении ошибки в ранее предоставленном расчёте или при недоплате взносов обязательно сдаётся уточнённый расчёт. Он должен состоять из тех же приложений, которые были поданы ранее. В уточняющем документе обязательно указывается номер корректировки.

Если вам нужно отменить ранее предоставленные сведения, то в строке 010 Раздела 3 необходимо проставить признак аннулирования «1», а строки 130-170, 190-210 оставить незаполненными.

Если в ранее представленном расчёте обнаружена ошибка в личных данных застрахованного лица, то порядок заполнения коррекционного отчёта будет следующим:

  1. Страхователь заполняет Раздел 3 с ошибочными сведениями и указывает в нём признак аннулирования «1», в подразделе 3. 2.1 ставятся прочерки.
  2. Раздел 3 заполняется ещё раз, в него вносятся исправленные данные и заполняется подраздел 3.2.1. В этом случае признак аннулирования уже не указывается.

В итоге в состав уточнённого расчёта войдёт два листа: один с ошибочными сведениями, а второй правильный. Для уточнения других неточностей в Разделе 3 необходимо просто ещё раз подать документ с указанием верной информации. При этом в персонифицированный раздел должен быть заполнен полностью, а не только исправленные строки.

Бланк формы РСВ на 2021 год

Скачать бланк формы РСВ на 2020—2021 года в формате .xls

Образец заполнения РСВ за IV кв. 2020 года

Скачать образец заполнения РСВ за IV квартал 2020 года в формате .xls

Нормативно-правовая база

Как заполнить РСВ с нулевым тарифом по взносам — СКБ Контур

РСВ — что изменилось из-за коронавируса
Как заполнить РСВ с нулевым тарифом
Как заполнить приложения 1 и 2 к разделу 1
Как заполнить раздел 3
Новые контрольные соотношения для нулевого тарифа

РСВ — что изменилось из-за коронавируса

Коронавирус стал причиной множества изменений по страховым взносам. Сначала государство ввело пониженный тариф 15 % для всех субъектов МСП, а затем дополнительно установило нулевой тариф для наиболее пострадавших отраслей. Поэтому РСВ за это полугодие компании заполняют одним из трёх способов — по стандартным, пониженным и нулевым тарифам.

Мы рассказывали, как считать взносы с пониженным тарифом и заполнять РСВ.

Освобождение от налогов и взносов за второй квартал регулирует Федеральный закон от 08.06.2020 № 172-ФЗ.  Нулевой тариф действует для страховых взносов на ОПС, ОМС, и ВНиМ за период апрель — июнь 2020 года. Это касается как выплат в рамках предельной базы, так и сверх неё.

Льгота действует для наиболее пострадавших ИП и организаций, которые попали в реестр МСП по результатам отчётности за 2018 год. Также она распространяется на некоторые социально ориентированные НКО. Проверить своё право на льготу можно по ИНН в специальном сервисе ФНС.

Как изменится РСВ с 2021 года: среднесписочная численность, новые коды и приложения

Как заполнить РСВ с нулевым тарифом

От страховых взносов работодателей освободили, но расчёт сдать все равно придётся. ФНС разъяснила, что о применении нулевого тарифа работодатели смогут заявить через сдачу полугодового РСВ с нулевыми начислениями за II квартал. Если вы уже сдали расчёт и указали в нём суммы за апрель-июнь, заполните новый экземпляр по инструкции и сдайте как уточнёнку (информация ФНС России от 10.07.2020).

Подготовить и сдать РСВ через интернет бесплатно

Для подготовки расчёта за первое полугодие используйте стандартный бланк РСВ, утверждённый приказом ФНС от 18.09.2019 N ММВ-7-11/[email protected] Правила заполнения налоговая разъяснила в письме от 09.06.2020 № БС-4-11/[email protected]

В расчёте страховых взносов заполните:

  • титульный лист;
  • раздел 1;
  • приложение 1 к разделу 1;
  • приложение 2 к разделу 1;
  • раздел 3.

Титульный лист и первый раздел заполняйте в стандартном порядке — тут изменений нет. Помните, что раздел 1 заполняется нарастающим итогом с начала года, поэтому нужно просуммировать соответствующие строки по каждому виду взносов из всех строк листов по разным тарифам. Но за апрель, май и июнь в первом разделе проставьте нули.

В отношении остальных листов появились новые разъяснения.

Как заполнить приложения 1 и 2 к разделу 1

Приложения 1 и 2 заполните в двух экземплярах — по одному для каждого тарифа (обычного и нулевого).

В первом экземпляре приложения поставьте код тарифа плательщика «01» и заполните его только данными по взносам за первый квартал. Укажите нарастающим итогом суммы выплат с 1 января по 31 марта. В графах 2, 3 и 4 проставьте нули, так как они предназначены для начислений за последние три месяца, а эти данные мы поместим в отдельный экземпляр.

В строке 001 «Код тарифа плательщика» для тарифа 0 % укажите код «21». Покажите в приложениях с этим кодом только начисления за II квартал — в общей сумме и по месяцам. В строке 060 Заполните все 4 поля нулями, так как за второй квартал взносы начислены по тарифу 0 %. Страницы нумеруйте по порядку, дублировать номера не надо.

Необлагаемые выплаты включайте в отчёт в соответствии с тем периодом, к которому они относятся. Если они отнесены к февралю, впишите их в отчет с кодом «01», если к маю — в отчет с кодом «21».

Проверить бесплатно, выполняются ли в РСВ новые контрольные соотношения

Как заполнить раздел 3

Раздел 3 заполните на каждого работника в одном экземпляре — для нулевого тарифа по взносам. В строке 130 подраздела 3.2.1 укажите код категории застрахованного лица из письма ФНС от 09.06.2020 № БС-4-11/[email protected] Всего есть три кода категории:

  • КВ — для работников-граждан РФ;
  • ВПКВ — для работников из числа временно пребывающих иностранцев и лиц без гражданства;
  • ВЖКВ — для работников из числа застрахованных в системе ОПС иностранных граждан или лиц без гражданства, временно пребывающих в РФ, а также временно пребывающие в РФ беженцы.

Заполняйте раздел 3 в общем порядке, но в строках, где вы обычно показываете взносы, проставьте нули.

Бизнес из реестра МСП, который власти не отнесли к перечню наиболее пострадавших, тоже получил льготу. Такие работодатели платят взносы с части зарплаты, превышающей федеральный МРОТ по ставке 15 %. Для заполнения РСВ при этом предусмотрен иной порядок. Мы рассказывали, как заполнить расчёт по сниженным тарифам для страховых взносов. 

Новые контрольные соотношения для нулевого тарифа

Новые контрольные соотношения для расчёта по нулевым тарифам ФНС опубликовала в письме от 10.06.2020 N БС-4-11/9607. Они дополняют предыдущий перечень контролей для формы РСВ (письмо ФНС от 07.02.2020 № БС-4-11/[email protected]).

Всего добавили три новых контрольных соотношения, но суть у всех одна. Рассмотрим на примере первого: «При наличии подр 1.1 прил. 1 р. 1 СВ по значению поля 001 прил. 1 р. 1 СВ = 21 обязательность соблюдения условий для применения пониженных тарифов страховых взносов, установленных статьей 3 Федерального закона от 08.06.2020 N 172-ФЗ». Аналогичные правила действуют для подраздела 1.2 приложения 1 и приложения 2.

Это значит, что заполнять РСВ по нулевым тарифам с кодом «21» можно только в том случае, если вы соответствуете условиям освобождения из Федерального закона от 08. 06.2020 № 172-ФЗ. ФНС будет это проверять.

РСВ за 2 квартал для пострадавших отраслей по нулевой ставке - как заполнить

Кто попал в льготники по нулевой ставке взносов

Какие новшества для бухгалтера введены с 01.07.2020, узнайте в статье.

В качестве очередной меры поддержки малого бизнеса установлены нулевые ставки по взносам для отраслей экономики наиболее пострадавших от коронавируса.

Нулевые ставки введены федеральным законом от 08.06.2020 № 172-ФЗ.

Кто относится к льготникам? Определяется это аналогичным способом, как и то, кто мог получить субсидию или отсрочку по уплате налогов за 2019 год и первый квартал 2020 года.

Какие критерии должны быть соблюдены, чтобы уплачивать взносы за второй квартал по нулевым ставкам:Актуальный перечень пострадавших отраслей вы найдете в статье.

Какие именно выплаты облагаются по нулевым ставкам:Обращаем внимание, что к взносам на травматизм данная льгота не имеет отношения.

В связи с нововведениями возникает резонный вопрос: как это отразится на заполнении отчетов, связанных с начислением выплат, облагаемых по льготной нулевой ставке? Ниже рассмотрим, что изменилось в РСВ за 2 квартал 2020 года. 

Поправки в РСВ из-за применения льготной ставки

Смещения представления расчета на несколько месяцев по взносам в начале 2020 года не было ни для кого, даже для тех, кто вошел в перечень пострадавших предприятий. Была небольшая корректировка сроков в связи с нерабочими днями.Вопреки ожиданиям отчетность по взносам за полугодие-2020 придется сдавать по старой форме. К полугодовой отчетной кампании новая форма РСВ за 2 квартал 2020 года так и не была утверждена. Скорее всего, обновленный вариант бланка появится лишь по итогам 2020 года.

Пользуемся бланком из приказа ФНС от 18.09.2019 № ММВ-7-11/470.

В связи с новшествами в расчетах взносов во втором квартале 2020 года, есть особенности заполнения расчета по взносам:Ниже опишем порядок заполнения РСВ за полугодие-2020 при нулевой ставке, а также приведем пример заполнения РСВ для МСП за полугодие-2020.

Как заполнить другие отчеты при условии списания налогов, читайте в статье.

Подпишитесь на рассылку

Корректное заполнение полугодового РВС

Порядок заполнения приложений 5, 6, 7 и других подробно изложен в готовом решении «КонсультантПлюс». Еще больше актуальной информации вы получите, если оформите пробный бесплатный доступ к К+.

Процесс внесения данных в РСВ за 2 квартал 2020 при нулевом тарифе налоговая пояснила в своих разъяснениях.

Для заполнения расчета пользуемся письмом ФНС от 09.06.2020 № БС-4-11/9528.

По сути, заполнение РСВ за 2 квартал 2020 при льготах не сильно отличается от обычного порядка составления расчета по взносам. Основное отличие — добавление нового кода в нулевой РСВ за 2 квартал 2020 года в целях обозначения сумм выплат, облагаемых по льготным ставкам, как пониженным, так и нулевым.

Состав формы в общем случае прежний:Титульный лист и раздел 1 не претерпели изменений. Они заполняются в обычном порядке.

РСВ заполняется нарастающим итогом, то есть в расчет за полгода попадут и начисления за первый квартал, облагаемые по обычным ставкам, и начисления за второй квартал, облагаемые нулевыми ставками. Вот эти выплаты надо разделить.

Для этого заполняем по два экземпляра приложений 1 и 2. В одном экземпляре указываем код тарифа плательщика, как обычно, а в другом — код тарифа плательщика — 21, который и указывает на право применения нулевых ставок взносов.

В раздел 1 попадают сводные данные из всех приложений.

Для раздела 3 также были введены коды категории застрахованного лица:Образец, как заполнить МСП РСВ за полугодие-2020, вы найдете в начале статьи.

***

Применение некоторыми предприятиями нулевых ставок по взносам во втором квартале 2020 года привело к необходимости по-новому заполнять расчет по страховым взносам. Следует разделить в нем выплаты, облагаемые в первом квартале обычными ставками, и выплаты второго квартала, облагаемые нулевыми ставками. Приложения 1 и 2 заполняются дважды — с разными кодами тарифа. В разделе 3 также введены новые коды категории застрахованного лица.

Еще больше полезным материалов в разделе — «Страховые взносы».

Более полную информацию по теме вы можете найти в КонсультантПлюс.
Пробный бесплатный доступ к системе на 2 дня.

Новые коды в РСВ за 2 квартал 2020

В качестве одной из мер поддержки малого и среднего бизнеса власти обнулили страховые взносы за 2 кв. 2020 года. В связи с этим, заполнение расчета по взносам за этот период имеет свои особенности. Для этого ФНС утвердила специальные новые коды для РСВ за 2 квартал 2020 года.

Также смотрите:

Списание страховых взносов за 2 квартал 2020

С 8 июня 2020 года действует Федеральный закон от 08.06.2020 № 172-ФЗ (далее – Закон № 172-ФЗ) с изменениями Налоговый кодекс РФ. Помимо прочего, он отменил уплату страховых взносов на ОПС, ВНиМ и ОМС за 2 квартал 2020 года.

Подробнее об этом на нашем сайте смотрите в материале «Особенности уплаты страховых взносов организациями и ИП за 2 квартал 2020 года».

Коды для РСВ за 2 квартал 2020

В письме от 09.06.2020 № БС-4-11/9528 ФНС России указала, что до внесения соответствующих изменений в Порядок заполнения расчета по страховым взносам (утв. приказом ФНС от 18.09.2019 № ММВ-7-11/470) при заполнении РСВ за 2 кв. 2020 нужно использовать следующие коды.

Что касается кода тарифа плательщика, применяющие пониженные тарифы страховых взносов (ставка 0% в данном случае) в соответствии с положениями Закона № 172-ФЗ указывают в расчете код «21».

Коды категории застрахованного лица пострадавшие от коронавируса плательщики при заполнении подразд. 3.2.1 «Сведения о сумме выплат и иных вознаграждений, начисленных в пользу физического лица» раздела 3 расчета используют следующие:

КВ Физлица, с выплат и вознаграждений которым исчисляют страховые взносы по ставке 0% в соответствии с Законом № 172-ФЗ
ВЖКВ Застрахованные в системе обязательного пенсионного страхования иностранцы или лица без гражданства, временно проживающие на территории РФ

Временно пребывающие на территории РФ иностранцы или лица без гражданства, которым предоставлено временное убежище в соответствии с Законом от 19. 02.1993 № 4528-1 «О беженцах»

ВПКВ Иностранцы или лица без гражданства (кроме высококвалифицированных специалистов), временно пребывающие в России

В письме ФНС особо отмечено, что эти коды применяют при заполнении расчета по страховым взносам за полугодие (6 месяцев, 2 квартал) 2020 года.

Как заполнить РСВ за полугодие 2020 года при применении пониженных тарифов (15%) и при освобождении от уплаты страховых взносов за II квартал?

Организации и ИП, которые применяют пониженные тарифы, как и остальные плательщики взносов, заполняют Расчет по форме, утвержденной Приказом ФНС России от 18.09.2019 N ММВ-7-11/[email protected]

Потребуется заполнить два приложения 1 и два первых листа приложения 2 – для выплат, облагаемых по обычным и пониженным тарифам. В разделе 3 такие выплаты надо показать в отдельных подразделах 3.2.1.

Выплаты, облагаемые по общему тарифу, отражаются в приложениях 1 и 2 с кодом тарифа 01. Код категории застрахованного лица в подразделе 3.2.1 – НР, у иностранцев – ВЖНР или ВПНР.

Для выплат, облагаемых по тарифу 15%, нужно заполнить приложение 1 и первый лист приложения 2 с кодом тарифа 20. В разделе 3 такие выплаты отражаются в подразделе 3.2.1 с кодом категории застрахованного лица МС, а для иностранцев – ВЖМС или ВПМС (Контрольные соотношения).

См. Пример. Расчет по взносам за полугодие 2020 года при пониженных тарифах 

Если применяется тариф 0%, на выплаты за апрель – июнь заполняется приложение 1 и первый лист приложения 2 с кодом тарифа 21 (пп. 5.4, 10.1 Порядка заполнения Расчета).

В разделе 3 расчета за полугодие ставится код категории застрахованного лица КВ, а для иностранцев – ВЖКВ или ВПКВ.

См. Пример. Расчет по взносам за полугодие 2020 года при тарифе 0%

Напомним, РСВ за полугодие сдается в обычный срок – не позднее 30 июля 2020 года.

На заметку: ФНС разъяснила, как малому и среднему бизнесу платить страховые взносы с выплат временно пребывающим иностранцам после 1 апреля 2020 года. Читайте об этом в обзоре на нашем сайте.

Читайте подробнее

Рсв за 2 квартал 2020 нулевая

Если предпринимательская деятельность не велась, зарплата работникам не начислялась и не выплачивалась, но вы зарегистрированы в качестве работодателя, РСВ все равно нужно подать. Нулевой отчет подается и в случае отсутствия начислений взносов за работников. Раздел 1 включает в себя информацию по расчетам пенсионных, медицинских взносов, а так же по взносам на страхование по временной нетрудоспособности и в связи материнством. Используя карточку учета страховых взносов, отражающую начисленные и выплаченные физическим лицам выплаты и вознаграждения в отчетном периоде в году, последовательно заполняются строки от до При этом строка заполняется нарастающим итогом с начала года, а строки ; ; заполняются ежемесячными данными.

ВИДЕО ПО ТЕМЕ: Изменения законодательства в 2019 г. Страховые взносы и отчетность в ПФР.

Дорогие читатели! Наши статьи рассказывают о типовых способах решения юридических вопросов, но каждый случай носит уникальный характер.

Если вы хотите узнать, как решить именно Вашу проблему - обращайтесь в форму онлайн-консультанта справа или звоните по телефонам, представленным на сайте. Это быстро и бесплатно!

Расчет по взносам за 3 квартал 2019 года: сроки сдачи

Расчет по страховым взносам: суть, форма и варианты отчета. Образец расчета по страховым взносам за 1 квартал года. Типичные ошибки в РСВ и возможность их исправления без санкций.

Расчет по страховым взносам за 1 квартал года фискалы планируют обновить к первой отчетной кампании года.

Подробности см. И сама форма, и правила внесения данных в нее действуют с начала года, т. В связи со сменой куратора взносов который стал единым изменилась и форма отчета, ставшего общим для всех видов взносов, подпавших под контроль ИФНС. Расчет по страховым взносам РСВ обязателен к формированию для всех работодателей, в т.

В последнем случае может возникать необходимость сдачи отчета с нулевыми показателями в основных разделах письмо ФНС России от Обязательными для заполнения большинством составителей РСВ являются титульный лист, разделы 1 и 3, посвященные, соответственно, общим данным об исчислении взносов и персональным сведениям о получателях доходов, на которые начисляются взносы.

К разделу 1 предусмотрено 10 приложений, заполнить первое и второе из которых нужно непременно они отведены начислениям по основным тарифам , а остальные — по мере необходимости.

Раздел 2 предназначен для глав фермерских хозяйств и поэтому используется нечасто. На нашем форуме можно получить ответ на любой вопрос, возникший у вас в ходе заполнения и сдачи отчетности по взносам.

В силу этого абсолютная корреляция данных между этими разделами имеет место только в отчете за 1 квартал. Соответственно, отчет за этот период проще всего заполнить и достаточно легко проверить.

Отличия свелись к тому, что из единого отчета исключены:. Но ФНС России письмами неоднократно давала разъяснения по отдельным вопросам применения этого приказа. Из этих разъяснений следует отметить последний по времени документ письмо ФНС России от Составляя расчет страховых взносов за 1 квартал года, на его титульном листе нужно указать код периода, соответствующий 1 кварталу Скачать образец.

Срок сдачи отчета установлен на е число месяца, наступающего после окончания отчетного периода п. Однако на него влияют совпадения с выходными днями.

Но конечная дата срока сдачи расчета страховых взносов за 1 квартал года совпадает с общеустановленным и приходится на Способов сдачи существует два: электронный и бумажный.

Последний доступен лицам, отчитывающимся за работников, общее количество которых не превышает В момент приемки налоговым органом осуществляется входной контроль на предмет наличия расхождений п. Если такие расхождения выявлены, ИФНС извещает подателя отчетности о непринятии отчета и обнаруженных несоответствиях.

Оперативное уточнение РСВ дает возможность считать его сданным в дату подачи первого оказавшегося непринятым отчета. Составляя РСВ за 1 квартал года, следует ориентироваться на форму этого отчета и правила его заполнения, применяемые с начала года.

Сдача его обязательна для всех работодателей, в т. Срок подачи отчета за 1 квартал года истечет Подписывайтесь на новости. Подписаться ОК. Присоединяйтесь к нам в соц.

РСВ за 1 квартал - пример заполнения этого отчета приводим ниже - первый из отчетов по страховым взносам, составляемых нарастающим итогом за год. Рассмотрим, в чём состоят особенности его оформления.

Скачать форму Расчет по страховым взносам РСВ обязателен к формированию для всех работодателей, в т. Образец расчета по страховым взносам за 1 квартал года РСВ — отчет, составляемый ежеквартально, но данные его формируются по-разному: в разделе 1 — нарастающим итогом в течение года с выделением данных, относящихся к месяцам последнего квартала отчетного периода; в разделе 3 — только за последний квартал отчетного периода.

Отличия свелись к тому, что из единого отчета исключены: данные об итогах расчетов с фондами на начало года и на конец периода составления отчета; сведения о реквизитах документов на уплату взносов; информация о стаже работников. Образец заполнения РСВ за 1 квартал года смотрите на нашем сайте.

Скачать образец Типичные ошибки в РСВ и возможность их исправления без санкций Срок сдачи отчета установлен на е число месяца, наступающего после окончания отчетного периода п. Итоги Составляя РСВ за 1 квартал года, следует ориентироваться на форму этого отчета и правила его заполнения, применяемые с начала года.

Подписывайтесь на наш бухгалтерский канал Яндекс. Добавить в закладки. Предыдущая статья Следующая статья.

Советуем прочитать. Последнее с форума. Ваш вопрос.

Нулевой РСВ-1 за 2 квартал: образец

В каких случаях сдается нулевой РСВ и обязательно ли его подавать. Где скачать образец заполнения нулевого РСВ за 1 квартал года. Как сдать нулевой отчет по страховым взносам.

Действующий расчет по страховым взносам за 2 квартал - это единственный отчетный формуляр, который объединяет в себе информацию обо всех видах страхового обеспечения, зачисляемого страхователями в ИФНС. Инструкция по заполнению представлена в том же Приказе. Рассмотрим подробный алгоритм заполнения.

Заполнить РСВ онлайн. Все права защищены. Этот документ спасет от обидных штрафов и защитит от ошибок. Зарегистрируйтесь, скачайте и сразу используйте в работе!

Пример заполнения РСВ за 1 квартал 2019 года

Там же вы найдете бланк, введение которого запланировано на год. Кроме того, введены новые сроки подачи отчетности. Дело в том, что еще в июле года был опубликован проект приказа о внесении изменений в форму РСВ. Предполагалось, что уже в году отчетность по страховым взносам будет сдаваться по новой форме. Затем сроки принятия новой формы были перенесены на начало года, однако, и в году бланк так и не был утвержден. Поэтому весь год работодатели сдают отчет РСВ на старом бланке, утвержденном еще в году. Согласно последней информации, новый бланк РСВ станет актуальным в году. И на этот раз, судя по всему, его действительно введут. Независимо от формата подачи отчетности, отчет РСВ предоставляется ежеквартально, в срок до 30 числа месяца , который следует за отчетным периодом. В и в годах, разрешается сдавать на бумажном носителе организациям и ИП, численность работников которых не превышает 25 человек.

Как заполнить нулевой расчет по страховым взносам за 3 квартал 2018 года: пример

Страховые взносы в году: изменения. Корректирующий расчет по страховым взносам Пониженные тарифы страховых взносов. Ошибки в расчете по страховым взносам. Как рассчитать страховые взносы в году.

Нулевая форма РСВ-1 за 2 квартал предоставляется в территориальном отделение Пенсионного Фонда РФ всеми организациями, которые не осуществляли в рамках отчетного периода активную деятельность или не имели в штате сотрудников.

Внимание: если начисляется и выплачивается заработок, с которого высчитывается страховой взнос, то форму подавать обязательно. У компаний бывают ситуации, когда по разным причинам нет никаких выплат работникам. Так как показатели в отчетах нулевые, некоторые принимают решение их не сдавать.

Как заполнить нулевой расчет по страховым взносам

Такая обязанность исходит из того, что все российские фирмы проходят процедуру регистрационного учета в Пенсионном фонде в качестве работодателей. Полностью нулевым т. Из-за этого наиболее часто создаваемым с нулевыми данными оказывается РСВ, формируемый за 1 квартал.

ПОСМОТРИТЕ ВИДЕО ПО ТЕМЕ: Новый расчет по страховым взносам за первый квартал 2017 года

Расчет по страховым взносам: суть, форма и варианты отчета. Образец расчета по страховым взносам за 1 квартал года. Типичные ошибки в РСВ и возможность их исправления без санкций. Расчет по страховым взносам за 1 квартал года фискалы планируют обновить к первой отчетной кампании года. Подробности см. И сама форма, и правила внесения данных в нее действуют с начала года, т.

Расчет по страховым взносам за 2 квартал 2019 года: новая форма и образец

Единая форма расчёта по страховым взносам введена Налоговой службой с начала года после передачи администрирования взносов пенсионного и медицинского страхования в ведение ведомства. Подать новую форму РСВ в налоговую инспекцию необходимо до конца месяца, следующего за очередным кварталом, для 1 квартала года установленный срок 30 апреля был перенесен на 3 мая. Несвоевременное и некорректное заполнение отчета может привести к наложению штрафов на организацию. Отчет содержит расшифровку начислений в зависимости от количества персонала и типа уплачиваемых взносов. Новая форма РСВ используется ФНС для контроля за расчетом и перечислением страховых взносов с января года вместо четырех шаблонов отчетности, применявшихся ранее. В конце года была предложена корректировка РСВ, на момент сдачи отчетов за первый отчётный период январь-март года соответствующий приказ не был утвержден.

Действующий расчет по страховым взносам за 2 квартал - это единственный отчетный формуляр, который объединяет в себе информацию обо всех видах страхового обеспечения, зачисляемого страхователями в ИФНС.

Нулевая отчетность в ПФР состоит из трех листов: титульного, раздела 1 и 2 подраздел 2. На каждом листе не забудьте поставить дату, подпись и регистрационный номер в ПФР в самом верху. Все сотрудники компании в административном отпуске? К этим разделам добавьте раздел 6 и подраздел 2. На сотрудников в административном отпуске компания должна представить раздел 6 с кодом "НЕОПЛ", ведь с ними действуют трудовые договоры.

Заполнение нулевого РСВ за 1 квартал 2019 года

Требуется ли сдавать нулевой РСВ-1 за 2 квартал? Как заполнять нулевые расчеты? Ответы на эти и другие вопросы вы найдете в нашей статье. По итогам 2 квартала года все страхователи организации и ИП должны отчитаться перед ПФР о взносах на обязательное пенсионное и медицинское страхование, которые рассчитывались с выплат в пользу работников.

Нулевой Отчет Рсв За 1 Квартал 2019 Года

Нулевой расчет по страховым взносам РСВ за 9 месяцев года — пример заполнения этого отчета может понадобиться тем хозяйствующим субъектам, у которых отсутствовала деятельность и не производились отчисления на работников. Все, что необходимо знать о правилах его оформления и представления, вы найдете в этой статье. Также см.

Подайте нулевой расчет по страховым взносам за 3 квартал года, даже если организация не ведет деятельность и не выдает зарплату, а из сотрудников только директор. Иначе инспекторы выпишут штраф.

Сдача промежуточной отчетности может быть отменена местными властями. Форма подачи аналогична 6-НДФЛ. Порядок оплаты также устанавливается местным законом. Порядок уплаты этого налога устанавливает региональное законодательство.

Расчет по страховым взносам за 2 квартал года: образец заполнения. Новый бланк расчета страховых взносов Корректирующий расчет по страховым взносам Единый расчет по страховым взносам форма. Сдача РСВ за 2 квартал года обязательна для всех работодателей — они должны регулярно отчитываться о доходах своих наемных сотрудников, об объеме перечисленных в бюджет страховых отчислений с заработков персонала и сумме начисленных, выплаченных социальных пособий. Отчет подается в налоговую инспекцию, которая является администратором страховых взносов, за исключением отчислений на травматизм. По страховым взносам отчетных периодов несколько — 1 квартал, полугодовой интервал, 9 месяцев.

.

Расчет по страховым взносам (КНД 1151111) / КонсультантПлюс

Применяется - с отчетности за 2020 год

Утверждена - Приказом ФНС России от 18.09.2019 N ММВ-7-11/[email protected]

 

Срок сдачи - не позднее 30-го числа месяца, следующего за расчетным (отчетным) периодом

 

Внимание! Плательщики, у которых численность физических лиц, в пользу которых начислены выплаты и иные вознаграждения, за расчетный (отчетный) период превышает 10 человек, а также вновь созданные (в том числе в результате реорганизации) организации, у которых численность указанных физических лиц превышает данный предел, представляют расчеты в электронной форме.

 

Скачать форму расчета по страховым взносам:

- в TIF (данный TIF-шаблон рекомендован ФНС России и размещен на сайте АО "ГНИВЦ" www.gnivc.ru)- в PDF (данная машиночитаемая форма доступна для заполнения в программе Adobe Reader (программа размещена на сайте www.adobe.com))

 

Образец заполнения расчета по страховым взносам >>>

 

Материалы по заполнению расчета по страховым взносам:

- Приказ ФНС России от 18.09.2019 N ММВ-7-11/[email protected] Письмо ФНС России от 29.01.2021 N БС-4-11/[email protected] Письмо ФНС России от 22.01.2021 N БС-4-11/[email protected]

- Готовое решение: Как заполнить и представить в налоговый орган расчет по страховым взносам за отчетные (расчетный) периоды 2021 г.

- Готовое решение: Как учреждению заполнить и представить расчет по страховым взносам за отчетные (расчетный) периоды 2021 г.

- Готовое решение: Как заполнить расчет по страховым взносам при применении пониженных тарифов

- "Годовой отчет для казенных учреждений - 2020" (под общ. ред. Ю.А. Васильева) ("БиТуБи", 2020)

- Статья: Новшества в заполнении РСВ и 4 - ФСС после перехода на прямые выплаты пособий (Шаронова Е.А.) ("Главная книга", 2021, N 7)

- Статья: РСВ за I квартал: какие обновления учесть при заполнении (Шаронова Е.А.) ("Главная книга", 2021, N 7)

- Статья: Что учесть при заполнении РСВ за I квартал 2021 года ("Практическая бухгалтерия", 2021, N 2)

- Статья: Особенности заполнения формы РСВ за I квартал 2021 года (Мухин С.) ("Казенные учреждения: бухгалтерский учет и налогообложение", 2021, N 3)

- Статья: Что учесть при заполнении обновленного РСВ за 2020 год (комментарий к Закону от 28.01.2020 N 5-ФЗ; Приказу ФНС от 15.10.2020 N ЕД-7-11/[email protected]) (Шаронова Е.А.) ("Главная книга", 2021, N 1)

- Статья: Нюансы отражения в расчете по страховым взносам среднесписочной численности ("Оплата труда: бухгалтерский учет и налогообложение", 2021, N 2)

- Статья: Расчет по страховым взносам: обновленная форма отчетности за 2020 год (Тишин А.П.) ("Актуальные вопросы бухгалтерского учета и налогообложения", 2020, N 12)

 

Архивные формы расчета по страховым взносам:

- расчет по страховым взносам с отчетности за I квартал 2020 года до отчетности за 2020 год

- расчет по страховым взносам с отчетности за I квартал 2017 года до отчетности за I квартал 2020 года

 

----------------------------------------

Открыть полный текст документа

Тестирование на респираторно-синцитиальный вирус (RSV)

Источники, использованные в текущем обзоре

Bozman M, et al. Диагностика респираторно-синцитиального вируса, профилактика и лечение осложнений. Фармацевт США . 2014; 39 (7): 31-34. Доступно в Интернете по адресу http://www.medscape.com/viewarticle/833507. По состоянию на ноябрь 2016 г.

Broadbent L, et al. Респираторно-синцитиальный вирус, постоянная медицинская дилемма. Вирусы респираторного гриппа . 2015; 9 (4): 169-178.Доступно в Интернете по адресу http://www.medscape.com/viewarticle/847350. По состоянию на ноябрь 2016 г.

(4 ноября 2014 г.) Центры по контролю и профилактике заболеваний. Респираторно-синцитиальная вирусная инфекция (RSV). Доступно в Интернете по адресу http://www.cdc.gov/rsv/index.html. По состоянию на ноябрь 2016 г.

(26 июля 2016 г.) Национальный институт аллергии и инфекционных заболеваний. Респираторно-синцитиальный вирус (RSV). Доступно в Интернете по адресу https://www.niaid.nih.gov/topics/rsv/Pages/Default.aspx. По состоянию на ноябрь 2016 г.

(Обновлено: 13.10.2016) Крылов Л. Респираторно-синцитиальные вирусные инфекции. Medscape Болезни. Доступно в Интернете по адресу http://emedicine.medscape.com/article/971488-overview. По состоянию на ноябрь 2016 г.

(март 2015 г.) Консультации ВОЗ по разработке вакцины против респираторно-синцитиального вируса (RSV). Доступно в Интернете по адресу http://www.who.int/immunization/research/meetings_workshops/rsv_vaccine_development/en/. По состоянию на ноябрь 2016 г.

Источники, использованные в предыдущих обзорах

Томас, Клейтон Л., Редактор (1997). Циклопедический медицинский словарь Табера. Компания F.A. Davis, Филадельфия, Пенсильвания [18-е издание].

Пагана, Кэтлин Д. и Пагана, Тимоти Дж. (2001). Справочник по диагностическим и лабораторным испытаниям Мосби, 5-е издание: Mosby, Inc., Сент-Луис, Миссури. (стр. 826-827).

(апрель 2003 г.). Сезон «гриппа» переходит в сезон «респираторного вируса». Медицинский центр Стэнфордского университета, LAB Letter [Электронный бюллетень]. PDF-файл доступен для загрузки по адресу http://www.stanfordhospital.com/pdf/labLetterApril2003.pdf.

(28 ноября 2003 г., проверено). Респираторно-синцитиальный вирус. CDC, Национальный центр инфекционных заболеваний, отделение респираторных и кишечных вирусов [онлайн-информация]. Доступно в Интернете по адресу http://www.cdc.gov/ncidod/dvrd/revb/respiratory/rsvfeat.htm.

Изенберг, Н. (июль 2003 г., проверено). Респираторно-синцитиальный вирус. KidsHealth for Parents, Фонд Nemours [Он-лайн информация]. Доступно в Интернете по адресу http://kidshealth.org/parent/infections/lung/rsv.html.

(7 января 2003 г.).CDC обнаружил, что ежегодная смертность от гриппа выше, чем предполагалось ранее. CDC по связям со СМИ [он-лайн пресс-релиз]. Доступно в Интернете по адресу http://www.cdc.gov/od/oc/media/pressrel/r030107.htm.

Graham, P. (30 октября 2003 г., обновлено). Респираторно-синцитиальный вирус (RSV). Медицинская информация MedlinePlus, Медицинская энциклопедия [он-лайн информация]. Доступно в Интернете по адресу http://www.nlm.nih.gov/medlineplus/ency/article/001564.htm.

Полак, М. (13 апреля 2004 г.). Респираторно-синцитиальный вирус (RSV): обзор, лечение и стратегии профилактики.Medscape, From Обзоры по уходу за новорожденными и младенцами [Электронный журнал]. Доступно в Интернете по адресу http://www.medscape.com/viewarticle/472399?src=search.

Эстрада, Б. (2004 г., 5 января). Педиатрический бюллетень, Что нового в RSV. Medscape, Infect Med 20 (11): 522, 2003. [Электронный журнал]. Доступно в Интернете по адресу http://www.medscape.com/viewarticle/465432?src=search.

Парк, Дж. И Барнетт, Д. (2002). Респираторно-синцитиальная вирусная инфекция и врач-терапевт.Medscape, South Med J 95 (3): 353-359, 2002 [Электронный журнал]. Доступно в Интернете по адресу http://www.medscape.com/viewarticle/431615.

(© 2004). Антитела к респираторно-синцитиальному вирусу, IgG и IgM. Руководство ARUP по клиническим лабораторным исследованиям [он-лайн информация]. Доступно в Интернете по адресу http://www.arup-lab.com/guides/clt/tests/clt_176b.jsp#1146861.

(© 2004). Респираторные вирусы. Руководство ARUP по клиническим лабораторным исследованиям [он-лайн информация]. Доступно в Интернете по адресу http: // www.arup-lab.com/guides/clt/tests/clt_177b.jsp#1146881.

(май 2003 г.). BD Directigen RSV. Бектон, Дикинсон и компания (BD) [Вставка тестового пакета].

Ву, А. (2006). Клиническое руководство по лабораторным исследованиям Тиц, четвертое издание. Сондерс Эльзевир, Сент-Луис, Миссури. С. 1596-1597.

Forbes, B. et. al. (© 2007). Диагностическая микробиология Бейли и Скотта, двенадцатое издание: Mosby Elsevier Press, Сент-Луис, Миссури. ПП 730-731, 745.

Раух, Д. (26 июля 2007 г., обновлено).Респираторно-синцитиальный вирус (RSV). Медицинская энциклопедия MedlinePlus [Он-лайн информация]. Доступно в Интернете по адресу http://www.nlm.nih.gov/medlineplus/ency/article/001564.htm. Доступно 29.07.08.

Мозинго Т. (2008, зима). RSV, когда это больше, чем просто холод. Здоровые дети, Американская академия педиатрии [он-лайн информация]. PDF-файл доступен для загрузки по адресу http://www.aap.org/family/healthychildren/08winter/HC-winter08-rsv.pdf. Доступно 29.07.08.

Персонал клиники Мэйо (1 августа 2007 г.).Респираторно-синцитиальный вирус. MayoClinic.com [Он-лайн информация]. Доступно в Интернете по адресу http://www.mayoclinic.com/health/respiratory-syncytial-virus/DS00414. Доступно 29.07.08.

(© 2007). Респираторно-синцитиальный вирус. Американская ассоциация легких [Он-лайн информация]. Доступно в Интернете по адресу http://www.lungusa.org/site/apps/nlnet/content3.aspx?c=dvLUK9O0E&b=2060721&content_id={AC999AD1-9FB2-4310-A642-FD850C2E82AC}¬oc=1. Доступно 29.07.08.

(© 2007). Информационный бюллетень о респираторно-синцитиальном вирусе.Американская ассоциация легких [Он-лайн информация]. Доступно в Интернете по адресу http://www.lungusa.org/site/apps/nlnet/content3.aspx?c=dvLUK9O0E&b=2060721&content_id={DEA9A6D1-58D5-4E47-8F36-6E0AAB65B977}¬oc=1. Доступно 29.07.08.

(2008). Респираторно-синцитиальный вирус. Данные Американской ассоциации легких по легочным заболеваниям: 2008 [Информация в Интернете]. PDF-файл доступен для загрузки по адресу http://www.lungusa.org/atf/cf/%7B7a8d42c2-fcca-4604-8ade-7f5d5e762256%7D/ALA_LDD08_RSV_FINAL.PDF. Доступно 29.07.08.

(© 2012). Респираторно-синцитиальный вирус. Американская ассоциация легких [Он-лайн информация]. Доступно в Интернете по адресу http://www.lungusa.org/lung-disease/respiratory-syncytial-virus/. По состоянию на январь 2012 г.

сотрудников клиники Мэйо (29 июля 2011 г.). Респираторно-синцитиальный вирус (РСВ), клиника Мейо [Информация в Интернете]. Доступно в Интернете по адресу http://www.mayoclinic.com/health/respiratory-syncytial-virus/DS00414/METHOD=print. По состоянию на январь 2012 г.

Delgado, J. et. al. (Обновлено октябрь 2011 г.).Респираторно-синцитиальный вирус - RSV. ARUP Consult [Он-лайн информация]. Доступно в Интернете по адресу http://www.arupconsult.com/Topics/RSV.html. По состоянию на январь 2012 г.

Крылов Л. (Обновлено 14 июня 2011 г.). Инфекция, вызванная респираторно-синцитиальным вирусом (RSV). Справочник по Medscape [Он-лайн информация]. Доступно в Интернете по адресу http://emedicine.medscape.com/article/971488-overview. По состоянию на январь 2012 г.

Дагдейл, Д. (Обновлено 19 февраля 2011 г.). Тест на антитела к RSV. Медицинская энциклопедия MedlinePlus [Он-лайн информация].Доступно в Интернете по адресу http://www.nlm.nih.gov/medlineplus/ency/article/003348.htm. По состоянию на январь 2012 г.

(обновлено 31 октября 2011 г.). Узнайте о респираторно-синцитиальном вирусе. Особенности CDC [Он-лайн информация]. Доступно в Интернете по адресу http://www.cdc.gov/Features/RSV/. По состоянию на январь 2012 г.

Глобальное молекулярное разнообразие RSV - исследование INFORM RSV | BMC Infectious Diseases

Дизайн исследования

INFORM RSV - это глобальное клиническое исследование, инициированное в 2017 году компанией AstraZeneca для проспективного анализа штаммов RSV, собранных у детей младше 5 лет.Соавторы были идентифицированы через респираторно-синцитиальную вирусную сеть (ReSViNET; www.resvinet.org). ReSViNET Foundation - международная ведущая некоммерческая организация, стремящаяся снизить глобальное бремя инфекции RSV. В исследовании INFORM RSV положительные на RSV образцы из носа будут собираться у субъектов в рамках обычного клинического ухода в местных клинических центрах и отправляться в лабораторию Медицинского центра Университета Утрехта (UMCU), Нидерланды, для секвенирования и культивирования.

В исследовании INFORM RSV цель состоит в сборе и секвенировании примерно 4000 респираторных образцов с положительным результатом на RSV в течение 5-летнего периода (2017–2022 гг.), Что соответствует 50 или 100 образцам на участок в год (дополнительные файлы, таблица 1 ). На момент написания, исследование INFORM RSV продолжалось 2 года и в настоящее время проводится в 17 странах на 18 участках (рис. 1). Мы стремимся распространиться на другие страны, где исследования бремени болезней продолжаются. Чтобы обеспечить как сезонное, так и географическое разнообразие, мы стремимся собирать 10–20 проб с каждого участка в месяц в течение ~ пятимесячного сезона RSV, который в среднем длится 5 месяцев.Если сайт может собрать больше, чем требуется количество образцов, подмножество будет выбрано случайным образом. Секвенирование вирусного генома будет выполнено на всех образцах NGS с использованием амплифицированных кДНК ОТ-ПЦР в лаборатории UMCU. Для изучения молекулярной устойчивости будет случайным образом отобрана и культивирована подмножество штаммов (~ 10%) для оценки функциональной чувствительности к разрабатываемым противовирусным препаратам и вирусной пригодности варианта RSV с изменениями сайтов связывания лекарств или доминирующими изменениями в немедикаментозных препаратах. сайт привязки.

Рис. 1

Страны, участвующие в исследовании INFORM RSV. Красный - Старт в 2017 году; Синий - начало 2018 года; Желтый - начало в 2019 году. Рисунок был создан ACL с использованием Maptive (https://www.maptive.com)

Участники исследования

Дети имеют право участвовать в исследовании, если они соответствуют всем критериям включения (Таблица 1) . Дети могут участвовать в исследовании, если они соответствуют всем следующим критериям: (1) возраст младше 5 лет на момент отбора проб, (2) госпитализация или посещение амбулаторной клиники, (3) положительный результат теста на РСВ или подозрение на РСВ. иметь инфекцию RSV, когда тестирование RSV не является стандартной практикой.Подозрение на RSV определяется симптомами инфекции дыхательных путей (ИРО). В случаях, когда тестирование на RSV не является стандартом лечения, процедура информированного согласия выполняется перед сбором образцов для целей исследования. Нижние и верхние ИРО не дифференцируются. Подписанное и датированное письменное информированное согласие получено от родителя (ей) / законного представителя (ей) в соответствии с протоколом исследования INFORM RSV, Руководством Международной конференции по гармонизации надлежащей клинической практики E6 (ICH-GCP) и применимыми национальными и международными нормативными актами. требований, включая Хельсинкскую декларацию.Дети, которые соответствуют критериям исключения из использования профилактических или лечебных препаратов для RSV, например: паливизумаб, рибавирин или экспериментальное mAb против RSV или вакцина будут исключены из участия.

Таблица 1 Критерии отбора для исследования INFORM RSV

Сбор, хранение и отправка образцов

После получения информированного согласия образцы носоглотки собираются с помощью флокированных тампонов и помещаются в универсальную транспортную среду Copan (UTM). Когда пациенты проходят искусственную вентиляцию легких, бронхиальный аспират собирают в Copan UTM.Образцы хранятся локально при -80 ° C. Когда хранение - 80 ° C недоступно, образцы можно хранить при - 20 ° C перед отправкой в ​​лабораторию UMCU. Образцы предпочтительно хранить в оригинальном контейнере и маркировать уникальным штрих-кодом, предоставленным UMCU, соответствующим коду INFORM RSV. Образцы отправляются замороженными на сухом льду в лабораторию UMCU для секвенирования и культивирования после каждого сезона.

Экстракция нуклеиновой кислоты и подтип RSV

Нуклеиновые кислоты экстрагируют из 250–500 мкл носовых образцов, положительных по RSV, с использованием набора MagNA Pure 96 DNA and Viral NA Large Volume (Roche Diagnostics, Mannheim, Germany) в соответствии с инструкциями производителя.Нуклеиновые кислоты элюируют 50 мкл буфера для элюции. Подтипирование и количественное определение RSV проводят с помощью мультиплексного анализа TaqMan RT-PCR гена RSV N с использованием смесей праймеров и зондов, специфичных для RSV-A и RSV-B. Реакции TaqMan RT-PCR проводят в системе StepOnePlus (Applied Biosystems) в общем объеме 10 мкл, включая 1 мкл нуклеиновых кислот, 1-шаговую мастер-смесь TaqMan Fast Virus (Thermo Fisher Scientific), прямой праймер RSV-A 900 нМ. (5 ′ AGATCAACTTCTGTCATCCAGCAA 3 ′), 900 нМ обратного праймера RSV-A (5 ′ TTCTGCACATCATAATTAGGAGTATCAAT 3 ′), 300 нМ RSV-B прямого праймера (5 ′ AAGATGCAAATCATAAATTATTCATTAGTAGGA 3 ′), обратного праймера 300GCTCCATAGGA 3 ′ ′), 58.3 нМ зонд RSV-A (5 'CACCATCCAACGGAGCACAGGAGAT 3', 5'6-FAM / ZEN / 3'IBFQ) и 66,7 нМ зонд RSV-B (5 'TTCCCTTCCTAACCTGGACATAGCATATAACATACCT 3', 5 'JOE NHS / ZEN / 3' ) (Интегрированные ДНК-технологии). Условия цикла: 50 ° C в течение 2 минут и 95 ° C в течение 10 минут, затем 45 циклов при 95 ° C в течение 15 секунд и 60 ° C в течение 60 секунд.

ОТ-ПЦР-амплификация геномов RSV и секвенирование следующего поколения

После субтипирования RSV соответствующие пары праймеров используются для обратной транскрипции и ПЦР-амплификации четырех перекрывающихся фрагментов генома RSV с использованием системы SuperScript IV One-Step RT-PCR ( Invitrogen, CA) в термоциклере 9800 Fast (Applied Biosystems).Четыре перекрывающихся фрагмента генома вместе составляют полный геном RSV, охватывающий все вирусные гены, но без дальних 3 'и 5' концов генома. Вырожденные основания используются вместо генетически изменчивых оснований в штаммах RSV-A и RSV-B при необходимости (таблица 2). Условия цикла: 55 ° C в течение 10 минут и 98 ° C в течение 2 минут, затем 40 циклов при 98 ° C в течение 10 секунд, 61 ° C в течение 10 секунд и 72 ° C в течение 3 минут. Ампликоны проверяют на 1% агарозном геле, объединяют в эквимолярных количествах и очищают из 1% агарозного геля с использованием набора для очистки GeneJet PCR Purification Kit (Thermo Fisher Scientific).Затем очищенные ампликоны количественно определяют с помощью набора для анализа дцДНК Quant-iT PicoGreen (Thermo Fisher Scientific) в соответствии с инструкциями производителя. Затем нормализованные продукты ПЦР подвергаются конструированию библиотеки секвенирования следующего поколения (NGS) с использованием набора для подготовки библиотеки ДНК Nextera XT в соответствии с протоколом производителя (Illumina). Адаптеры секвенирования и штрих-коды Illumina добавляются к меченой ДНК посредством ПЦР-амплификации с использованием уникальных пользовательских олиго-последовательностей (Integrated DNA Technologies).Затем ДНК очищают и выбирают по размеру с использованием 0,6-кратного объема реагента Ampure XP (Beckman Coulter, Inc.) в соответствии с протоколом производителя. Затем очищенную ДНК количественно определяют с помощью набора для анализа дцДНК Quant-iT PicoGreen (Thermo Fisher Scientific) и смешивают в эквимолярных количествах. Секвенирование выполняется на платформе Illumina NextSeq500 (Illumina, Inc), генерируя считывания с парным концом 150 п.о.

Таблица 2 Праймеры, используемые в этом исследовании для амплификации перекрывающихся фрагментов генома RSV

Сборка и аннотация генома RSV

Сборка считанных данных секвенирования в полные геномы выполняется с помощью AstraZeneca's Next-Generation Sequencing Microbial Surveillance Toolbox (NGS-MSTB) - a полностью автоматизированный распределенный конвейер, реализованный с помощью Common Workflow Language (CWL) и с пользовательским интерфейсом, основанным на рабочей среде биоинформатики Galaxy [12].Основным этапом обработки является целевая сборка de-novo с использованием Ariba [13] с индивидуальным протоколом сборки AstraZeneca, настроенным на надежность в присутствии смешанных вирусных субпопуляций и очень высокую вариабельность охвата. За этим следует пост-сборочная фильтрация малонаселенных плохо собранных квазивидов. Конвейер создает веб-отчет с показателями контроля качества и представлениями браузера генома на уровне контига и отдельного чтения. Рукопись с подробным описанием конвейера сборки и его выпуска с открытым исходным кодом находится в стадии подготовки.

Присвоение подтипов RSV выполняется в процессе сборки, а определение генотипов RSV выполняется путем филогенетической кластеризации с использованием справочной базы данных ранее описанных генотипов [14].

Для определения полиморфизмов в областях связывания белка F в mAb RSV последовательности генов транслируются в аминокислотные последовательности, выравниваются по эталонным последовательностям (штаммы NL13) и регистрируются аминокислотные изменения.

Культура RSV

Замороженные респираторные образцы, хранящиеся в UTM, размораживают, объединяют в соотношении 1: 1 с DMEM (минимальная необходимая среда Дульбекко; Lonza) с добавлением 5% FBS и 100 мкг / мл нормоцина (InvivoGen) и затем фильтруют через 0 .Фильтр 45 мкм. Фильтрат используют для заражения клеток HEp-2 (60% конфлюэнтности) в колбах T25 в течение 1 ч при 33 ° C и 5% CO2. Супернатант заменяют свежим DMEM с добавлением 5% FBS и 100 мкг / мл нормоцина и снова помещают в увлажненный инкубатор с 5% CO2 при 33 ° C. Вирусную культуру собирают при достижении приблизительно 70% цитопатического эффекта (ЦПЭ) центрифугированием при 247 × g в течение 10 мин и объединением супернатанта с 50% сахарозой в dPBS (стерильная фильтрация). Вирусы хранят в аликвотах по 1 мл при -80 ° C.

Сбор и обработка данных

Данные записываются в электронную форму отчетности образца (SRF) (Таблица 3). SFR со всех сайтов загружаются в центральную базу данных (eCASTOR) компанией Julius Clinical, после чего клинические данные объединяются с данными секвенирования. Для обеспечения анонимности субъекта будет введен только уникальный номер субъекта и возраст в месяцах. Данные будут заблокированы после каждого сезона.

Таблица 3 Переменные пациента в электронной форме истории болезни

Результаты

Первичная конечная точка

Последовательности RSV из глобальной популяции госпитализированных детей.

Вторичные конечные точки
  1. 1.

    Общее количество подтипов RSV A и B и родственных геномов и связь этих подтипов с характеристиками пациентов (таблица 3)

  2. 2.

    Гомология гена F циркулирующего RSV дикого типа с таковой у контрольных штаммов

  3. 3.

    Общее количество штаммов RSV с полиморфизмом в областях связывания mAb RSV или антигенных сайтах белка F RSV

Расчет размера выборки

Минимальное количество образцов, необходимое для этого исследования, составляет 2500. Размер выборки позволит получить точные оценки частоты подтипов RSV A и B, а также полиморфизмов. Ширина 95% доверительного интервала (ДИ) не превышает 4%.При крайне низкой или высокой распространенности (например, <7,5% или> 92,5%) ширина 95% доверительного интервала будет менее 2%. Это исследование также хорошо подходит для выявления различий в распространенности подтипов (RSV A и B). Оценка средней распространенности RSV A (две трети) была получена из исследования Zhu et al. [10]. Исследование INFORM RSV имеет не менее 90% мощности для выявления разницы в распространенности подтипов между группами 7% при альфа 0,05 (например, 70% RSV A у мужчин против 63% RSV A у женщин), и, по крайней мере, Мощность 90% для обнаружения эффекта размером 0.08 с использованием критерия хи-квадрат с 4 степенями свободы. Это означает, например, что это исследование может выявить разницу в распределении подтипов RSV, если распространенность RSV A по сайтам была примерно следующей: 58, 62, 66, 70 и 74%. Эти расчеты размера выборки проводились в программном обеспечении PASS с использованием двусторонних доверительных интервалов для одинарных пропорций с помощью простого асимптотического метода с поправкой на непрерывность и анализа мощности критерия хи-квадрат. Хотя 2500 образцов достаточно для обнаружения желаемого эффекта и, исходя из минимальной инвазивности для участников ИНФОРМ, исследование будет расширяться и включать больше стран для максимального понимания географического и временного разнообразия.

Ответ дыхательных путей на респираторно-синцитиальный вирус оказывает побочное антибактериальное действие

  • 1.

    Zumla, A. et al. Возникающие инфекции дыхательных путей. Lancet Infect. Дис. 14 , 910–911 (2014).

    Артикул Google Scholar

  • 2.

    Lozano, R. et al. Глобальная и региональная смертность от 235 причин смерти для 20 возрастных групп в 1990 и 2010 годах: систематический анализ для исследования Global Burden of Disease Study 2010. Ланцет 380 , 2095–2128 (2012).

    Артикул Google Scholar

  • 3.

    Shi, T. et al. Глобальные, региональные и национальные оценки бремени острых респираторных инфекций нижних дыхательных путей, вызванных респираторно-синцитиальным вирусом, у детей младшего возраста в 2015 г .: систематический обзор и исследование на основе моделирования. Ланцет 390 , 946–958 (2017).

    Артикул Google Scholar

  • 4.

    Мартенс, П., Ворм, С. В., Лундгрен, Б., Конрадсен, Х. Б. и Бенфилд, Т. Повторное рассмотрение серотип-специфической смертности от инвазивной болезни Streptococcus pneumoniae . BMC Infect. Дис. 4 , 21 (2004).

    Артикул Google Scholar

  • 5.

    Watt, J. P. et al. Бремя болезни, вызываемой Haemophilus influenzae типа b, у детей младше 5 лет: глобальные оценки. Ланцет 374 , 903–911 (2009).

    Артикул Google Scholar

  • 6.

    Verduin, C. M., Hol, C., Fleer, A., van Dijk, H. & van Belkum, A. Moraxella catarrhalis: от появившегося до установленного патогена. Clin. Microbiol. Ред. 15 , 125–144 (2002).

    Артикул Google Scholar

  • 7.

    Smith, A. M. & McCullers, J. A. in Патогенез и борьба с гриппом , Vol.I (ред. Compans, Ричард В. и Олдстон, Майкл Б. А.) 327–356 (Springer International Publishing, Cham, Швейцария, 2014).

  • 8.

    Моренс, Д. М., Таубенбергер, Дж. К. и Фаучи, А. С. Преобладающая роль бактериальной пневмонии как причины смерти при пандемическом гриппе: последствия для готовности к пандемическому гриппу. J. Infect. Дис. 198 , 962–970 (2008).

    Артикул Google Scholar

  • 9.

    МакКуллерс, Дж. А. Анализ взаимодействия вируса гриппа и пневмококка. Clin. Microbiol. Ред. 19 , 571–582 (2006).

    CAS Статья Google Scholar

  • 10.

    Моррис Д. Э., Клири Д. В. и Кларк С. С. Вторичные бактериальные инфекции, связанные с пандемиями гриппа. Перед. Microbiol. https://doi.org/10.3389/fmicb.2017.01041 (2017).

  • 11.

    Weinberger, D. M. et al. Влияние пандемии гриппа 2009 г. на госпитализации с пневмококковой пневмонией в США. J. Infect. Дис. 205 , 458–465 (2012).

    Артикул Google Scholar

  • 12.

    Андраде, М.А., Хоберман, А., Глуштейн, Дж., Парадайз, Дж. Л. и Уолд, Э. Р. Острый средний отит у детей с бронхиолитом. Педиатрия 101 , 617–619 (1998).

    CAS Статья Google Scholar

  • 13.

    Смит, К. Б., Голден, К., Клаубер, М. Р., Каннер, Р., Рензетти, А. Взаимодействие между вирусами и бактериями у пациентов с хроническим бронхитом. J. Infect. Дис. 134 , 552–561 (1976).

    CAS Статья Google Scholar

  • 14.

    Blanken, M.O. et al. Респираторно-синцитиальный вирус и повторяющиеся хрипы у здоровых недоношенных детей. N. Engl. J. Med. 368 , 1791–1799 (2013).

    CAS Статья Google Scholar

  • 15.

    Hament, J. M. et al. Повышенная адгезия Streptococcus pneumoniae к эпителиальным клеткам человека, инфицированным респираторно-синцитиальным вирусом. Pediatr. Res. 55 , 972–978 (2004).

    Артикул Google Scholar

  • 16.

    Hament, J. M. et al. Прямое связывание респираторно-синцитиального вируса с пневмококками: феномен, который усиливает как адгезию пневмококков к эпителиальным клеткам человека, так и инвазивность пневмококков на мышиной модели. Pediatr. Res. 58 , 1198–1203 (2005).

    CAS Статья Google Scholar

  • 17.

    Avadhanula, V. et al. Респираторные вирусы усиливают адгезию бактериальных патогенов к респираторному эпителию в зависимости от вида вируса и типа клеток. J. Virol. 80 , 1629–1636 (2006).

    CAS Статья Google Scholar

  • 18.

    Avadhanula, V., Wang, Y., Portner, A. & Adderson, E. Нетипируемые Haemophilus influenzae и Streptococcus pneumoniae связывают гликопротеин респираторно-синцитиального вируса. J. Med. Microbiol. 56 , 1133–1137 (2007).

    CAS Статья Google Scholar

  • 19.

    de Steenhuijsen Piters, W. A. ​​et al. Микробиота носоглотки, транскриптом хозяина и тяжесть заболевания у детей с респираторно-синцитиальной вирусной инфекцией. Am. J. Respir. Крит. Care Med. 194 , 1104–1115 (2016).

    Артикул Google Scholar

  • 20.

    Morpeth, S.C. et al. Влияние вирусной инфекции верхних дыхательных путей на концентрацию носоглоточного пневмококка среди детей Кении. Sci. Отчетность 8 , 11030 (2018).

    Артикул ОБЪЯВЛЕНИЯ Google Scholar

  • 21.

    Lukens, M. V. et al. Системный нейтрофильный ответ предшествует устойчивой активации CD8 (+) Т-клеток во время естественной респираторно-синцитиальной вирусной инфекции у младенцев. J. Virol. 84 , 2374–2383 (2010).

    CAS Статья Google Scholar

  • 22.

    Thwaites, R. S. et al. Снижение назальной вирусной нагрузки и ответа на IFN у младенцев с бронхиолитом, вызванным RSV, и дыхательной недостаточностью. Am. J. Respir. Крит. Care Med. https://doi.org/10.1164/rccm.201712-2567OC (2018).

    CAS Статья Google Scholar

  • 23.

    Emboriadou, M. et al. Эластаза нейтрофилов человека при бронхиолите, вызванном RSV. Ann. Clin. Лаборатория. Sci. 37 , 79–84 (2007).

    CAS PubMed Google Scholar

  • 24.

    Джаовисидха П., Пиплс М. Э., Брис А. А., Карпентер Л. Р. и Мой Дж.N. Респираторно-синцитиальный вирус стимулирует дегрануляцию нейтрофилов и высвобождение хемокинов. J. Immunol. 163 , 2816–2820 (1999).

    CAS Google Scholar

  • 25.

    Mejias, A. et al. Профили экспрессии генов в цельной крови для оценки патогенеза и тяжести заболевания у младенцев с респираторно-синцитиальной вирусной инфекцией. PLoS Med. 10 , e1001549 (2013).

    Артикул Google Scholar

  • 26.

    Эверард, М. Л. и др. Анализ клеток, полученных при промывании бронхов младенцев с респираторно-синцитиальной вирусной инфекцией. Arch. Дис. Ребенок. 71 , 428–432 (1994).

    CAS Статья Google Scholar

  • 27.

    Смит П. К., Ван С. З., Даулинг К. Д. и Форсайт К. Д. Популяции лейкоцитов при бронхиолите, индуцированном респираторно-синцитиальным вирусом. J. Paediatr. Здоровье ребенка 37 , 146–151 (2001).

    CAS Статья Google Scholar

  • 28.

    Rorvig, S., Ostergaard, O., Heegaard, N. H. & Borregaard, N. Профилирование протеома субпопуляций нейтрофильных гранул человека, секреторных пузырьков и клеточной мембраны: корреляция с профилированием транскриптома предшественников нейтрофилов. J. Leukoc. Биол. 94 , 711–721 (2013).

    Артикул Google Scholar

  • 29.

    Боррегаард Н., Соренсен О. Э. и Тейлгаард-Монч К. Нейтрофильные гранулы: библиотека белков врожденного иммунитета. Trends Immunol. 28 , 340–345 (2007).

    CAS Статья Google Scholar

  • 30.

    Rai, P. et al. Streptococcus pneumoniae секретирует перекись водорода, что приводит к повреждению ДНК и апоптозу клеток легких. Proc. Natl Acad. Sci. США 112 , E3421 – E3430 (2015).

    CAS Статья ОБЪЯВЛЕНИЯ Google Scholar

  • 31.

    Allen, R.C. & Stephens, J. T. Jr. Миелопероксидаза избирательно связывает и избирательно убивает микробы. Заражение. Иммун. 79 , 474–485 (2011).

    CAS Статья Google Scholar

  • 32.

    Evans, TJ, Carpenter, A., Moyes, D., Martin, R. & Cohen, J. Защитные эффекты рекомбинантного амино-концевого фрагмента бактерицидного / повышающего проницаемость белка человека в модели на животных грамотрицательного сепсиса. J. Infect. Дис. 171 , 153–160 (1995).

    CAS Статья Google Scholar

  • 33.

    Lechner, AJ, Lamprech, KE, Johanns, CA & Matuschak, GM Рекомбинантный N-концевой фрагмент 23 кДа бактерицидного / повышающего проницаемость белка (rBPI23) снижает Escherichia coli -индуцированную смертность и поражение органов. травма во время нейтропении, связанной с иммуносупрессией. Ударная волна 4 , 298–306 (1995).

    CAS Статья Google Scholar

  • 34.

    Lin, Y., Ammons, W. S., Leach, W. J. & Kung, A.H. Защитные эффекты рекомбинантного N-концевого фрагмента бактерицидного / повышающего проницаемость белка при эндотоксическом шоке у кроликов в сознании. Ударная волна 2 , 324–331 (1994).

    CAS Статья Google Scholar

  • 35.

    Weinrauch, Y., Дружан, Д., Шапиро, С. Д., Вайс, Дж. И Зихлински, А. Нейтрофильная эластаза нацелена на факторы вирулентности энтеробактерий. Nature 417 , 91–94 (2002).

    CAS Статья ОБЪЯВЛЕНИЯ Google Scholar

  • 36.

    Borelli, V. et al. Пероксидаза эозинофилов человека вызывает поверхностное изменение, уничтожение и лизис Mycobacterium tuberculosis . Заражение. Иммун. 71 , 605–613 (2003).

    CAS Статья Google Scholar

  • 37.

    Джонсон, Дж. Э., Гонсалес, Р. А., Олсон, С. Дж., Райт, П. Ф. и Грэм, Б. С. Гистопатология фатальной нелеченой респираторно-синцитиальной вирусной инфекции человека. Мод. Патол. 20 , 108–119 (2007).

    CAS Статья Google Scholar

  • 38.

    Nokes, D. J. et al. Эпидемиология респираторно-синцитиального вируса в когорте новорожденных из района Килифи, Кения: инфекция в течение первого года жизни. J. Infect. Дис. 190 , 1828–1832 (2004).

    Артикул Google Scholar

  • 39.

    Caporaso, J. G. et al. QIIME позволяет анализировать данные секвенирования сообщества с высокой пропускной способностью. Нат. Методы 7 , 335–336 (2010).

    CAS Статья Google Scholar

  • 40.

    Kuczynski, J. et al. Использование QIIME для анализа последовательностей гена 16S рРНК из микробных сообществ. Curr. Protoc. Биоинформатика. https://doi.org/10.1002/0471250953.bi1007s36 (2011).

  • 41.

    Callahan, B.J. et al. DADA2: вывод образца с высоким разрешением из данных ампликона Illumina. Нат. Методы 13 , 581–583 (2016).

    CAS Статья Google Scholar

  • 42.

    McDonald, D. et al. Улучшенная таксономия Greengenes с явными рангами для экологического и эволюционного анализа бактерий и архей. ISME J. 6 , 610–618 (2012).

    CAS Статья Google Scholar

  • 43.

    Sande, C.J. et al. Ненаправленный анализ протеомов дыхательных путей детей с респираторными инфекциями с использованием протеомики на основе масс-спектрометрии. Sci. Отчет 8 , 13814 (2018).

    Артикул ОБЪЯВЛЕНИЯ Google Scholar

  • 44.

    Vizcaino, J.A. et al. ProteomeXchange обеспечивает глобально скоординированную передачу и распространение протеомных данных. Нат. Biotechnol. 32 , 223–226 (2014).

    CAS Статья Google Scholar

  • 45.

    Cox, J. et al. Andromeda: поисковая машина пептидов, интегрированная в среду MaxQuant. J. Proteome Res. 10 , 1794–1805 (2011).

    CAS Статья ОБЪЯВЛЕНИЯ Google Scholar

  • 46.

    Chen, E. Y. et al. Enrichr: интерактивный и совместный инструмент анализа пополнения списка генов HTML5. BMC Bioinformatics 14 , 128 (2013).

    Артикул Google Scholar

  • 47.

    Кулешов М.В. и др. Enrichr: обновление веб-сервера для комплексного анализа обогащения набора генов 2016 г. Nucleic Acids Res. 44 , W90 – W97 (2016).

    CAS Статья Google Scholar

  • 48.

    Lagousi, T. et al. Обнаружение иммунодоминантных В-клеточных эпитопов в поверхностных белках вирулентности пневмококка у педиатрических пациентов с инвазивным пневмококковым заболеванием. J. Biol. Chem. 290 , 27500–27510 (2015).

    CAS Статья Google Scholar

  • Появление новых антигенных эпитопов в гликопротеинах респираторно-синцитиального вируса человека, собранных в ходе надзорного исследования в США, 2015–17

  • 1.

    Ши, Т. и др. . Глобальные, региональные и национальные оценки бремени острых респираторных инфекций нижних дыхательных путей, вызванных респираторно-синцитиальным вирусом, у детей младшего возраста в 2015 г .: систематический обзор и исследование на основе моделирования. Lancet 390 , 946–958, https://doi.org/10.1016/S0140-6736(17)30938-8 (2017).

    Артикул PubMed PubMed Central Google Scholar

  • 2.

    Stockman, L.J., Curns, A.Т., Андерсон, Л. Дж. И Фишер-Лэнгли, Г. Госпитализации младенцев и детей раннего возраста, связанные с респираторно-синцитиальным вирусом, в США, 1997–2006 гг. Pediatr Infect Dis J 31 , 5–9, https://doi.org/10.1097/INF.0b013e31822e68e6 (2012).

    Артикул PubMed Google Scholar

  • 3.

    Американская академия педиатрии, Комитет по инфекционным заболеваниям, D. и Американская академия педиатрии, рекомендации по бронхиолиту, C.Обновленное руководство по профилактике паливизумабом среди младенцев и детей раннего возраста с повышенным риском госпитализации по поводу респираторно-синцитиальной вирусной инфекции. Педиатрия 134 , e620–638, https://doi.org/10.1542/peds.2014-1666 (2014).

    Артикул Google Scholar

  • 4.

    Гутфрейнд, А., Гальвани, А. П. и Мейерс, Л. А. Эффективность и оптимизация схем инъекций паливизумаба против респираторно-синцитиальной вирусной инфекции. JAMA Pediatr 169 , 341–348, https://doi.org/10.1001/jamapediatrics.2014.3804 (2015).

    Артикул PubMed PubMed Central Google Scholar

  • 5.

    Паливизумаб, A. Моноклональные антитела к гуманизированному респираторно-синцитиальному вирусу, сокращают госпитализацию в связи с инфекцией респираторно-синцитиального вируса у младенцев из группы высокого риска. Педиатрия 102 , 531–537 (1998).

    Артикул Google Scholar

  • 6.

    Хан, Л. Л., Александр, Дж. П. и Андерсон, Л. Дж. Респираторно-синцитиальная вирусная пневмония среди пожилых людей: оценка бремени болезней. J Infect Dis 179 , 25–30, https://doi.org/10.1086/314567 (1999).

    CAS Статья PubMed Google Scholar

  • 7.

    Falsey, A. R. & Walsh, E. E. Инфекция респираторно-синцитиальным вирусом у пожилых людей. Лекарства от старения 22 , 577–587 (2005).

    Артикул Google Scholar

  • 8.

    Widjoatmodjo, M. N. et al. . Сильно аттенуированный рекомбинантный респираторно-синцитиальный вирус человека, лишенный G-белка, индуцирует длительную защиту у хлопковых крыс. Virol J 7 , 114, https://doi.org/10.1186/1743-422X-7-114 (2010).

    CAS Статья PubMed PubMed Central Google Scholar

  • 9.

    Саллендер, В. М. Генетическое и антигенное разнообразие респираторно-синцитиального вируса. Обзоры по клинической микробиологии 13 , 1–15, содержание (2000).

  • 10.

    Peret, T. C. et al. . Характер циркуляции генотипов респираторно-синцитиального вируса группы A и B в 5 сообществах Северной Америки. J Infect Dis 181 , 1891–1896, https://doi.org/10.1086/315508 (2000).

    CAS Статья PubMed Google Scholar

  • 11.

    Эшаги, А. и др. . Генетическая изменчивость штаммов респираторно-синцитиального вируса человека А, циркулирующих в Онтарио: новый генотип с дупликацией гена G. Plos One 7 , e32807, https://doi.org/10.1371/journal.pone.0032807 (2012).

    ADS CAS Статья PubMed PubMed Central Google Scholar

  • 12.

    Дуввури В. Р. и др. . Генетическое разнообразие и эволюционное понимание генотипа респираторно-синцитиального вируса A ON1: глобальная и локальная динамика передачи. Sci Rep 5 , 14268, https://doi.org/10.1038/srep14268 (2015).

    ADS CAS Статья PubMed PubMed Central Google Scholar

  • 13.

    Zheng, Y. et al . Преобладающее распределение генотипов и характеристики респираторно-синцитиального вируса человека на северо-востоке Китая. J Med Virol 89 , 222–233, https://doi.org/10.1002/jmv.24640 (2017).

    CAS Статья PubMed Google Scholar

  • 14.

    Фан, Р. и др. . Респираторно-синцитиальный вирус подтипа ON1 / NA1 / BA9 преобладает у госпитализированных детей с инфекциями нижних дыхательных путей. J Med Virol 89 , 213–221, https://doi.org/10.1002/jmv.24619 (2017).

    CAS Статья PubMed Google Scholar

  • 15.

    Отиено, Дж. Р. и др. . Распространение и эволюция респираторно-синцитиального вируса A генотипа ON1, прибрежная зона Кении, 2010-2015 гг. Emerg Infect Dis 23 , 264–271, https://doi.org/10.3201/eid2302.161149 (2017).

    Артикул PubMed PubMed Central Google Scholar

  • 16.

    Тренто А. и др. . Десять лет глобальной эволюции генотипа BA респираторно-синцитиального вируса человека с 60-нуклеотидной дупликацией в гене G-белка. J Virol 84 , 7500–7512, https://doi.org/10.1128/JVI.00345-10 (2010).

    CAS Статья PubMed PubMed Central Google Scholar

  • 17.

    Хотард, А. Л., Лайхтер, Э., Брукс, К., Хартерт, Т. В. и Мур, М. Л. Функциональный анализ дупликации 60 нуклеотидов в гликопротеине прикрепления штамма Буэнос-Айресского штамма респираторно-синцитиального вируса. J Virol 89 , 8258–8266, https://doi.org/10.1128/JVI.01045-15 (2015).

    CAS Статья PubMed PubMed Central Google Scholar

  • 18.

    Zhu, Q. и др. . Высокоэффективное антитело с увеличенным периодом полужизни в качестве потенциального заменителя вакцины против RSV для всех младенцев. Sci Transl Med 9 , https://doi.org/10.1126/scitranslmed.aaj1928 (2017).

  • 19.

    Мелеро, Дж. А. и Мур, М. Л. Влияние различий штаммов респираторно-синцитиального вируса на патогенез и иммунитет. Curr Top Microbiol Immunol 372 , 59–82, https://doi.org/10.1007/978-3-642-38919-1_3 (2013).

    CAS Статья PubMed PubMed Central Google Scholar

  • 20.

    Маклеллан, Дж. С. и др. . Структура тримерного гликопротеина слияния RSV, связанного с нейтрализующим антителом, специфичным для предварительного слияния. Наука 340 , 1113–1117, https://doi.org/10.1126/science.1234914 (2013).

    ADS CAS Статья PubMed PubMed Central Google Scholar

  • 21.

    Самуэль Д. и др. . GS-5806 ингибирует пре- и постфузионные конформационные изменения слитого белка респираторно-синцитиального вируса. Противомикробные агенты Chemother 59 , 7109–7112, https://doi.org/10.1128/AAC.00761-15 (2015).

    CAS Статья PubMed PubMed Central Google Scholar

  • 22.

    Де Винченцо, Дж. П. и др. . Активность перорального ALS-008176 в исследовании респираторно-синцитиального вируса. N Engl J Med 373 , 2048–2058, https://doi.org/10.1056/NEJMoa1413275 (2015).

    CAS Статья PubMed Google Scholar

  • 23.

    Mejias, A., Garcia-Maurino, C., Rodriguez-Fernandez, R., Peeples, M. E. & Ramilo, O. Разработка и клиническое применение новых антител для профилактики и лечения респираторно-синцитиальной вирусной инфекции. Vaccine 35 , 496–502, https: // doi.org / 10.1016 / j.vaccine.2016.09.026 (2017).

    CAS Статья PubMed Google Scholar

  • 24.

    Виллафана, Т., Фаллон, Дж., Гриффин, М. П., Чжу, К. и Эссер, М. Т. Пассивная и активная иммунизация против респираторно-синцитиального вируса для молодых и старых. Expert Rev Vaccines 16 , 1–13, https://doi.org/10.1080/14760584.2017.1333425 (2017).

    CAS Статья PubMed Google Scholar

  • 25.

    Гриффин М. П. и др. . Безопасность, переносимость и фармакокинетика MEDI8897, моноклонального антитела, нацеленного на F-мишень респираторно-синцитиального вируса с увеличенным периодом полужизни, у здоровых взрослых. Противомикробные агенты Chemother 61 , https://doi.org/10.1128/AAC.01714-16 (2017).

  • 26.

    McLellan, J. S., Yang, Y., Graham, B. S. & Kwong, P. D. Структура гликопротеина слияния респираторно-синцитиального вируса в постфузионной конформации показывает сохранение нейтрализующих эпитопов. J Virol 85 , 7788–7796, https://doi.org/10.1128/JVI.00555-11 (2011).

    CAS Статья PubMed PubMed Central Google Scholar

  • 27.

    Hause, A. M. et al . Вариабельность последовательности гена слияния респираторно-синцитиального вируса (RSV) среди современных и исторических генотипов RSV / A и RSV / B. Plos One 12 , e0175792, https://doi.org/10.1371/journal.pone.0175792 (2017).

    CAS Статья PubMed PubMed Central Google Scholar

  • 28.

    Маклеллан, Дж. С., Рэй, В. К. и Пиплс, М. Е. Структура и функция поверхностных гликопротеинов респираторно-синцитиального вируса. Curr Top Microbiol Immunol 372 , 83–104, https://doi.org/10.1007/978-3-642-38919-1_4 (2013).

    CAS Статья PubMed PubMed Central Google Scholar

  • 29.

    Sivapalasingam, S. et al. . Исследование фазы 1 по оценке безопасности, переносимости, фармакокинетики и иммуногенности REGN2222 у здоровых взрослых: новое человеческое моноклональное антитело против RSV-F для профилактики RSV. Открытый форум по инфекционным заболеваниям 2 , https://doi.org/10.1093/ofid/ofv133.628 (2015).

  • 30.

    Бродбент, Л., Гроувс, Х., Шилдс, М. Д. и Пауэр, У. Ф. Респираторно-синцитиальный вирус, текущая медицинская дилемма: комментарий экспертов по профилактическим и терапевтическим препаратам против респираторно-синцитиального вируса, которые в настоящее время проходят клинические испытания. Грипп и другие респираторные вирусы 9 , 169–178, https://doi.org/10.1111/irv.12313 (2015).

    Артикул PubMed PubMed Central Google Scholar

  • 31.

    Zhu, Q. et al . Анализ доклинических и клинических вариантов респираторно-синцитиального вируса, устойчивых к нейтрализации моноклональными антителами паливизумаб и / или мотавизумаб. Журнал инфекционных болезней 203 , 674–682, https: // doi.org / 10.1093 / infdis / jiq100 (2011 г.).

    CAS Статья PubMed PubMed Central Google Scholar

  • 32.

    Zhao, X. & Sullender, W. M. In vivo отбор респираторно-синцитиальных вирусов, устойчивых к паливизумабу. J Virol 79 , 3962–3968, https://doi.org/10.1128/JVI.79.7.3962-3968.2005 (2005).

    CAS Статья PubMed PubMed Central Google Scholar

  • 33.

    Де Винченцо, Дж. П. и др. . Наблюдение за клиническими изолятами респираторно-синцитиального вируса в отношении мутантов, устойчивых к паливизумабу (Synagis). J Infect Dis 190 , 975–978, https://doi.org/10.1086/423213 (2004).

    Артикул PubMed Google Scholar

  • 34.

    Адамс, О. и др. . Инфекция респираторно-синцитиального вируса человека, резистентная к паливизумабу, в младенчестве. Clin Infect Dis 51 , 185–188, https: // doi.org / 10.1086 / 653534 (2010).

    CAS Статья PubMed Google Scholar

  • 35.

    Zhu, Q. et al . Распространенность и значение замен в гибридном белке респираторно-синцитиального вируса, приводящих к ускользанию нейтрализации от антитела MEDI8897. J Infect Dis , https://doi.org/10.1093/infdis/jiy189 (2018).

  • 36.

    Маккарти, М., Виллафана, Т., Стиллман, Э. и Эссер, М.T. Структура белка респираторно-синцитиального вируса, функция и значение для разработки субъединичной вакцины. Вирусология будущего 9 , 753–767 (2014).

    CAS Статья Google Scholar

  • 37.

    Rossey, I. et al. . Мощные однодоменные антитела, которые задерживают слитый белок респираторно-синцитиального вируса в его состоянии до слияния. Nat Commun 8 , 14158, https://doi.org/10.1038 / ncomms14158 (2017).

    ADS CAS Статья PubMed PubMed Central Google Scholar

  • 38.

    Тренто А. и др. . Основные изменения в G-белке изолятов респираторно-синцитиального вируса человека, вызванные дупликацией 60 нуклеотидов. J Gen Virol 84 , 3115–3120, https://doi.org/10.1099/vir.0.19357-0 (2003).

    CAS Статья PubMed Google Scholar

  • 39.

    Falsey, A.R. и др. . Респираторно-синцитиальный вирус и другие респираторно-вирусные инфекции у пожилых людей с умеренным и тяжелым гриппоподобным заболеванием. J Infect Dis 209 , 1873–1881, https://doi.org/10.1093/infdis/jit839 (2014).

    Артикул PubMed PubMed Central Google Scholar

  • 40.

    Schobel, S. A. et al. . Полногеномное секвенирование респираторно-синцитиального вируса идентифицирует конвергентную эволюцию дупликации последовательностей на С-конце гена G. Sci Rep 6 , 26311, https://doi.org/10.1038/srep26311 (2016).

    ADS CAS Статья PubMed PubMed Central Google Scholar

  • 41.

    Отиено, Дж. Р. и др. . Молекулярно-эволюционная динамика респираторно-синцитиального вируса группы А при повторяющихся эпидемиях в прибрежных районах Кении. J Virol 90 , 4990–5002, https://doi.org/10.1128/JVI.03105-15 (2016).

    CAS Статья PubMed PubMed Central Google Scholar

  • 42.

    Ким, Ю. Дж. и др. . Быстрая замена респираторно-синцитиального вируса человека А генотипом ON1 с дупликацией 72 нуклеотидов в гене G. Infect Genet Evol 26 , 103–112, https://doi.org/10.1016/j.meegid.2014.05.007 (2014).

    CAS Статья PubMed Google Scholar

  • 43.

    van Niekerk, S. & Venter, M. Замена ранее циркулировавших штаммов подтипа B респираторно-синцитиального вируса генотипом BA в Южной Африке. J Virol 85 , 8789–8797, https://doi.org/10.1128/JVI.02623-10 (2011).

    CAS Статья PubMed PubMed Central Google Scholar

  • 44.

    Zhang, R.F. et al. . Респираторно-синцитиальный вирус человека у детей с острыми респираторными инфекциями в Китае. J Clin Microbiol 48 , 4193–4199, https://doi.org/10.1128/JCM.00179-10 (2010).

    Артикул PubMed PubMed Central Google Scholar

  • 45.

    Чоудхари М. Л., Ананд С. П., Вадхва Б. С. и Чадха М. С. Генетическая изменчивость респираторно-синцитиального вируса человека в Пуне, Западная Индия. Infect Genet Evol 20 , 369–377, https://doi.org/10.1016/j.meegid.2013.09.025 (2013).

    CAS Статья PubMed Google Scholar

  • 46.

    Чен, Х. и др. . Генетические вариации гибридного белка респираторно-синцитиального вируса, выделенного у детей, госпитализированных с внебольничной пневмонией в Китае. Sci Rep 8 , 4491, https://doi.org/10.1038/s41598-018-22826-4 (2018).

    ADS CAS Статья PubMed PubMed Central Google Scholar

  • 47.

    Domachowske, J. B. et al. . Безопасность, переносимость и фармакокинетика MEDI8897, моноклонального антитела, нацеленного на F-таргетинг, однократного респираторно-синцитиального вируса с увеличенным периодом полужизни, вводимого в виде однократной дозы здоровым недоношенным детям. Pediatr Infect Dis J , https://doi.org/10.1097/INF.0000000000001916 (2018).

  • 48.

    Хоркера П. А. и Трипп Р. А. Респираторно-синцитиальный вирус: перспективы новых и появляющихся терапевтических средств. Expert Rev Respir Med 11 , 609–615, https://doi.org/10.1080/17476348.2017.1338567 (2017).

    CAS Статья PubMed Google Scholar

  • 49.

    Шикли, Дж. Х., Каур, Дж.И Тан, Р. С. Доклинические фенотипические и генотипические анализы педиатрической респираторно-синцитиальной вакцины-кандидата MEDI-559 фазы 1 (rA2cp248 / 404 / 1030DeltaSH) при допустимых и недопустимых температурах. Virus Res 169 , 38–47, https://doi.org/10.1016/j.virusres.2012.06.027 (2012).

    CAS Статья PubMed Google Scholar

  • 50.

    Raghunandan, R. et al . Вакцина в виде наночастиц респираторно-синцитиального вируса (RSV) F, полученная из клеток насекомых, индуцирует антигенные антитела к сайту II и защищает от заражения RSV хлопковых крыс посредством активной и пассивной иммунизации. Vaccine 32 , 6485–6492, https://doi.org/10.1016/j.vaccine.2014.09.030 (2014).

    CAS Статья PubMed Google Scholar

  • 51.

    Гленн, Г. М. и др. . Рандомизированное слепое контролируемое исследование диапазона доз вакцины с наночастицами рекомбинантного слияния (F) респираторно-синцитиального вируса у здоровых женщин детородного возраста. J Infect Dis 213 , 411–422, https: // doi.org / 10.1093 / infdis / jiv406 (2016).

    CAS Статья PubMed PubMed Central Google Scholar

  • 52.

    Лэнгли, Дж. М. и др. . Рандомизированное, контролируемое, слепое исследование фазы 1 безопасности и иммуногенности вакцины против респираторно-синцитиального вируса с адъювантом квасцов или без него. J Infect Dis 215 , 24–33, https://doi.org/10.1093/infdis/jiw453 (2017).

    CAS Статья PubMed PubMed Central Google Scholar

  • 53.

    Табатабай, Дж., Приферт, К., Пфейл, Дж., Грулих-Хенн, Дж. И Шницлер, П. Новый генотип респираторно-синцитиального вируса (РСВ) ON1 преобладает в Германии в зимний сезон 2012–2013 годов. Plos One 9 , e109191, https://doi.org/10.1371/journal.pone.0109191 (2014).

    ADS CAS Статья PubMed PubMed Central Google Scholar

  • 54.

    Кумар, С., Стечер, Г. и Тамура, К. MEGA7: молекулярно-эволюционный генетический анализ, версия 7.0 для больших наборов данных. Mol Biol Evol 33 , 1870–1874, https://doi.org/10.1093/molbev/msw054 (2016).

    CAS Статья PubMed Google Scholar

  • 55.

    Letunic, I. & Bork, P. Интерактивное древо жизни (iTOL) v3: онлайн-инструмент для отображения и аннотации филогенетических и других деревьев. Nucleic Acids Res 44 , W242–245, https://doi.org/10.1093/nar/gkw290 (2016).

    CAS Статья PubMed PubMed Central Google Scholar

  • Для медицинских работников: RSV (респираторно-синцитиальный вирус)

    Медицинские работники должны учитывать RSV у пациентов с респираторными заболеваниями, особенно во время сезона RSV.

    Респираторно-синцитиальный вирус (RSV) был открыт в 1956 году и с тех пор признан одной из наиболее частых причин детских болезней. Он вызывает ежегодные вспышки респираторных заболеваний во всех возрастных группах. В большинстве регионов США RSV обычно циркулирует осенью, зимой и весной, но время и серьезность сезона RSV в данном сообществе могут варьироваться от года к году. Ученые разрабатывают несколько вакцин, моноклональных антител и противовирусных препаратов, чтобы помочь защитить младенцев и маленьких детей, беременных женщин (для защиты их еще не родившихся детей) и пожилых людей от тяжелой инфекции RSV.

    Клиническое описание и диагноз

    У младенцев и детей раннего возраста

    Инфекция RSV может вызывать различные респираторные заболевания у младенцев и детей младшего возраста. Чаще всего он вызывает заболевание, похожее на простуду, но также может вызывать инфекции нижних дыхательных путей, такие как бронхиолит и пневмония. От одного до двух процентов детей младше 6 месяцев с инфекцией RSV может потребоваться госпитализация. Тяжелое заболевание чаще всего возникает у младенцев раннего возраста. Кроме того, к группе повышенного риска относятся дети с одним из следующих основных состояний:

    • Недоношенные
    • Очень маленькие дети, особенно в возрасте 6 месяцев и младше
    • Дети младше 2 лет с хроническими заболеваниями легких или врожденными пороками сердца
    • Дети с подавленной иммунной системой
    • Дети с нервно-мышечными расстройствами, в том числе те, которые испытывают трудности с глотанием или очищением слизистых выделений

    Младенцы и дети раннего возраста с инфекцией RSV могут иметь ринорею и снижение аппетита до появления каких-либо других симптомов.Кашель обычно развивается через один-три дня. Вскоре после развития кашля может возникнуть чихание, жар и хрипы. У очень маленьких детей раздражительность, снижение активности и / или апноэ могут быть единственными симптомами инфекции.

    Большинство здоровых младенцев и детей раннего возраста, инфицированных RSV, не нуждаются в госпитализации. Госпитализированным может потребоваться кислород, интубация и / или искусственная вентиляция легких. Большинство из них улучшаются при поддерживающей терапии и выписываются через несколько дней.

    Для пожилых людей и взрослых с хроническими заболеваниями

    Взрослые, инфицированные RSV, обычно имеют легкие симптомы или не имеют никаких симптомов. Симптомы обычно соответствуют инфекции верхних дыхательных путей, которая может включать ринорею, фарингит, кашель, головную боль, усталость и жар. Заболевание обычно длится менее пяти дней.

    Однако у некоторых взрослых могут быть более тяжелые симптомы, связанные с инфекцией нижних дыхательных путей, например пневмония. К группе высокого риска тяжелого заболевания RSV относятся

    • Пожилые люди, особенно 65 лет и старше
    • Взрослые с хроническими заболеваниями легких или сердца
    • Взрослые с ослабленной иммунной системой

    RSV иногда может привести к обострению серьезных заболеваний, таких как

    • Астма
    • Хроническая обструктивная болезнь легких (ХОБЛ)
    • Застойная сердечная недостаточность

    Клинические лабораторные исследования

    Клинические симптомы RSV неспецифичны и могут совпадать с другими респираторными вирусными инфекциями, а также с некоторыми бактериальными инфекциями.Для подтверждения инфекции RSV доступны несколько типов лабораторных тестов. Эти тесты могут проводиться на образцах из верхних и нижних дыхательных путей.

    Наиболее часто используемые типы клинических лабораторных тестов на RSV:

    • Цепная реакция обратной транскриптазы-полимеразы в реальном времени (рОТ-ПЦР), которая более чувствительна, чем тестирование культуры и антигена
    • Тест на антиген, который высокочувствителен у детей, но не чувствителен у взрослых

    Реже используемые тесты включают

    • Вирусная культура
    • Серология, которая обычно используется только для исследовательских и надзорных исследований

    Некоторые тесты могут различать подтипы RSV (A и B), но клиническое значение этих подтипов неясно.Проконсультируйтесь с вашим лаборантом о том, какой тип респираторного образца лучше всего использовать.

    Для младенцев и детей раннего возраста

    И rRT-PCR, и тесты на обнаружение антигенов являются эффективными методами диагностики RSV-инфекции у младенцев и детей раннего возраста. Чувствительность тестов на обнаружение антигенов RSV обычно колеблется от 80% до 90% в этой возрастной группе. Медицинские работники должны проконсультироваться у опытных лаборантов для получения дополнительной информации об интерпретации результатов.

    Для детей старшего возраста, подростков и взрослых

    Медицинские работники должны использовать высокочувствительные анализы rRT-PCR при тестировании детей старшего возраста и взрослых на RSV. Анализы рОТ-ПЦР теперь коммерчески доступны для RSV. Чувствительность этих анализов часто превышает чувствительность методов выделения вируса и обнаружения антигена. Тесты на антигены нечувствительны для детей старшего возраста и взрослых, поскольку у них может быть более низкая вирусная нагрузка в их респираторных образцах. Медицинские работники должны проконсультироваться у опытных лаборантов для получения дополнительной информации об интерпретации результатов.

    Профилактика и дети грудного и раннего возраста из группы высокого риска

    Паливизумаб - это моноклональное антитело, рекомендованное Американской академией педиатрии (AAP) для введения младенцам из группы высокого риска и детям младшего возраста, которым может быть полезна иммунопрофилактика в зависимости от гестационного возраста и некоторых основных заболеваний. Его вводят в виде ежемесячных внутримышечных инъекций в течение сезона RSV, который обычно происходит осенью, зимой и весной в большинстве мест в Соединенных Штатах.

    Последние рекомендации по паливизумабу см. На внешнем значке политики AAP. Сопровождающий значок внешнего технического отчета AAP предоставляет дополнительный контекст и обоснование для руководства.

    Конкуренция между RSV и гриппом: пределы моделирования вывода из данных эпиднадзора

    Основные моменты

    Респираторно-синцитиальный вирус (RSV) и грипп могут взаимодействовать через врожденный иммунитет.

    Взаимодействие может привести к кратковременной перекрестной защите.

    Математические модели могут использоваться для определения перекрестной защиты от данных наблюдения.

    Вывод модели должен точно и точно определять значения параметров.

    Респираторный сезон Великобритании можно использовать в качестве примера для оценки обратного вывода.

    Abstract

    Респираторно-синцитиальный вирус (RSV) и грипп вызывают большое бремя болезней. Свидетельства их взаимодействия посредством временной перекрестной защиты подразумевают, что предотвращение одного может непреднамеренно привести к увеличению нагрузки на другого.Однако данные о влиянии такого взаимодействия на общественное здоровье немногочисленны и во многом основаны на экологическом анализе сдвигов пиков в данных эпиднадзора. Чтобы проверить надежность оценок параметров взаимодействия между RSV и гриппом на основе данных эпиднадзора, мы провели моделирование и исследование с обратным выводом. Мы разработали модель взаимодействия двух патогенов, параметризованную для моделирования эпидемиологии RSV и гриппа в Великобритании. Используя модель инфекции в сочетании с процессом стохастического наблюдения, подобным эпиднадзору, мы сгенерировали ряд возможных траекторий RSV и гриппа, а затем использовали методы Монте-Карло с цепью Маркова (MCMC), чтобы вывести параметры, в том числе описывающие конкуренцию.Мы обнаружили, что в большинстве сценариев сила и продолжительность взаимодействия RSV и гриппа могут быть достаточно хорошо оценены на основе смоделированных данных эпиднадзора. Однако надежность вывода снизилась в сторону крайних значений вероятных диапазонов параметров с вводящими в заблуждение результатами. Например, невозможно было отличить слабое / умеренное взаимодействие от отсутствия взаимодействия. В заключение, наши результаты показывают, что в вероятном диапазоне параметров силу взаимодействия RSV и гриппа можно оценить на основе высококачественных данных эпиднадзора за один сезон, но также подчеркивает важность проверки идентифицируемости параметра a priori в таких ситуациях.

    Ключевые слова

    Вывод

    Конкуренция

    Грипп

    Респираторно-синцитиальный вирус

    Взаимодействие

    Рекомендуемые статьиЦитирующие статьи (0)

    © 2021 Авторы. Опубликовано Elsevier B.V.

    Рекомендуемые статьи

    Цитирующие статьи

    Frontiers | Цитокины в дыхательных путях как биомаркеры серьезности и прогноза респираторно-синцитиальной вирусной инфекции: обновление

    Введение

    Респираторно-синцитиальный вирус человека (hRSV) - это вирусный агент, который преимущественно участвует в развитии острых инфекций нижних дыхательных путей (LRTI), часто связанных с бронхиолитом и пневмонией у детей и младенцев (1, 2).HRSV является причиной примерно 60% всех LRTI у детей в возрасте до 5 лет и вызывает более 80% зарегистрированных случаев у младенцев (3, 4). В возрасте 2 лет почти все дети были инфицированы hRSV хотя бы один раз, и тяжесть заболевания у этих детей может варьироваться от легких до тяжелых проявлений, иногда требуя госпитализации с введением кислорода или помещения в отделения интенсивной терапии (5, 6) . Более того, инфекция hRSV может вызывать обострение заболеваний дыхательных путей и была связана с повторяющимися хрипами и развитием астмы (7, 8).

    Было предпринято несколько попыток уменьшить влияние чРСВ-НИОТ на здравоохранение. Первое испытание вакцины против hRSV было основано на инактивированном формалином препарате hRSV (FI-hRSV) в 1960-х годах, но этот препарат не смог вызвать эффективный иммунный ответ и, наоборот, вызывал обострение заболевания у детей после инфицирования hRSV (9). После этой первой неудачной попытки было рассмотрено несколько других стратегий вакцинации, начиная от живых аттенуированных вирусных подходов и заканчивая рекомбинантными белками, а также рекомбинантными организмами, использующими как вирусные, так и бактериальные векторы в качестве иммуноадъювантов (10).Важно отметить растущее число клинических испытаний вакцин в последние десятилетия, направленных на определение защитного подхода (фазы I и II, ClinicalTrials.gov 2017: Идентификатор: NCT03213405 и Идентификатор 2018 года: NCT03636906) (2, 11). Однако, несмотря на значительный прогресс, достигнутый в этой области, до сих пор нет коммерчески доступных вакцин против hRSV (12).

    Что касается ведения заболевания, связанного с hRSV, в группах высокого риска, для предотвращения тяжелых проявлений, связанных с hRSV-LRTI, была внедрена профилактика, основанная на нейтрализующих моноклональных антителах (13–15).Паливизумаб и мотавизумаб - это два гуманизированных моноклональных антитела, выработанных против слитого белка F hRSV, которые показали эффективность в предотвращении инфекции hRSV и способность снижать частоту госпитализации младенцев, инфицированных hRSV (16). Однако только паливизумаб был лицензирован для использования в качестве терапии против тяжелых инфекций hRSV, связанных с бронхиолитом и пневмонией. Тем не менее, он не может обеспечить длительную защиту у тех, кто лечится, а затраты, связанные с его использованием, затрудняют реализацию этой стратегии в качестве первого варианта лечения (14).Несмотря на существование нейтрализующих антител, описанных выше в качестве профилактических и терапевтических стратегий, эти подходы не работают как вакцины. Таким образом, на сегодняшний день не существует успешной и доступной стратегии борьбы со вспышками hRSV, которые представляют собой важную проблему общественного здравоохранения во всем мире (17, 18).

    Следовательно, необходимы стратегии предотвращения осложнений, вызванных инфекцией hRSV, и улучшения ведения болезни. Основываясь на этой предпосылке, ранняя диагностика и прогнозирование тяжести заболевания вызвали значительный интерес у исследователей и поиск биологических биомаркеров для прогнозирования тяжести заболевания во время инфекции hRSV.В этом обзоре мы обсуждаем последние исследования потенциальных биомаркеров прогноза, доступные в PubMed, и пересматриваем возможность их включения в рутинную диагностику hRSV.

    Характеристики и патогенез HRSV

    HRSV представляет собой оболочечный негативный одноцепочечный РНК-вирус, принадлежащий к семейству Pneumoviridae (19, 20). В геноме hRSV имеется 10 генов, кодирующих 11 белков, необходимых для репликативного цикла hRSV в инфицированных клетках (21, 22), а также для модуляции иммунного ответа хозяина (23).Были идентифицированы два подтипа hRSV, A и B, причем подтип A в основном связан со вспышками зимой в странах с умеренным климатом (24, 25). hRSV передается при прямом контакте или с частицами аэрозоля и, попав в дыхательные пути, реплицируется в эпителиальных клетках слизистой оболочки, начиная с верхних дыхательных путей и затем продолжая в нижних дыхательных путях (26). Когда hRSV попадает в нижние дыхательные пути, распознавание вирусного антигена клетками врожденного иммунитета вызывает воспалительный ответ - процесс, который является результатом сложных взаимодействий между патогеном и факторами хозяина (27, 28).Воспаление легких, вероятно, является результатом неэффективной активации врожденного иммунитета инфекцией hRSV, что в основном приводит к иммунным ответам Th3 и / или Th27, которые вызывают избыточное производство слизи в дыхательных путях и усиливают воспалительный иммунный ответ в этой ткани, что приводит к легкому иммунопатология (29, 30). После того, как эпителиальные клетки дыхательных путей (AEC) распознают компоненты hRSV (например, белок F и связанные с вирусом нуклеиновые кислоты) через Toll-подобные рецепторы (например, TLR3 или 4) (рис. 1A) и рецепторы гена I, индуцируемого ретиноевой кислотой (RIG-I) сигнальные пути активируют факторы транскрипции, такие как фактор регуляции интерферона 3 (IRF-3) и ядерный фактор κB (NF-κB) (рис. 1A).В свою очередь, эти белки способствуют транскрипции нескольких антивирусных генов и растворимых молекул (30, 31). В ответ на инфекцию hRSV AEC продуцируют провоспалительные молекулы, такие как интерфероны типа I и типа III (IFN) (31, 32). IFN связываются с рецепторами IFN (например, IFNAR), расположенными на поверхности клеток-мишеней, и активируют сигнальные пути через преобразователь сигнала и активатор транскрипции 1 (STAT-1) и факторы транскрипции STAT-2. В идеале STAT будет связываться с факторами регуляции IFN для полной стимуляции транскрипции генов, стимулированных интерфероном (ISG).Одновременно индуцируются и секретируются во внеклеточную среду провоспалительные цитокины, такие как IL-6, фактор некроза опухоли альфа (TNF-α) и хемокины (например, CXCL8, CCL3, CCL2 и CCL5). Важно отметить, что некоторые из этих молекул (например, CCL2 и CCL5) будут способствовать привлечению лейкоцитов (например, моноцитов и нейтрофилов), дендритных клеток, макрофагов, естественных клеток-киллеров и Т-клеток CD4 + к месту инфекции (31 , 32).

    Рисунок 1 . Патогенез hRSV и молекул с потенциалом биомаркеров, индуцированных в дыхательных путях во время инфекции hRSV. (A) HRSV прикрепляется к эпителиальным клеткам дыхательных путей, и это связывание опосредуется взаимодействием между гибридным (F) или гликопротеиновым (G) белком hRSV. Toll-подобный рецептор 4 (TLR4) экспрессируется на AEC и участвует в проникновении hRSV. Когда белок F hRSV связывается с TLR4, это запускает каскад передачи сигналов, при котором активируется первичный ответ миелоидной дифференцировки белка 88 (MyD88). Активация MyD88 приводит к активации митоген-активируемой протеинкиназы (MAPK) и фактора транскрипции NF-kB.Активированный NF-kB перемещается в ядро ​​и способствует выработке цитокинов Th2 (таких как TNF-α, IL-6 и IL-8). Нуклеолин - это белок, расположенный на поверхности клетки, который также участвует в процессе проникновения hRSV, который создает слияние мембраны клетки-хозяина и вируса. Это слияние обеспечивает проникновение вирусного генетического материала в клетку и связывание дцРНК с TLR3. TLR3 запускает каскад передачи сигналов с помощью адаптера-индуцирующего TIR-домен интерферона-β (TRIF), MAPK и фактора транскрипции NF-kB.Этот сигнальный путь способствует продукции IL-33 и TSLP. HRSV также может инфицировать дендритные клетки (DC) , и вирус опосредует его проникновение через рецептор TLR4, присутствующий на поверхности DC. Затем ДК инфицированы, и генетический материал вируса попадает в клетку. dsRNA связывает рецептор TLR7, присутствующий в эндосоме, продуцируемой слиянием, причем один из TLR3 запускает каскад передачи сигналов с помощью белка MyD88, MAPK и фактора транскрипции NF-kB или фактора регуляции интерферона (IRF).Эти сигнальные пути способствуют продукции IL-12 и IFN-α соответственно. (B) Инфицированные AEC секретируют несколько цитокинов и хемокинов, которые были описаны как потенциальные биомаркеры. Высокие уровни IL-33 продуцируются AEC, а клетки, экспрессирующие рецептор ST2, такие как ILC2, отвечают на IL-33 посредством продукции IL-5 и IL-13, которые способствуют привлечению эозинофилов, вызывающих обострение заболевания и связано с необходимостью вентиляции. Тучные клетки также экспрессируют рецептор ST2, и когда IL-33 связывается с этими рецепторами, продуцируется IL-3.AEC продуцируют высокие уровни IL-8 , способствуя привлечению нейтрофилов в очаг инфекции, что может вызвать гипоксию, потребность в вентиляции и развитие астмы. TSLP Производство осуществляется при посредничестве AEC. Этот цитокин распознается рецептором TSLPR, который экспрессируется макрофагами, вызывая обострение болезни и астмы. Периостин продуцируется АЭК или эозинофилами. Этот белок увеличивает экспрессию медиаторов воспаления.Отложения периостина в легких связаны с обострением астмы. IL-6 продуцируется AEC и способствует ответу Th3. Этот цитокин участвует в стимулировании наивной дифференцировки в Т-клетки CD4 + и CD8 + . CD4 + Т-клетки запускают выработку IL-13 и реакцию сверхреакции Th3. CD8 + Т-клетки увеличивают тяжесть заболевания. IFN-α производится pDC и AEC. На поздних этапах инфицирования высокие уровни этого цитокина продуцируют высокие уровни ИЛ-10 Т-клетками. IL-12 продуцируется pDC и способствует дифференцировке наивных Т-клеток в клетки Th2 и индуцирует слабую продукцию IFN-γ Т-клетками. Это низкое образование IFN-γ вызывает чрезмерную реакцию Th3. IL-3 способствует выработке базофилов и эозинофилов, вызывая воспалительные и аллергические заболевания, такие как астма. IL-13 продуцируется, среди прочего, клетками ILC2 и CD4 + Т-клетками. Высокие уровни IL-13 приводят к чрезмерной реакции Th3 и привлечению эозинофилов, которые вызывают усиленное производство слизи, гиперреактивность дыхательных путей и воспаление.Различные линии (пунктирные и сплошные) использовались для облегчения понимания рисунка и различных задействованных сигнальных путей.

    Эффективный клиренс hRSV требует сбалансированного адаптивного иммунного ответа Th2 и Th3, который способствует продукции IFN-γ цитотоксическими CD8 + Т-клетками (27, 33). Однако во время инфекции hRSV у хозяина вызывается слабый IFN-ответ типа I, в результате чего вирусная репликация эффективна в инфицированных клетках и генерируется провоспалительный Th3-ответ (34) (рисунки 1A, B).Поскольку инфекция hRSV не вызывает эффективного ответа памяти, который обеспечивает защитный иммунитет от последующего воздействия вируса, очень часто возникают повторные инфекции, которые приводят к гиперреактивности, повторяющимся хрипам и повышенной восприимчивости к развитию астмы (35).

    Клинические проявления инфекции HRSV

    Клинические проявления LRTI, вызванные hRSV, могут варьироваться в зависимости от сопутствующей патологии человека, возраста или пола, воздействия загрязнения воздуха, астмы у родителей в анамнезе или предыдущих инфекций, среди прочего (2, 36).HRSV-LRTI может сопровождаться заложенностью носа, ринореей, кашлем, хрипом и одышкой (36, 37) с повышенным риском последующих эпизодов хрипов, которые могут длиться в течение нескольких лет после острой инфекции. Действительно, патология, вызванная респираторными вирусами в дыхательных путях, характеризуется изменениями в респираторном эпителии, что стимулирует выработку провоспалительных цитокинов и хемокинов, которые способствуют проникновению иммунных клеток в легкие (38, 39). В некоторых случаях эта реакция может обостриться и вызвать временные или пожизненные изменения в легких, что приведет к повторяющимся эпизодам свистящего дыхания и астме (3, 40).Хотя большинство вирусных инфекций вызывают преходящую гиперреактивность дыхательных путей (41, 42), у пациентов с атопией или астмой в анамнезе может наблюдаться усиленное вирусное воспаление со значительной обструкцией дыхательных путей, что приводит к более тяжелому заболеванию (43, 44). Следовательно, идентификация инфицированных hRSV пациентов, предрасположенных к развитию более тяжелых заболеваний, будет иметь важное значение для принятия более эффективных клинических решений.

    Диагностика инфекции HRSV

    Ранняя клиническая диагностика инфекции hRSV может помочь улучшить лечение пациентов с респираторными инфекциями и предвидеть тяжелые исходы в соответствии с клиническими предрасполагающими факторами, такими как возраст.В настоящее время доступные методы диагностики hRSV включают тесты, основанные на молекулярной, вирусологической или иммунологической диагностике.

    В настоящее время наиболее часто используемые методы диагностики hRSV основаны на прямой иммунофлуоресценции (DIF), обратной транскриптазе-ПЦР (RT-PCR), иммунохроматографическом анализе (CIA) и иммуноферментном анализе (EIA). Другие более сложные методологии, которые чаще использовались в последние годы, основаны на обнаружении нескольких аналитов в сложных мультиплексных анализах (таких как Luminex или Affimetrix), поскольку эти подходы быстрее, чем культивирование вирусов (11, 45, 46 ).Некоторые молекулярные анализы, такие как ОТ-ПЦР и Luminex, обладают высокой диагностической чувствительностью по сравнению с методом культивирования клеток, но только ОТ-ПЦР используется в качестве эталонного метода (47). Хотя ОТ-ПЦР является самой быстрой, ее реализация дороже по сравнению с анализами DIF, EIA или CIA. Однако, хотя последние являются низкозатратными и быстрыми, их чувствительность ниже, чем у RT-PCR или Luminex, и в некоторых случаях (например, DIF) интерпретация результатов является несколько субъективной и требует технических навыков, времени и экспертиза (47).

    Иммунологическая диагностика hRSV основана на характеристике клеточного и цитокинового / хемокинового профилей (48, 49). В этом случае проточная цитометрия является основным методом, используемым для идентификации типов клеток, присутствующих в жидкости бронхоальвеолярного лаважа (ЖБАЛ) и образцах периферической крови пациентов с инфекцией hRSV. Клетки, попадающие в легкие, включают нейтрофилы, дендритные клетки, Т- и В-клетки, альвеолярные макрофаги и моноциты (10, 35). Клинические исследования с участием детей, инфицированных hRSV, показали повышенное количество нейтрофилов (CD11b + , CD18 + и CD54 + ) (50), альвеолярных макрофагов (экспрессирующих TNF-α) (51), моноцитов (CD69 ). + ) (52) и В-клетки (53), проникающие в инфицированные дыхательные пути.Напротив, присутствие Т-клеток (CD4 + и CD8 + ) и плазмоцитоидных дендритных клеток (ДК, HLA-DR + , CD123 + / CD11c - ) значительно снижается в периферической крови инфицированных детей. по сравнению со здоровыми детьми контрольных групп (54, 55). Помимо характеристики клеток, инфильтрирующих дыхательные пути, также информативным является профиль цитокинов / хемокинов, наблюдаемый в инфицированной ткани. Основными цитокинами, оцениваемыми в ЖБАЛ людей, инфицированных hRSV, в основном являются IL-2, IL-12, IFN-γ, IL-8, IL-6 и TNF-α (35).Важно отметить, что все эти цитокины можно оценить с помощью проточной цитометрии, ELISA, RT-PCR или Luminex (56–58).

    Типы образцов, используемых для выявления hRSV или иммунных маркеров, могут быть носовыми промывками, носоглоточными аспиратами (NPA), носоглоточными мазками, BALF, сывороткой и периферической кровью (11, 45, 46). Однако цитокины как биомаркеры следует оценивать в очаге инфекции (верхние и нижние дыхательные пути) и, в меньшей степени, в периферической крови. Роль вышеупомянутых цитокинов во время инфекции обсуждается ниже в следующих разделах.

    Прогноз тяжести инфекции HRSV

    Среди пациентов с диагнозом ИНДП значительному количеству детей, инфицированных вирусом РСВ, которые проходят амбулаторное лечение, потребуется дополнительная медицинская помощь из-за респираторных осложнений. Кроме того, у значительного процента диагностированных пациентов в последующие месяцы после первого эпизода ИНДП будут наблюдаться повторяющиеся эпизоды свистящего дыхания и другие осложнения (59, 60). Стоит отметить, что этих пациентов невозможно идентифицировать на раннем этапе после заражения из-за отсутствия точных инструментов для прогнозирования тяжести заболевания.Кроме того, в настоящее время нет единого мнения о прогнозировании исхода у пациентов с ИДП, вызванной чРСВ, что представляет проблему для лечения заболевания из-за быстрого развития заболевания, при котором может неожиданно потребоваться искусственная вентиляция легких в течение 24 часов или меньше (61). В настоящее время широко используются методы, основанные на клинических параметрах, используемых врачами для поддержки клинических решений (62). Однако эти параметры могут быть в некоторой степени субъективными и недостаточно точными, чтобы выполнить точную категоризацию или прогноз тяжести заболевания (63, 64).Для решения этой проблемы биомаркеры в образцах пациентов могут способствовать более точному диагнозу и могут помочь врачам принимать более точные решения, увеличивая возможность получения лучших результатов (4, 65). В соответствии с этим представлением, в последние годы несколько исследовательских групп сосредоточились на определении точного метода определения степени тяжести и прогрессирования НИПТ при чРСС (62, 66–68). Ниже мы описываем различные параметры и растворимые молекулы, которые в настоящее время используются для оценки тяжести заболевания у пациентов, инфицированных hRSV (Таблица 1).

    Таблица 1 . Молекулы и клетки как маркеры тяжести респираторных заболеваний.

    Клиническая оценка как биомаркер, связанный с тяжестью заболевания

    Использование моделей прогнозирования для расчета риска тяжелого исхода при ИДПТ у детей ранее применялось на основе клинических характеристик пациентов, радиологических данных и лабораторных результатов (77). За последние 10 лет значительный прогресс в диагностике был достигнут благодаря доступности транскрипционных профилей, которые позволили установить отпечатки пальцев, связанные с прогрессированием и тяжестью заболевания, вызванного инфекцией hRSV (78).Среди доступных методов, основанных на транскриптомных подходах, «молекулярное расстояние до здоровья» (MDTH) оказалось многообещающим инструментом диагностики инфекций дыхательных путей (68, 79). MDTH - это инструмент, предназначенный для измерения изменений в профиле транскрипции иммунных клеток (т.е. нейтрофилов, цитотоксических клеток и Т-клеток), полученных от пациентов (80). Данные получены в результате теста в виде единой оценки, которую сравнивают с базальной оценкой здоровых контролей. Важно отметить, что оценка MDTH, проведенная в первые дни инфицирования hRSV, позволила предсказать тяжесть заболевания с точки зрения количества дней госпитализации и потребностей в интенсивной терапии (78).

    Микробные факторы как биомаркеры серьезности

    Хорошо известно, что чем выше микробная нагрузка в очаге инфекции, тем выше вероятность повреждения тканей, что связано с худшим прогнозом. Основываясь на этой предпосылке, несколько исследовательских групп попытались продемонстрировать прямую связь между вирусной нагрузкой и тяжестью заболевания (81), но выводы несколько противоречивы. Различные исследования показали прямую корреляцию между увеличением вирусной нагрузки и более тяжелыми клиническими проявлениями (81–83).Фактически, эти исследования показали, что высокая вирусная нагрузка hRSV на 3-й день в значительной степени связана с потребностью в интенсивной терапии и респираторной недостаточностью (84). Напротив, такие исследования, как (69, 85) и Piedra et al. сообщили об обратном, где высокие нагрузки hRSV в начале инфекции коррелируют с защитным иммунным ответом и менее тяжелым прогрессированием заболевания (86). Эти результаты вызывают дискуссию о роли вирусной нагрузки в прогрессировании заболевания и возможности рассмотрения этого фактора в качестве потенциального биомаркера для определения тяжести заболевания в отношении hRSV-LRTI, поскольку вирусная нагрузка может опережать иммунный ответ хозяина на вирус.

    Растворимые белки как биомаркеры тяжести заболевания

    В последние несколько лет анализ паттернов экспрессии белков стал одной из наиболее исследуемых областей диагностики. Образцы, используемые для получения паттернов экспрессии белков, варьируются от образцов крови до образцов из носоглотки, что позволяет получить полезные сведения об идентификации молекул, связанных с серьезностью инфекции. Например, повышенные уровни сывороточных трансаминаз, аминотрансфераз и антидиуретических гормонов были связаны с тяжелыми случаями бронхиолита, вызванного вирусом hRSV (70, 71).Кроме того, повышенный уровень лактатдегидрогеназы (ЛДГ) в образцах носоглотки также показал прогностическую ценность 88% при определении тяжести заболевания у маленьких детей с бронхиолитом (72, 73). Другой молекулой, предложенной в качестве биомаркера тяжести заболевания, является муцин 5AC (MUC5AC), высокогликозилированный белок, присутствующий в слизи дыхательных путей (74). Сообщается, что этот белок обнаруживается в назальных аспиратах, полученных от детей, инфицированных hRSV, и его присутствие и концентрация коррелируют с тяжестью заболевания, вызванного hRSV (75).Взятые вместе, несколько растворимых молекул показывают корреляцию с тяжестью заболевания, связанного с hRSV, и могут быть легко обнаружены в образцах, которые легко получить, и, таким образом, могут использоваться в качестве биомаркеров тяжести заболевания, связанного с инфекциями, вызванными hRSV.

    Провоспалительные цитокины как биомаркеры тяжести заболевания при инфекциях hRSV

    Во время инфекции hRSV врожденный иммунный ответ хозяина, генерируемый против вируса, может быть несбалансированным и, в конечном счете, вредным для хозяина.Неоптимальные ответы против вируса - это Th3-подобные ответы с образованием цитокинов, которые, в свою очередь, могут привлекать многочисленные провоспалительные иммунные клетки (35, 56). Кроме того, в нескольких исследованиях сообщалось об увеличении уровней Th3-подобных цитокинов в различных типах образцов (ЖБАЛ, сыворотка, кровь, плазма, носоглоточные или аспирационные смывы), что может коррелировать с тяжестью заболевания у детей. Такими цитокинами, которые могут быть использованы в качестве биомаркеров прогноза, являются IL-33, IL-8, TSLP, IL-6, периостин и IFN-α.Эти биомаркеры могут предсказывать тяжесть заболевания, вызванного вирусом вирусного гепатита C, у детей (таблица 2). Другие цитокины, такие как IL-12, IL-3 и IL-13, также могут быть потенциальными биомаркерами, хотя необходимы дополнительные клинические исследования (Таблица 3). Далее мы объясним, как некоторые из этих цитокинов могут быть полезны для прогнозирования тяжести инфекции hRSV.

    Таблица 2 . Провоспалительные цитокины как биомаркеры прогноза респираторных заболеваний.

    Таблица 3 . Провоспалительные цитокины как потенциальные биомаркеры прогноза респираторных заболеваний.

    Интерлейкин-33 (ИЛ-33)

    IL-33 конститутивно экспрессируется эндотелиальными и эпителиальными клетками. Основная функция этого цитокина - инициация и развитие врожденного и адаптивного иммунного ответа типа Th3 (103). Клетки, экспрессирующие рецептор ST2, реагируют на IL-33, включая тучные клетки, эозинофилы и базофилы, среди прочего (104). Врожденные лимфоидные клетки типа 2 (ILC2) также нацелены на IL-33 для производства цитокинов Th3-типа (IL-6, IL-8, IL-5, IL-13), которые, в свою очередь, способствуют Th3-ответу с привлечением эозинофилов. , вызывая обострение болезни (105) (рис. 1B).Недавние исследования на мышах, у которых IL-33 был нейтрализован во время инфекции hRSV, показали, что тяжелая патология не вызывалась и что у мышей, получавших IL-33 во время инфекции hRSV, быстро развивалось заболевание, что приводило к более тяжелому клиническому исходу (35, 88). Интересно, что Saravia et al. измерили уровни IL-33 в NPA и показали связь с потребностью в вентиляции у младенцев, госпитализированных с бронхиолитом, вызванным hRSV (87). В 2015 году Бертран и др. провели исследование у детей с бронхиолитом, вызванным hRSV, и выявили высокие уровни экспрессии IL-33 в NPA у пациентов с семейным анамнезом атопии (66).Гарсия-Гарсия и др. измерили уровни IL-33 из NPA у детей, инфицированных hRSV, что связывало бронхиолит с высоким уровнем этого цитокина. Кроме того, оба исследования описывают, что цитокин IL-33 повышается при коинфекции (88). Взятые вместе, эти результаты показывают, что IL-33 может быть хорошим биомаркером для определения тяжести и прогноза бронхиолита, вызванного hRSV.

    Интерлейкин-8 (ИЛ-8)

    IL-8 играет главную хемотаксическую роль и в основном продуцируется моноцитами, эндотелиальными клетками, макрофагами и Т-клетками (106, 107).IL-8 связывается с рецепторами, связанными с G-белком, CXCR1 и CXCR2, экспрессируемыми клетками, среди которых моноциты, нейтрофилы, эндотелиальные клетки, макрофаги и Т-клетки (108, 109) (рис. 1B). Во время инфицирования hRSV McNamara et al. обнаружили, что концентрация IL-8 остается повышенной во время болезни, даже когда количество и набор нейтрофилов в конечном итоге уменьшаются (110). Повышенные уровни IL-8 (в образцах из носоглотки) широко коррелировали с тяжестью заболевания, вызванного инфекцией hRSV, включая риск искусственной вентиляции легких (4, 90).В 2013 году Диас и др. обнаружили высокие уровни IL-8 в NPA у детей с тяжелым бронхиолитом, вызванным вирусом hRSV, по сравнению с контрольной группой и пациентами с легкими проявлениями заболевания. В частности, они наблюдали повышение уровня IL-8 в группе пациентов с тяжелым заболеванием (111), что может свидетельствовать о том, что более высокие уровни этого цитокина связаны с более серьезной инфекцией hRSV. Табарани и др. Выявлено, что в смывах из носоглотки повышены уровни IL-6, IL-8 и TNF-α, связанные с тяжестью заболевания hRSV у маленьких детей (89).В этом исследовании авторы связали тяжесть заболевания с возрастом людей, хроническими заболеваниями и повышенными концентрациями IL-8, а также других молекул (89). В другом исследовании, проведенном у детей с тяжелой инфекцией hRSV, Brand et al. оценили уровни IL-8 в плазме и NPA и обнаружили увеличение IL-8 в плазме детей с тяжелым заболеванием по сравнению с детьми с легким или умеренным заболеванием (48). В 2015 году Диас и др. провели еще одно исследование у детей с бронхиолитом, вызванным hRSV и риновирусом (RV).Это исследование показало более высокие уровни IL-8 в NPA у детей, инфицированных как hRSV, так и RV, чем у детей, инфицированных только RV, что было связано с большим количеством дней, требующих лечения O 2 (92). Основываясь на этом исследовании, можно предположить, что высокие уровни IL-8 у детей, инфицированных hRSV, будут служить хорошим предиктором для определения дней, когда потребуется лечение O 2 . В 2016 году Хуанг и др. провели клиническое исследование, в котором участвовали 96 пациентов с астмой и хронической обструктивной болезнью легких (ХОБЛ) и 35 здоровых людей из контрольной группы.Их результаты показали увеличение уровней IL-8 и других цитокинов, которые были связаны с тяжестью заболеваний дыхательных путей. Исследователи предполагают, что IL-8 может быть потенциальным маркером для оценки астмы и ХОБЛ (91). Нет новых клинических исследований, которые коррелируют высокие уровни этого цитокина с тяжестью заболевания.

    Тимический стромальный лимфопоэтин (TSLP)

    TSLP экспрессируется несколькими типами клеток, но в основном эпителиальными клетками и кератиноцитами (112, 113). Для этого цитокина описаны две изоформы: длинная и короткая форма TSLP (114).Короткая изоформа конститутивно экспрессируется в нескольких тканях, особенно в тех, которые очень чувствительны к воспалению. Важно отметить, что длинная изоформа TSLP широко коррелировала с усилением иммунных ответов и возникновением аллергии и астмы у пациентов с атопическим дерматитом (95) (рис. 1B). У детей астма может быть следствием различных факторов. Однако в последнее десятилетие возможная связь с вирусными инфекциями привлекла повышенное внимание исследователей (88).В настоящее время появляется все больше данных, свидетельствующих о связи между TSLP, вызванным инфицированием hRSV или RV, и развитием астмы (88, 94). Однако еще предстоит выяснить, способствует ли астма тяжелому вирусному заболеванию или астма является результатом тяжелого заболевания, вызванного респираторной инфекцией. Ли и др. сообщили, что распознавание вирусного антигена запускает сигнальный каскад с участием ядерного фактора NF-κB и гена 1, индуцированного ретиноевой кислотой (RIG-1) (115). Активация этого каскада привела к продукции TSLP и сильному Th3-ответу, внося свой вклад в патофизиологию, наблюдаемую при тяжелом бронхиолите, который в конечном итоге в некоторых случаях прогрессировал до астмы (115).Позже Гарсия-Гарсия и др. показали связь между TSLP вместе с периостином и IL-33 с тяжестью заболевания при инфекции дыхательных путей у детей. Это исследование показало корреляцию между повышенными уровнями TSLP с бронхиолитом, вызванным hRSV, и коинфекциями с риновирусом, а также с тяжелым заболеванием и поступлением в отделение интенсивной терапии (ОИТ) (88).

    Интерлейкин-6 (ИЛ-6)

    IL-6 - растворимый медиатор, который может продуцироваться макрофагами и эпителиальными клетками (116).После своего синтеза IL-6 перемещается в печень через кровоток и оказывает плейотропное действие на иммунитет и воспаление (117). Этот цитокин участвует в стимулировании дифференцировки наивных CD4 + и CD8 + Т-клеток и является важным звеном между врожденным и приобретенным иммунитетом (117) (Рисунок 1B). В 2013 году Табарани и др. оценивали уровни IL-6 в образцах смыва из носоглотки от детей с LRTI и hRSV. Интересно, что они обнаружили корреляцию между степенью клинических проявлений, вызванных инфекцией hRSV, и высокими уровнями IL-6 среди других медиаторов воспаления (CCL2, TNF-α, CXCL8, IL-10) (89).С другой стороны, Brown et al. предположили, что высокие уровни IL-6 в плазме могут указывать на более высокую вероятность госпитализации младенцев и тяжелого бронхиолита, вызванного hRSV (4). В 2016 году Лу и др. также выявили высокие уровни IL-6 в NPA пациентов с hRSV, и это коррелировало с более высокой тяжестью заболевания hRSV (100). Повышенные уровни IL-6 и других цитокинов также были обнаружены в жидкостях для промывания носа у детей с НИПТ, особенно тех, которые нуждались в лечении O 2 (35, 118).Другие исследования, проведенные у детей с бронхиолитом, вызванным инфекцией hRSV, показали, что высокие уровни IL-6 в образцах из носа и ЖБАЛ коррелируют с потребностью в вентиляции и с более высокой степенью гипоксии (35, 92). В этом исследовании авторы предположили, что IL-6 и другие оцениваемые цитокины могут быть надежными биомаркерами для определения тяжести инфекции hRSV.

    Периостин

    Периостин - это белок, который экспрессируется на базальном уровне почти во всех тканях человека (119).Его экспрессия также обнаруживается в респираторном эпителии и повышена у детей с астмой (120). Этот белок вырабатывается эозинофилами в ответ на передачу сигналов IL-4 и IL-13 (121) (рис. 1B). Роль периостина связана, в частности, с возникновением аллергического воспаления и развитием фенотипа Th3 (120) (рисунок 1B). Периостин был связан с тяжестью астмы, и повышенные уровни периостина были обнаружены в сыворотке крови детей с обострением астмы (122).Lopez-Guisa и его коллеги оценили уровни периостина в бронхиальных и носовых клетках у астматических, неастматических, атопических и здоровых детей и обнаружили значительное увеличение уровней периостина у астматических детей (в 3,7 раза) по сравнению с другими группами (96). . Эти результаты были подтверждены в исследованиях, которые показали корреляцию между высокими уровнями периостина в сыворотке крови и стойкой или неконтролируемой астмой у детей (97, 98). Фактически, клинические проявления астмы очень похожи на симптомы бронхиолита (123).Эти данные позволяют предположить, что астма может быть следствием тяжелого бронхиолита у детей (123). Гарсия-Гарсия и др. показали в NPA, что повышенные концентрации периостина были связаны с более тяжелой инфекцией hRSV по сравнению со здоровыми детьми (88, 93). Совсем недавно уровни периостина были связаны с тяжестью вирусного бронхиолита, поскольку у детей с тяжелой легочной гипертензией был высокий уровень этого белка по сравнению с детьми с легкой легочной гипертензией (8 887 ± 1582 пг / мл против5016 ± 1017 пг / мл) (99). Эти результаты показывают, что периостин может быть еще одним хорошим биомаркером для прогноза инфекции hRSV и особенно бронхиолита.

    Интерферон альфа (IFN-α)

    IFN представляют собой большое семейство плейотропных цитокинов. В частности, IFN-α и IFN-β являются членами семейства интерферонов I типа, продуцируемых эпителиальными клетками и большинством иммунных клеток (124). Чтобы проявлять свое биологическое действие, IFN типа I связывается с рецептором IFN типа I (IFNAR1 / 2) (125), который запускает экспрессию провоспалительных молекул и противовирусных генов, таких как те, которые участвуют в деградации вирусной РНК. (126).Важно отметить, что распознавание неструктурного белка 1 hRSV (NS1) коррелировало с нарушением функции IFN-α, в частности, за счет индукции miRNA miR-29a, которая ингибирует экспрессию рецептора IFN-α в инфицированных клетках ( 101). Эти исследования показывают, что низкие уровни IFN-α могут быть связаны с серьезностью инфекции hRSV и, следовательно, могут использоваться в качестве биомаркера. Однако другие исследования, основанные на профиле транскрипции образцов крови и мазков из носоглотки, сообщают о противоположных результатах, указывающих на то, что интерфероны I типа, особенно IFN-α / β, повышаются при бронхиолите, вызванном вирусом hRSV, и коррелируют с тяжелым заболеванием и повторяющимся хрипом (89, 102). ).Эти исследования предполагают, что пути передачи сигналов интерферона могут служить важными биомаркерами, связанными с нагрузкой и тяжестью hRSV (102). Устранение несоответствий, обнаруженных в различных исследованиях, анализирующих роль IFN-α в тяжести заболевания hRSV, потребует дальнейших исследований, которые в идеале связывают результаты транскрипции с уровнями белка в крови и образцах носоглотки.

    Другие потенциальные провоспалительные цитокины как биомаркеры степени тяжести, вызванной HRSV

    Помимо цитокинов, описанных выше как потенциальных биомаркеров серьезности hRSV (4), недавние исследования предварительно указали на другие провоспалительные цитокины, которые показывают положительную корреляцию с серьезностью hRSV и являются потенциальными биомаркерами прогноза респираторных заболеваний (Таблица 3).Некоторые из этих цитокинов описаны ниже.

    Интерлейкин-12 (ИЛ-12)

    IL-12 продуцируется в ответ на вирусные или бактериальные инфекции DC и другими антиген-презентирующими клетками и участвует в стимулировании дифференцировки наивных Т-клеток в Т-клетки Th2 (127) (рис. 1B). Бертран и др. показали, что образцы из носа и легких показывают повышенные уровни IL-12 у пациентов с НИОТ. Кроме того, они впервые показали, что высокие уровни IL-12p40 (в BALF) и других цитокинов могут быть связаны с рецидивирующим хрипом и развитием астмы у младенцев с бронхиолитом, вызванным инфекцией hRSV (35, 66).

    Интерлейкин-3 (ИЛ-3)

    IL-3 в основном экспрессируется тучными клетками и активированными Т-клетками, расположенными в дыхательных путях (128). Этот цитокин вызывает увеличение продукции базофилов и эозинофилов (129) (рис. 1B) и участвует в патогенезе астмы (128). В 2015 году Бертран и др. впервые описали наличие высоких уровней IL-3 в BALF и NPA, полученных от детей младше 9 месяцев с острым бронхиолитом, вызванным hRSV. Кроме того, авторы обнаружили корреляцию между высокими уровнями IL-3 с эпизодами повторяющихся хрипов и развитием астмы в будущем (66).Лу и др. также были обнаружены высокие уровни IL-3 в NPA у детей с бронхиолитом, вызванным hRSV, и повышенный риск астмы, что было связано с более высокой тяжестью заболевания (100). Результаты этого исследования предполагают, что IL-3 может участвовать в развитии хронических воспалительных заболеваний дыхательных путей и что его можно использовать для прогнозирования клинических исходов при hRSV-LRTI. Авторы последовательно предположили, что ИЛ-3 можно в конечном итоге использовать для прогнозирования клинического исхода пациентов.

    Интерлейкин-13 (ИЛ-13)

    В легких IL-13 является медиатором эозинофильного воспаления, секреции слизистой оболочки и гиперреактивности бронхов (130).Было замечено, что уровень IL-13 повышен при ХОБЛ, а также при астме и других заболеваниях легких (131). Важно отметить, что IL-13 вырабатывается в ответ на передачу сигналов IL-33 и высвобождается из различных клеток, включая альвеолярные макрофаги, базофилы, тучные клетки, эозинофилы, Т-клетки ILC2 и CD4 + (132) (Рисунок 1B). В 2015 году Saravia et al. связали высокие уровни IL-13 и IL-33 с необходимостью вентиляции у младенцев, госпитализированных с бронхиолитом, вызванным hRSV (87). Соответственно, на животной модели hRSV (мыши BALB / c) сообщалось о повышающей регуляции IL-13, что приводит к рекрутированию эозинофилов в дыхательные пути, что вызывает усиленное производство слизи, гиперреактивность легких и воспаление дыхательных путей (132 ).В более позднем исследовании, проведенном в 2016 году, оценивались уровни IL-13 в крови детей, получающих лечение от респираторных симптомов после тяжелого бронхиолита, вызванного вирусом RSV, и было обнаружено, что IL-13 может использоваться в качестве клинического диагностического маркера астмы (100).

    Заключительные замечания

    Биомаркеры для классификации степени тяжести инфекций дыхательных путей стали глобальной потребностью из-за отсутствия эффективных стратегий по снижению воздействия таких заболеваний и необходимости улучшения ведения пациентов и их потенциальных результатов.Большинство усилий направлено на разработку высокочувствительных, быстрых и недорогих методов, позволяющих точно прогнозировать прогноз пациентов с респираторными инфекциями. В настоящее время идентифицировано большое количество молекул, которые могут помочь в оценке тяжести заболевания, однако их специфичность и чувствительность остаются проблемными и еще недостаточно сильными, чтобы точно предсказать исход заболевания и стать каноническим биомаркером для прогнозирования тяжести ИНДП, связанной с hRSV. Следовательно, необходимы дополнительные исследования для установления паттернов провоспалительных цитокинов и экспрессии цитокинов, которые связаны с развитием заболевания на разных стадиях инфекции hRSV.В идеале конкретные профили провоспалительных цитокинов в конечном итоге позволят определить на ранней стадии во время инфекции тяжесть заболевания, вызванного hRSV.

    Авторские взносы

    YV, LG и LN несут ответственность за написание этой обзорной статьи. PG, CR и PB несут ответственность за рецензирование статьи, а SB является ведущим исследователем и оказывает помощь в организации и редактировании рукописи.

    Финансирование

    Этот обзор был поддержан грантами № 1170964, 11

    и 1161525 из программы Национального фонда научного и технологического развития (FONDECYT) Министерства образования Чили; Грант 13CTI-21526 из программы INNOVA-CORFO Министерства экономики Чили и Института иммунологии и иммунотерапии «Миллениум», грант P09 / 016-F.

    Заявление о конфликте интересов

    Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могут быть истолкованы как потенциальный конфликт интересов.

    Благодарности

    Мы благодарим педиатрическое отделение и медицинскую школу Папского католического университета Чили за помощь и клинические образцы. Мы благодарны Тринидаду Селису (Папский католический университет Чили), создавшему графику.

    Сокращения

    hRSV, респираторно-синцитиальный вирус человека; LRTI, инфекция нижних дыхательных путей; TSLP, тимический стромальный лимфопоэтин; ИЛ, интерлейкин; IFN, интерферон; BALF, жидкость бронхоальвеолярного лаважа; NPA, носоглоточный аспират; TLR, Toll-подобные рецепторы; AECs, эпителиальные клетки дыхательных путей; NF-κB, Ядерный фактор κB.

    Список литературы

    1. Simões EA. Лечение и профилактика респираторно-синцитиального вируса инфекции нижних дыхательных путей: долгосрочное влияние на респираторные исходы. Am J Respir Crit Care Med. (2001) 163: S14–7. DOI: 10.1164 / ajrccm.163.supplement_1.2011112

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    2. Мазур Н.И., Бонт Л., Коэн А.Л., Коэн С., Фон Готтберг А., Грум М.Дж. и др. Тяжесть респираторно-синцитиальной инфекции нижних дыхательных путей с вирусной коинфекцией у детей, не инфицированных ВИЧ. Clin Infect Dis. (2016) 64: 443–50. DOI: 10.1093 / cid / ciw756

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    3.Чжун Ц., Фэн Х., Лу Ц., Лю Х, Чжао Ц., Ду И и др. Рецидивирующее свистящее дыхание при пневмонии новорожденных связано с сочетанной инфекцией респираторно-синцитиальным вирусом Staphylococcus aureus или Klebsiella pneumoniae . Научный доклад (2018) 8: 995. DOI: 10.1038 / s41598-018-19386-y

    CrossRef Полный текст | Google Scholar

    4. Brown PM, Schneeberger DL, Piedimonte G. Биомаркеры респираторно-синцитиальной вирусной инфекции (RSV): специфические уровни нейтрофилов и цитокинов обеспечивают повышенную точность прогнозирования тяжести заболевания. Paediat Respir Rev. (2015) 16: 232–40. DOI: 10.1016 / j.prrv.2015.05.005

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    5. Глезен В.П., Табер Л.Х., Франк А.Л., Касель Дж.А. Риск первичного заражения и повторного заражения респираторно-синцитиальным вирусом. Am J Dis Children. (1986) 140: 543–6. DOI: 10.1001 / archpedi.1986.02140200053026

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    8. Коктурк Н., Боздай Г., Йылмаз С., Доган Б., Гульбахар О., Рота С. и др.Обнаружение аденовируса и респираторно-синцитиального вируса у пациентов с хронической обструктивной болезнью легких: обострение или стабильное состояние. Мол. Med. Отчет (2015) 12: 3039–46. DOI: 10.3892 / mmr.2015.3681

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    9. Ким Х.В., Канчола Дж. Г., Брандт С. Д., Пайлс Г., Чанок Р. М., Дженсен К. и др. Респираторно-синцитиальное вирусное заболевание у младенцев, несмотря на предварительное введение антигенной инактивированной вакцины. Am.J. Epidemiol. (1969) 89: 422–34. DOI: 10.1093 / oxfordjournals.aje.a120955

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    10. Рей-Хурадо Э., Сото Дж., Гальвес Н., Калергис А.М. Безопасная и эффективная вакцина с вектором БЦЖ для предотвращения заболевания, вызываемого респираторно-синцитиальным вирусом человека. Hum Vacc Immunotherapeutics. (2017) 13: 2092–7. DOI: 10.1080 / 21645515.2017.1334026

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    11.Гриффитс С., Дрюс С.Дж., Марчант Д.Дж. Респираторно-синцитиальный вирус: инфекция, обнаружение и новые возможности профилактики и лечения. Clin. Microbiol. Ред. (2017) 30: 277–319. DOI: 10.1128 / CMR.00010-16

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    12. Мазур Н.И., Хиггинс Д., Нунес М.К., Мелеро Дж. А., Лангедейк А.С., Хорсли Н. и др. Пейзаж вакцин против респираторно-синцитиального вируса: уроки с кладбища и многообещающие кандидаты. Lancet Infect.Дис. (2018) 18: e295–311. DOI: 10.1016 / S1473-3099 (18) 30292-5

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    13. Touch SM, Spitzer AR. Паливизумаб, гуманизированное моноклональное антитело к респираторно-синцитиальному вирусу, снижает количество госпитализаций в связи с инфекцией респираторно-синцитиального вируса у младенцев из группы высокого риска. Clin. Педиатр. (Фила). (1999) 38: 556.

    Google Scholar

    14. Реш Б. Обзор продукта на моноклональные антитела паливизумаб для профилактики респираторно-синцитиальной вирусной инфекции. Hum Vacc Immunotherapeutics. (2017) 13: 2138–49. DOI: 10.1080 / 21645515.2017.1337614

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    15. Симойнс Э.А., Бонт Л., Манзони П., Фору Б., Паес Б., Фигерас-Алой Дж. И др. Прошлые, настоящие и будущие подходы к профилактике и лечению респираторно-синцитиальной вирусной инфекции у детей. Infect Dis Ther. (2018) 7: 87–120. DOI: 10.1007 / s40121-018-0188-z

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    16.О'Брайен К.Л., Чандран А., Уэзерхольц Р., Джафри Х.С., Гриффин М.П., ​​Беллами Т. и др. Эффективность мотавизумаба для профилактики респираторно-синцитиального вируса у здоровых младенцев коренных американцев: рандомизированное двойное слепое плацебо-контролируемое исследование фазы 3. Lancet Infect. Дис. (2015) 15: 1398–408. DOI: 10.1016 / S1473-3099 (15) 00247-9

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    17. Всемирная организация здравоохранения. Заседание стратегической консультативной группы экспертов по иммунизации, апрель 2014 г. - выводы и рекомендации. Еженедельный эпидемиологический отчет. (2014) 89: 221–236.

    Google Scholar

    18. ВОЗ. Неофициальная консультация ВОЗ по эпиднадзору за респираторно-синцитиальным вирусом на платформе Глобальной системы эпиднадзора за гриппом и ответных мер (ГСЭГО). Женева, Швейцария. (2016) стр. 25–27.

    Google Scholar

    19. Чанок Р., Ройзман Б., Майерс Р. Восстановление у младенцев с респираторным заболеванием вируса, связанного с возбудителем ринита шимпанзе (CCA). Am J Epidemiol .(1957) 66: 281–90. DOI: 10.1093 / oxfordjournals.aje.a119901

    CrossRef Полный текст | Google Scholar

    20. Муньос-Дуранго, Н., Писарро-Ортега, М.С., Рей-Хурадо, Е., Диас, ИП, Буэно, С.М., Калергис, А.М. Паттерны ответа антител во время естественной инфекции RSV: идеи для разработки новых методов лечения на основе антител. Exp Opin Investigations. (2018) 27: 721–31. DOI: 10.1080 / 13543784.2018.1511699

    CrossRef Полный текст | Google Scholar

    21. Гросфельд Х., Хилл М.Г., Коллинз ПЛ.Репликация РНК респираторно-синцитиальным вирусом (RSV) направляется белками N, P и L; транскрипция также происходит в этих условиях, но требует суперинфекции RSV для эффективного синтеза полноразмерной мРНК. J Virol. (1995) 69: 5677–86.

    PubMed Аннотация | Google Scholar

    22. Гонсалес П.Дж., Каррено Л.М., Буэно С.А., Ридель Калифорния, Калергис А.М. Понимание респираторно-синцитиальной вирусной инфекции для улучшения лечения и повышения иммунитета. Curr Mol Med. (2013) 13: 1122–39.DOI: 10.2174 / 1566524011313070007

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    23. Vandini S, Calamelli E, Faldella G, Lanari M. Иммунный и воспалительный ответ при бронхиолите, вызванном респираторно-синцитиальным вирусом и риновирусными инфекциями у младенцев. Paediatr Respir Rev. (2017) 24: 60–4. DOI: 10.1016 / j.prrv.2016.11.006

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    25. Нолан Т., Борха-Табора С., Лопес П., Векс Л., Уллоа-Гутьеррес Р., Ласкано-Понсе Е. и др.Распространенность и частота респираторно-синцитиального вируса и других респираторных вирусных инфекций у детей в возрасте от 6 месяцев до 10 лет с гриппоподобным заболеванием, включенных в рандомизированное исследование. Clin Infect Dis. (2015) 60: e80–9. DOI: 10.1093 / cid / civ065

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    27. Буэно С.М., Гонсалес П.А., Каутиво К.М., Мора Дж. Э., Лейва Е. Д., Тобар Х. Э. и др. Защитный Т-клеточный иммунитет против респираторно-синцитиального вируса эффективно индуцируется рекомбинантной БЦЖ. Proc Natl Acad Sci USA. (2008) 105: 20822–7. DOI: 10.1073 / pnas.0806244105

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    28. Талеб С.А., Аль Тани А.А., Аль Ансари К., Яссин Х.М. Респираторно-синцитиальный вирус человека: патогенез, иммунные ответы и современные подходы к вакцинам. Eur J Clin Microbiol Infect Dis. (2018) 37: 1817–27. DOI: 10.1007 / s10096-018-3289-4

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    29.Кристьянссон С., Бьярнарсон С.П., Веннергрен Г., Палсдоттир А.Х., Арнадоттир Т., Харальдссон А. и др. Респираторно-синцитиальный вирус и другие респираторные вирусы в течение первых 3 месяцев жизни вызывают местный Th3-подобный ответ. J Allergy Clin Immunol. (2005) 116: 805–11. DOI: 10.1016 / j.jaci.2005.07.012

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    30. Фэн С., Цзэн Д., Чжэн Дж., Чжао Д. МикроРНК: медиаторы и терапевтические мишени для гиперреактивности дыхательных путей после респираторно-синцитиальной вирусной инфекции. Front Microbiol. (2018) 9: 02177. DOI: 10.3389 / fmicb.2018.02177

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    31. Lay MK, Bueno SM, Gálvez N, Riedel CA, Kalergis AM. Новые сведения о вирусных факторах и факторах хозяина, влияющих на патогенез дыхательных путей, вызываемый респираторно-синцитиальным вирусом. Crit Rev Microbiol. (2016) 42: 800–12. DOI: 10.3109 / 1040841X.2015.1055711

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    32.Джартти Т., Смитс Х.Х., Боннеликке К., Кавкайтар О., Элениус В., Конрадсен Дж. Р. и др. Бронхиолит требует пересмотра: различения вирусных образований и способов их лечения. Аллергия . (2018) 74: 40–52. DOI: 10.1111 / all.13624

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    34. Аояги М., Шимодзё Н., Секин К., Нишимута Т., Коно Ю. Инфекция респираторно-синцитиального вируса подавляет продукцию IFN-γ Т-клетками γ δ . Clin Exp Immunol. (2003) 131: 312–7.DOI: 10.1046 / j.1365-2249.2003.02062.x

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    35. Рассел С.Д., Унгер С.А., Уолтон М., Шварц Дж. Иммунный ответ человека на инфекцию респираторно-синцитиального вируса. Clin Microbiol Rev. (2017) 30: 481–502. DOI: 10.1128 / CMR.00090-16

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    37. Мохапатра С.С., Бояпалле С. Эпидемиологические, экспериментальные и клинические связи между респираторно-синцитиальной вирусной инфекцией и астмой. Clin Microbiol Rev. (2008) 21: 495–504. DOI: 10.1128 / CMR.00054-07

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    38. Джуффрида М.Дж., Валеро Н., Москера Дж., Альварес де Мон М., Часин Б., Эспина Л.М. и др. Повышенное содержание цитокинов / хемокинов в сыворотке от пациентов с астмой и неастматическими вирусными респираторными инфекциями. Другие респираторные вирусы гриппа . (2014) 8: 116–22. DOI: 10.1111 / irv.12155

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    39.Ньютон А.Х., Кардани А., Брасиале Т.Дж. Иммунный ответ хозяина при респираторной вирусной инфекции: баланс клиренса вируса и иммунопатологии. В: Hussell T, Grabiec AM, редакторы. Семинары по иммунопатологии. Берлин: Springer (2016) стр. 471–82.

    PubMed Аннотация | Google Scholar

    40. Jartti T, Gern JE. Роль вирусных инфекций в развитии и обострении астмы у детей. J Allergy Clin Immunol. (2017) 140: 895–906. DOI: 10.1016 / j.jaci.2017.08.003

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    41. Bønnelykke K, Vissing NH, Sevelsted A, Johnston SL, Bisgaard H. Связь между респираторными инфекциями в раннем детстве и астмой в более позднем возрасте не зависит от типа вируса. J Allergy Clin Immunol. (2015) 136: 81–6. DOI: 10.1016 / j.jaci.2015.02.024

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    42. Текканат К.К., Маассаб Х.Ф., Чо Д.С., Лай Дж.Дж., Джон А., Берлин А. и др.Вызванная IL-13 гиперреактивность дыхательных путей во время респираторно-синцитиальной вирусной инфекции зависит от STAT6. J Immunol. (2018) 166: 3542–8. DOI: 10.4049 / jimmunol.166.5.3542

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    43. Wu P, Hartert TV. Доказательства причинно-следственной связи между респираторно-синцитиальной вирусной инфекцией и астмой. Exp Rev Anti Infect Ther. (2011) 9: 731–45. DOI: 10.1586 / eri.11.92

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    45.Chartrand C, Tremblay N, Renaud C, Papenburg J. Диагностическая точность экспресс-тестов на обнаружение антигенов респираторно-синцитиальной вирусной инфекции: систематический обзор и метаанализ. J Clin Microbiol. (2015) 53: 3738–49. DOI: 10.1128 / JCM.01816-15

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    46. Гонсалес Л.А., Васкес Й., Мора Х.Э., Палавесино С.Э., Бертран П., Феррес М. и др. Оценка моноклональных антител, которые обнаруживают консервативные белки респираторно-синцитиального вируса, метапневмовируса и аденовируса в образцах человека. J Virol Methods. (2018) 254: 51–64. DOI: 10.1016 / j.jviromet.2018.01.011

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    47. Асланзаде Дж., Чжэн Х, Ли Х., Тетро Дж., Раткевич И., Мэн С. и др. Проспективная оценка экспресс-тестов на антигены для диагностики респираторно-синцитиального вируса и метапневмовирусных инфекций человека. J Clin Microbiol. (2008) 46: 1682–5. DOI: 10.1128 / JCM.00008-08

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    48.Brand HK, Ferwerda G, Preijers F, de Groot R, Neeleman C, Staal FJ и др. Количество CD4 + Т-клеток и концентрации интерлейкина-8 и CCL-5 в плазме определяют степень тяжести заболевания у детей с RSV-инфекцией. Pediatr Res. (2013) 73: 187. DOI: 10.1038 / pr.2012.163

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    49. Райден С., Сананес И., Ремес-Леников Ф., Пандольфи Дж., Ромеро С., Де Лилло Л. и др. Респираторно-синцитиальный вирус (RSV) инфицирует CD4 + Т-клетки: частота циркуляции CD4 + RSV + Т-клеток как маркер тяжести заболевания у маленьких детей. J Infect Dis. (2017) 215: 1049–58. DOI: 10.1093 / infdis / jix070

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    50. Эверард М.Л., Сварбрик А., Райтхэм М., Макинтайр Дж., Данкли С., Джеймс П.Д. и др. Анализ клеток, полученных при промывании бронхов младенцев с респираторно-синцитиальной вирусной инфекцией. Arch Dis Child. (1994) 71: 428–32. DOI: 10.1136 / ADC.71.5.428

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    51.Мидулла Ф., Виллани А., Пануска Дж. Р., Даб И., Коллс Дж. К., Меролла Р. и др. Респираторно-синцитиальная вирусная инфекция легких у младенцев: иммунорегуляторная роль инфицированных альвеолярных макрофагов. J Infect Dis. (1993) 168: 1515–9. DOI: 10.1093 / infdis / 168.6.1515

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    52. Джонсон Дж. Э., Гонсалес Р. А., Олсон С. Дж., Райт П. Ф., Грэм Б. С.. Гистопатология летальной нелеченой респираторно-синцитиальной вирусной инфекции человека. Modern Pathol. (2007) 20: 108. DOI: 10.1038 / modpathol.3800725

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    53. Роман М., Калхун В.Дж., Хинтон К.Л., Авенданьо Л.Ф., Саймон В., Эскобар А.М. и др. Инфекция респираторно-синцитиальным вирусом у младенцев связана с преобладающим Th-2-подобным ответом. Am J Respir Crit Care Med. (1997) 156: 190–5. DOI: 10.1164 / ajrccm.156.1.9611050

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    54. О'Доннелл Д. Р., Кэррингтон Д.Лимфопения и нейтрофилия периферической крови у детей с тяжелой респираторно-синцитиальной вирусной болезнью. Pediatr Pulmonol. (2002) 34: 128–30. DOI: 10.1002 / ppul.10140

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    55. Вен К., Чжан Дж, Мэй Х, Ву А, Чжан Б., Цай М. и др. Уменьшение количества плазмоцитоидных дендритных клеток в периферической крови у детей с бронхиолитом после респираторно-синцитиальной вирусной инфекции. Другие респираторные вирусы гриппа. (2014) 8: 469–73. DOI: 10.1111 / irv.12242

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    56. Угонна К., Дурос К., Бингл С.Д., Эверард М.Л. Цитокиновые ответы при первичных и вторичных респираторно-синцитиальных вирусных инфекциях. Pediatr Res. (2016) 79: 946. DOI: 10.1038 / pr.2016.29

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    57. Да Ын Ро ШП, Чой Х. Дж., Ким Й. Сравнение профилей экспрессии цитокинов у младенцев с инфекцией нижних дыхательных путей, вызванной риновирусом, с хрипом или без него: сравнение с респираторно-синцитиальным вирусом. Korean J Pediatr. (2017) 60: 296. DOI: 10.3345 / kjp.2017.60.9.296

    CrossRef Полный текст | Google Scholar

    58. Fan R, Wen B, Liu W., Zhang J, Liu C, Fan C, et al. Измененные профили регуляторных цитокинов при детской респираторно-синцитиальной вирусной инфекции. Цитокин. (2018) 103: 57–62. DOI: 10.1016 / j.cyto.2017.12.028

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    59. Валконен Х, Варис М., Руохола А, Руусканен О, Хейккинен Т.Рецидивирующие одышки после респираторно-синцитиального вирусного или нереспираторно-синцитиального вирусного бронхиолита в младенчестве: наблюдение в течение 3 лет. Аллергия. (2009) 64: 1359–65. DOI: 10.1111 / j.1398-9995.2009.02022.x

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    60. Бланкен М.О., Роверс М.М., Моленаар Дж.М., Винклер-Зейнстра П.Л., Мейер А., Кимпен Дж.Л. и др. Респираторно-синцитиальный вирус и повторяющиеся хрипы у здоровых недоношенных детей. N Engl J Med. (2013) 368: 1791–9.DOI: 10.1056 / NEJMoa1211917

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    61. Брэдли Дж. С., Байингтон С. Л., Шах С. С., Алверсон Б., Картер Е. Р., Харрисон С. и др. Ведение внебольничной пневмонии у младенцев и детей старше 3 месяцев: рекомендации по клинической практике общества педиатрических инфекционных болезней и общества инфекционистов Америки. Clin Infect Dis. (2011) 53: e25–76. DOI: 10.1093 / cid / cir625

    CrossRef Полный текст | Google Scholar

    62.Казерта М.Т., Цю Х, Тесини Б., Ван Л., Мерфи А., Корбетт А. и др. Разработка глобальной респираторной оценки тяжести респираторно-синцитиальной вирусной инфекции у младенцев. J Infect Dis. (2016) 215: 750–6. DOI: 10.1093 / infdis / jiw624

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    64. Houben ML, Bont L, Wilbrink B., Belderbos ME, Kimpen JL, Visser GH, et al. Правило клинического прогноза бронхиолита, вызванного РСВ, у здоровых новорожденных: когортное исследование с прогнозом при рождении. Педиатрия. (2011) 127: 35–41. DOI: 10.1542 / peds.2010-0581

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    65. Brand HK, Ahout IML, De Ridder D, van Diepen A, Li Y, Zaalberg M, et al. Олфактомедин 4 служит маркером тяжести заболевания у детей, инфицированных респираторно-синцитиальным вирусом (RSV). PLoS ONE. (2015) 10: e0131927. DOI: 10.1371 / journal.pone.0131927

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    66.Бертран П., Лэй М.К., Пьедимонте Г., Брокманн П.Е., Палавесино С.Е., Эрнандес Дж. И др. Повышенные уровни IL-3 и IL-12p40 в нижних дыхательных путях у младенцев с бронхиолитом, вызванным RSV, коррелируют с повторяющимся хрипом. Цитокин. (2015) 76: 417–23. DOI: 10.1016 / j.cyto.2015.07.017

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    67. Ван ден Кибум С.Х., Ахут И.М., Зомер А., Бранд К.Х., де Гроот Р., Ферверда Г. и др. Экспрессия носоглоточного гена, новый подход к изучению течения респираторно-синцитиальной вирусной инфекции. Eur Respir J. (2015) 45: 718–25. DOI: 10.1183 / 0

    36.00085614

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    68. Йонг В.Л., Ахут И.М., ван ден Хам Х.Дж., Янс Дж., Заарауи-Бутахар Ф., Зомер А. и др. Транскриптом помогает прогнозировать тяжесть заболевания у младенцев, инфицированных респираторно-синцитиальным вирусом. Научный доклад (2016) 6: 36603. DOI: 10.1038 / srep36603

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    69. Лучсингер В., Ампуэро С., Паломино М.А., Чнайдерман Дж., Левикан Дж., Гаггеро А. и др.Сравнение вирусологических профилей респираторно-синцитиального вируса и риновируса при острых респираторных инфекциях нижнего тракта у детей раннего возраста в Чили в соответствии с их клиническим исходом. J Clin Virol. (2014) 61: 138–44. DOI: 10.1016 / j.jcv.2014.06.004

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    71. Торберн К., Фултон К., Кинг С., Раманесваран Д., Аламмар А., Макнамара П.С. Уровни трансаминаз отражают тяжесть заболевания у детей, находящихся на ИВЛ по поводу респираторно-синцитиального вирусного (RSV) бронхиолита. Научный доклад (2018) 8: 1803. DOI: 10.1038 / s41598-018-20292-6

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    72. Laham FR, Trott AA, Bennett BL, Kozinetz CA, Jewell AM, Garofalo RP, et al. Концентрация ЛДГ в жидкости для промывания носа как биохимический предиктор тяжести бронхиолита. Педиатрия. (2010) 125: e225–33. DOI: 10.1542 / педс.2009-0411

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    73. Мехта Р., Шеффлер М., Тапиа Л., Аидеян Л., Патель К.Д., Джуэлл А.М. и др.Лактатдегидрогеназа и активность каспазы в секрете носоглотки являются предикторами тяжести бронхиолита. Другие респираторные вирусы гриппа. (2014) 8: 617–25. DOI: 10.1111 / irv.12276

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    74. Kesimer M, Ford AA, Ceppe A, Radicioni G, Cao R, Davis CW и др. Концентрация муцина в дыхательных путях как маркер хронического бронхита. N Engl J Med. (2017) 377: 911–22. DOI: 10.1056 / NEJMoa1701632

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    75.Раджан Д., О'Киф Е.Л., Трэверс С., Маккракен С., Геогеган С., Кабальеро М.Т. и др. Уровни MUC5AC, связанные с тяжестью респираторно-синцитиального вируса. Clin Infect Dis . (2018) 67: 1441–4. DOI: 10.1093 / cid / ciy340

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    77. Уильямс Д. Д., Чжу Ю., Гриджалва К. Г., Селф WH, Харрелл Ф. Э., Рид С. и др. Прогнозирование тяжелых исходов пневмонии у детей. Педиатрия. (2016) 138: e20161019. DOI: 10.1542 / пед.2016-1019

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    78. Мехиас А., Димо Б., Суарес Н.М., Гарсия С., Суарес-Аррабаль М.С., Джартти Т. и др. Профили экспрессии генов в цельной крови для оценки патогенеза и тяжести заболевания у младенцев с респираторно-синцитиальной вирусной инфекцией. PLoS Med. (2013) 10: e1001549. DOI: 10.1371 / journal.pmed.1001549

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    79. Валлихан Р.Г., Суарес Н.М., Коэн Д.М., Маркон М., Мур-Клингенпил М., Мехиас А. и др.Молекулярная дистанция до состояния здоровья, оценка транскрипции и тяжесть заболевания у детей, госпитализированных с внебольничной пневмонией. Front Cell Infect Microbiol. (2018) 8: 00382. DOI: 10.3389 / fcimb.2018.00382

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    80. Pankla R, Buddhisa S, Berry M, Blankenship DM, Bancroft GJ, Banchereau J, et al. Геномное транскрипционное профилирование идентифицирует потенциальную сигнатуру биомаркера крови для диагностики септического мелиоидоза. Genome Biol. (2009) 10: R127. DOI: 10.1186 / GB-2009-10-11-r127

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    81. Гарсия-Мауриньо К., Мур-Клингенпил М., Томас Дж., Мертц С., Коэн Д.М., Рамило О. и др. Динамика вирусной нагрузки и тяжесть клинического заболевания у детей грудного возраста с респираторно-синцитиальной вирусной инфекцией. J Infect Dis. (2018) 219: 1207–15. DOI: 10.1093 / infdis / jiy655

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    82.Де Винченцо Дж. П., Уилкинсон Т., Вайшнау А., Чехельски Дж., Мейерс Р., Ночур С. и др. Вирусная нагрузка вызывает заболевание у людей, экспериментально инфицированных респираторно-синцитиальным вирусом. Am J Respir Crit Care Med. (2010) 182: 1305–14. DOI: 10.1164 / rccm.201002-0221OC

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    83. Каджи ФМН, Окамото М., Фурусэ Ю., Тамаки Р., Сузуки А., Лирио И. и др. Различия в вирусной нагрузке среди генотипов респираторно-синцитиального вируса человека у госпитализированных детей с тяжелыми острыми респираторными инфекциями на Филиппинах. Virol J. (2016) 13: 113. DOI: 10.1186 / s12985-016-0565-8

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    84. Эль Салиби К.М., Буш А.Дж., Харрисон Л.М., Эйткен Дж. А., Де Винченцо Дж. П. Нагрузка респираторно-синцитиальным вирусом, вирусная динамика и тяжесть заболевания у ранее здоровых естественно инфицированных детей. J Infect Dis. (2011) 204: 996–1002. DOI: 10.1093 / infdis / jir494

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    85.Houben ML, Coenjaerts FEJ, Rossen JWA, Belderbos ME, Hofland RW, Kimpen JLL и др. Тяжесть заболевания и вирусная нагрузка у младенцев коррелируют с первичной респираторно-синцитиальной вирусной инфекцией в обществе. J Med Virol. (2010) 82: 1266–71. DOI: 10.1002 / jmv.21771

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    86. Пьедра Ф.А., Мей М., Авадханула В., Мехта Р., Аидеян Л., Гарофало Р.П. и др. Взаимозависимость вирусной нагрузки, врожденного иммунного ответа и клинического исхода у детей, поступающих в отделение неотложной помощи с респираторно-синцитиальным вирусным бронхиолитом. PLoS ONE. (2017) 12: e0172953. DOI: 10.1371 / journal.pone.0172953

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    87. Саравиа Дж., Ю Д., Шреста Б., Джалигама С., Сифкер Д., Ли Дж. И. и др. Болезнь, вызванная респираторно-синцитиальным вирусом, опосредуется изменяющимся возрастом IL-33. PLoS Pathog. (2015) 11: e1005217. DOI: 10.1371 / journal.ppat.1005217

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    88. Гарсия-Гарсия М.Л., Кальво С., Морейра А., Каньяс Дж. А., Посо Ф, Састре Б. и др.Тимический стромальный лимфопоэтин, IL-33 и периостин у госпитализированных младенцев с вирусным бронхиолитом. Медицина. (2017) 96: e6787. DOI: 10.1097 / MD.0000000000006787

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    89. Табарани С.М., Бонвиль, Калифорния, Сурядевара М., Браниган П., Ван Д., Хуанг Д. и др. Новые воспалительные маркеры, клинические факторы риска и тип вируса, связанные с тяжелой респираторно-синцитиальной вирусной инфекцией. Pediatr Infect Dis J. (2013) 32: e437.DOI: 10.1097 / INF.0b013e3182a14407

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    90. Нето Е.А., Дуригон Т.С., Оливейра-Джуниор М.С., душ Сантуш Диас А., Маккензи Б., Констанцио Ф.С. и др. Новые сывороточные и назальные иммунологические биомаркеры при детской инфекции, вызванной респираторно-синцитиальным вирусом. Eur Respi J. (2016) 48: PA1277. DOI: 10.1183 / 13993003.congress-2016.PA1277

    CrossRef Полный текст | Google Scholar

    91. Хуан А.Х., Лу Л.В., Лю В.Дж., Хуан М.Уровни воспалительных цитокинов плазмы IL-4, IL-8, IL-10 и TNF-α коррелируют с функцией легких у пациентов с синдромом наложения астмы и хронической обструктивной болезни легких (ХОБЛ). Монитор медицинских наук. (2016) 22: 2800. DOI: 10.12659 / MSM.896458

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    92. Диас П.В., Вальдивия Г., Гаггеро А.А., Боно М.Р., Зепеда Г., Ривас М. и др. Провоспалительные цитокины в носоглоточном аспирате госпитализированных детей с респираторно-синцитиальной вирусной инфекцией с риновирусным бронхиолитом или без него, а также использование цитокинов в качестве предикторов тяжести заболевания. Медицина. (2015) 94:39. DOI: 10.1097 / MD.0000000000001512

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    93. Морейра А., Гарсия М.Л., Кальво С., Кеведо С., Посо Ф, Касас I и др. TSLP и периостин у младенцев с вирусным бронхиолитом. Eur Respi J. (2016) 48: OA4987. DOI: 10.1183 / 13993003.congress-2016.OA4987

    CrossRef Полный текст | Google Scholar

    94. Хан М., Раджпут С., Хун Дж. Й., Лей Дж., Хинд Дж. Л., Ву К. и др. Врожденные цитокины IL-25, IL-33 и TSLP взаимодействуют в индукции размножения врожденных лимфоидных клеток 2 типа и слизистой метаплазии у инфицированных риновирусом незрелых мышей. J Immunol. (2017) 199: 1308–18. DOI: 10.4049 / jimmunol.1700216

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    95. Варрикки Дж., Пекораро А., Мароне Дж., Крискуоло Дж., Спадаро Дж., Дженовезе А. и др. Изоформы стромального лимфопоэтина тимуса, воспалительные заболевания и рак. Front Immunol. (2018) 9: 1595. DOI: 10.3389 / fimmu.2018.01595

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    96. Лопес-Гуиса Дж. М., Пауэрс С., Файл D, Кокрейн Е., Хименес Н., Дебли Дж. С..Эпителиальные клетки дыхательных путей детей-астматиков по-разному экспрессируют проремоделирующие факторы. J Allergy Clin Immunol. (2012) 129: 990–7. DOI: 10.1016 / j.jaci.2011.11.035

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    97. Иноуэ Т., Акаси К., Ватанабэ М., Икеда Ю., Ашизука С., Мотоки Т. и др. Периостин как биомаркер для диагностики детской астмы. Pediat Allergy Immunol. (2016) 27: 521–6. DOI: 10.1111 / pai.12575

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    98.Habernau AM, Del VPA, Rodríguez FV, Bobadilla PG. Роль периостина в неконтролируемой астме у детей (исследование DADO). J Invest Allergol Clin Immunol. (2017) 27: 291–8. DOI: 10.18176 / jiaci.0144

    CrossRef Полный текст | Google Scholar

    99. Vu LD, Ward C, Devincenzo J, Philip R, Cormier SA, Kimura D. Повышенный уровень периостина и nt-пробнпа в трахеальных аспиратах ассоциировался с легочной гипертензией у детей с механической вентиляцией легких с бронхиолитом rsv. В: D25.Достижения в области редких заболеваний легких и легочных сосудов у детей . Американское торакальное общество (2018). п. A6313

    Google Scholar

    100. Лу С., Хартерт Т.В., Эверард М.Л., Гизек Х., Нельсен Л., Мехта А. и др. Предикторы астмы после тяжелого респираторно-синцитиального вирусного (RSV) бронхиолита в раннем детстве. Pediatr Pulmonol. (2016) 51: 1382–92. DOI: 10.1002 / ppul.23461

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    101.Zhang Y, Yang L, Wang H, Zhang G, Sun X. Неструктурный белок 1 респираторно-синцитиального вируса облегчает репликацию вируса посредством miR-29a-опосредованного ингибирования рецептора интерферона-α. Biochem Biophys Res Commun. (2016) 478: 1436–41. DOI: 10.1016 / j.bbrc.2016.08.142

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    102. Do LAH, Pellet J, van Doorn HR, Tran AT, Nguyen BH, Tran TTL и др. Профиль транскрипции хозяина в назальном эпителии и цельной крови госпитализированных детей в возрасте до 2 лет с респираторно-синцитиальной вирусной инфекцией. J Infect Dis. (2017) 217: 134–46. DOI: 10.1093 / infdis / jix519

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    105. Халим Т.Ю., Стир К.А., Мате Л., Голд М.Дж., Мартинес-Гонсалес И., МакНагни К.М. и др. Врожденные лимфоидные клетки 2-й группы имеют решающее значение для инициирования аллергического воспаления легких, опосредованного адаптивными Т-хелперами 2. Иммунитет. (2014) 40: 425–35. DOI: 10.1016 / j.immuni.2014.01.011

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    107.Руссо РК, Гарсия СС, Тейшейра ММ, Амарал ФА. Семейство хемокинов CXCL8 / IL-8 и его рецепторы при воспалительных заболеваниях. Exp Rev Clin Immunol. (2014) 10: 593–619. DOI: 10.1586 / 1744666X.2014.894886

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    108. Hess C, Means TK, Autissier P, Woodberry T, Altfeld M, Addo MM, et al. Чувствительность к IL-8 определяет подмножество CD8 Т-клеток, готовых к уничтожению. Кровь. (2004) 104: 3463–71. DOI: 10.1182 / кровь-2004-03-1067

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    109.Като Х, Ван Д, Дайкоку Т, Сун Х, Дей СК, Дюбуа Р. CXCR2-экспрессирующие миелоидные супрессорные клетки необходимы для стимулирования ассоциированного с колитом туморогенеза. Cancer Cell. (2013) 24: 631–44. DOI: 10.1016 / j.ccr.2013.10.009

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    110. McNamara PS, Ritson P, Selby A, Hart CA, Smyth RL. Клеточность бронхоальвеолярного лаважа у младенцев с тяжелым респираторно-синцитиальным вирусным бронхиолитом. Arch Dis Child. (2003) 88: 922–6. DOI: 10.1136 / adc.88.10.922

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    111. Диас П.В., Гаггеро А.А., Пинто Р.А., Мамани Р., Уасапуд П.А., Боно М.Р. Уровни воспалительных цитокинов и кортизола плазмы при респираторно-синцитиальном вирусном бронхиолите. Rev Med Chil. (2013) 141: 574–81. DOI: 10.4067 / S0034-98872013000500004

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    112. Reche PA, Soumelis V, Gorman DM, Clifford T, Liu MR, Travis M, et al.Лимфопоэтин стромы тимуса человека преимущественно стимулирует миелоидные клетки. J Immunol. (2001) 167: 336–43. DOI: 10.4049 / jimmunol.167.1.336

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    113. Soumelis V, Reche PA, Kanzler H, Yuan W., Edward G, Homey B, et al. Эпителиальные клетки человека запускают опосредованное дендритными клетками аллергическое воспаление, продуцируя TSLP. Nat Immunol. (2002) 3: 673. DOI: 10.1038 / ni805

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    114.Харада М., Хирота Т., Джодо А.И., Дои С., Камеда М., Фуджита К. и др. Функциональный анализ вариантов стромального лимфопоэтина тимуса в эпителиальных клетках бронхов человека. Am J Respir Cell Mol Biol. (2009) 40: 368–74. DOI: 10.1165 / rcmb.2008-0041OC

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    115. Ли Х.С., Хедли М.Б., Лу Ю.М., Берлин А., Гейл М. мл., Дебли Дж. С. и др. Тимический стромальный лимфопоэтин индуцируется инфицированными респираторно-синцитиальным вирусом эпителиальными клетками дыхательных путей и способствует ответу 2 типа на инфекцию. J Allergy Clin Immunol. (2012) 130: 1187–96. DOI: 10.1016 / j.jaci.2012.07.031

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    116. Джонс С.А., Дженкинс Б.Дж. Недавние исследования в области воздействия на семейство цитокинов IL-6 при воспалительных заболеваниях и раке. Nat Rev Immunol. (2018) 18: 773–89. DOI: 10.1038 / s41577-018-0066-7

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    118. Vieira RA, Diniz EMDA, Ceccon MEJR.Корреляция медиаторов воспаления в носоглоточном секрете и в сыворотке крови детей с инфекцией нижних дыхательных путей, вызванной респираторно-синцитиальным вирусом, и тяжестью заболевания. J Brasileiro de Pneumol. (2010) 36: 59–66. DOI: 10.1590 / S1806-37132010000100011

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    119. Нуццо П.В., Баззатти Г., Риччи Ф., Рубаготти А., Аргеллати Ф., Зиноли Л. и др. Периостин: новая прогностическая и терапевтическая мишень при раке мочеполовой системы? Clin рака генитурина. (2014) 12: 301–11. DOI: 10.1016 / j.clgc.2014.02.005

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    120. Федерико MJ, Hoch HE, Anderson WC, Spahn JD, Szefler SJ. Лечение астмы у детей: выявление и профилактика риска. Adv Pediatr. (2016) 63: 103–26. DOI: 10.1016 / j.yapd.2016.04.010

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    123. Сигурс Н., Альджассим Ф., Кьельман Б., Робинсон П.Д., Сигурбергссон Ф., Бьярнасон Р. и др.Характер астмы и аллергии через 18 лет после тяжелого бронхиолита, вызванного RSV, на первом году жизни. Грудь. (2010) 65: 1045–52. DOI: 10.1136 / thx.2009.121582

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    125. Ng CT, Mendoza JL, Garcia KC, Oldstone MB. Передача сигналов интерферона альфа и бета типа 1: пассаж для различных биологических результатов. Cell. (2016) 164: 349–52. DOI: 10.1016 / j.cell.2015.12.027

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    126.Чен К., Лю Дж., Цао Х. Регулирование передачи сигналов интерферона типа I при иммунитете и воспалении: всесторонний обзор. J Аутоиммунный. (2017) 83: 1–11. DOI: 10.1016 / j.jaut.2017.03.008

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    127. Джентиле Д.А., Сконер Д.П. Влияние респираторно-синцитиальной вирусной инфекции в раннем детстве на онтогенез цитокиновых иммунных ответов. В Allergy and Asthma Proceedings . Публикации OceanSide. (2002).п. 399.

    PubMed Аннотация | Google Scholar

    129. Broughton SE, Dhagat U, Hercus TR, Nero TL, Grimbaldeston MA, Bonder CS и др. Семейство рецепторов цитокинов GM-CSF / IL-3 / IL-5: от распознавания лиганда до инициации передачи сигналов. Immunol Rev. (2012) 250: 277–302. DOI: 10.1111 / j.1600-065X.2012.01164.x

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    131. Инграм Дж. Л., Крафт М. IL-13 при астме и аллергических заболеваниях: фенотипы астмы и таргетная терапия. J Allergy Clin Immunol. (2012) 130: 829–42. DOI: 10.1016 / j.jaci.2012.06.034

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    .