
РСВ за 3 квартал 2020: сроки, заполнение, подача

Не позднее 30 октября организации и ИП должны сдать в налоговые органы РСВ за 9 месяцев 2020 года.

Способ представления расчета зависит от количества работников: если их численность превышает 10 человек, электронный формат обязателен. Компании со штатом десять и менее человек могут выбирать форму РСВ на свое усмотрение.

При подаче РСВ обязательно заполняются:

  • титульный лист
  • раздел 1
  • подразделы 1.1 и 1.2 приложения 1
  • приложение 2
  • раздел 3.

Приложение 3 включается в состав расчета, если выплачивались пособия за счет ФСС. Остальные листы плательщики заполняют при необходимости, например, если взносы начисляются по дополнительному тарифу.

Если выплат физлицам не было, следует подать нулевой расчет, включив в него титульный лист, разделы 1 и 3.

Рекомендуем: «Нулевой расчет по страховым взносам: как заполнить»

На титульной странице РСВ указывается код расчетного периода 9 месяцев – «33».

Раздел 3 нужно заполнить отдельно на каждого работника, работавшего в компании в третьем квартале текущего года. Значение кода страны можно взять из общероссийского классификатора стран мира (ОКСМ), код вида документа – из Приложения 6 к Порядку заполнения формы расчета.

В поле «Код категории застрахованного лица» указывается значение:

  • НР – для российских граждан;
  • ВПНР – для временно пребывающих иностранцев;
  • ВЖНР – для временно проживающих иностранных граждан.

В графе 140 отражаются все выплаты работнику, включая необлагаемые и начисленные сверх предельной базы.

Выплаты, не относящиеся к объектам налогообложения по статье 420 НК РФ, в расчете показывать не требуется.

При включении в состав РСВ приложения 3, в его поля вносятся данные о пособиях за счет ФСС, начисленных в январе-сентябре 2020 года. При этом дата перечисления пособия и период, за который оно начислено, неважны.

В приложениях 1 и 2 отражаются выплаты по всей организации и начисленные с них взносы, а в разделе 1 – суммы взносов к уплате. Код тарифа плательщика для компании, начисляющей взносы по основным тарифам – «01» (для ОСН и УСН).

Образец заполнения расчета по страховым взносам за 9 месяцев 2020 года

Заполнение РСВ при пониженных тарифах

Если производились выплаты, облагаемые по обычным и пониженным тарифам, данные о них вносятся в РСВ следующим образом:

  • выплаты, облагаемые по общей ставке, указываются в приложения 1 и 2 с кодом тарифа «01». Код категории застрахованного лица в подразделе 3.2.1: НР для россиян, ВЖНР и ВПНР для иностранцев.
  • выплаты, облагаемые по ставке 15%, отражаются в приложении 1 и первом листе приложения 2 с кодом тарифа «20». Код категории застрахованного лица в подразделе 3.2.1 раздела 3: МС для граждан РФ, ВЖМС и ВПМС для иностранных работников.

Если организация к выплатам за апрель – июнь применяла тариф 0%, в РСВ за 9 месяцев дополнительно нужно заполнить приложение 1 и первый лист приложения 2 с кодом тарифа «21».

Страховые взносы в 2020 году

Закажите бесплатный сборник от КонсультантПлюс «Страховые взносы от расчета до отчета»! В подборке вы найдете пошаговые инструкции по расчету страховых взносов по базовым и пониженным тарифам, образцы заполнения РСВ и 4-ФСС, рекомендации по исправлению ошибок, сдаче нулевой отчетности и т.д.

Заполнение расчета по страховым взносам при разных категориях и тарифах

При совмещении режимов налогообложения или тарифов, смене тарифа или статуса работника – иностранца часто возникают трудности с заполнением расчета по страховым взносам.

Давайте разбираться вместе.

Применение нескольких тарифов

От применяемого налогового режима (ОСНО, ЕНВД, УСН, ЕСХН) и тарифа, по которому уплачиваются страховые взносы, определяется код тарифа работодателя- страхователя и коды категорий работников – застрахованных лиц.

В случае, когда страхователь в течение года применял более одного тарифа, например, основной и пониженный или несколько пониженных тарифов, то Приложение 1 и его подразделы нужно заполнить для

каждого тарифа отдельно.

Однако не стоит путать понятия «более одного тарифа» и «более одного кода тарифа». Налоговики в Письме от 28.12.2017 № ГД-4-11/26795 разъясняют, если компания платит взносы только по основным тарифам, хотя и совмещает разные системы налогообложения, то можно заполнить только одно Приложение 1 к разделу 1 и указать в нем любой применяемый код тарифа.

Коды основного тарифа страховых взносов:

  • 01 – для общей системы, применяющих основной тариф,
  • 02 – для упрощенцев, применяющих основной тариф,
  • 03 – для вмененщиков, применяющих основной тариф,
Пример. Как заполняется расчет при уплате взносов по основному тарифу и совмещении УСН и ЕНВД.

Организация с выплат всем работникам платит взносы по основным тарифам, хотя и совмещает разные налоговые режимы УСН и ЕНВД. В этом случае при заполнении расчета нужно заполнить только одно Приложение 1 к разделу 1 и указать в нем код тарифа: 02 либо 03.

Как заполнить сведения о застрахованном лице по разным тарифам?

Сведения о застрахованных лицах в расчете по страховым взносам заполняются в Разделе 3. Заполняется раздел отдельно на каждого работника. Сведения о физлице, которые в нем заполняются, называются персонифицированными.

Этот раздел состоит из двух частей.

В подразделе 3.1. кроме персональных данных работника указывается признак застрахованного лица в системах ОПС, ОМС И ОСС.

При изменении этого признака за последние 3 месяца, если хотя бы в течение одного месяца работник был застрахован, нужно указать «1 – да».

Пример. Заполнение строк 160, 170 и 180 раздела 3.1. при изменении признака застрахованного лица.

Работник в апреле 2018 года имел статус временно пребывающего и не был застрахован в системе обязательного медицинского страхования. В мае и июне у иностранца изменился статус, он стал временно проживающим. Теперь, начиная с мая, работодатель должен исчислять страховые взносы в ОМС с выплат этому работнику.

Тогда при заполнении расчета за 2 квартал в подразделе 3.1. в строке 170 признак застрахованного лица в системе обязательного медицинского страхования нужно указать: 1 – да.

В подразделе 3.2. отображаются сведения о суммах выплат работнику за последние три месяца и страховых взносах на ОПС с указанием кода категории застрахованного лица.

Код категории зависит от тарифа страховых взносов и статуса иностранца.

В таблице приведены некоторые коды категорий работников

Код категории Описание категории работников
Для граждан РФ Для временно пребывающих Для временно проживающих
НР ВПНР ВЖНР Работники организаций и ИП на ОСН и применяющие основной тариф
Работники организаций и ИП на УСН и применяющие основной тариф
Работники организаций и ИП на ЕНВД и применяющие основной тариф
ВПСБ ВЖСБ Аптечных организаций и ИП на ЕНВД
ПНЭД ВПЭД ВЖЭД Организации и ИП на УСН, применяющие пониженный тариф
ИП на патенте
КРС ВПКС ВЖКС Участники свободной экономической зоны в Крыму и Севостополе

Из таблицы видно, что код категории для временно пребывающих начинается – ВП, для временно проживающих – ВЖ.

При заполнении данных по разным тарифам, заполняется необходимое количество строк расчета.

Соответствие кода тарифа коду категории

Таблица соответствия кода тарифа страховых взносов на ОПС коду категории застрахованного лица.

Категории плательщиков страховых взносов Код тарифа Код категории застрахованного лица Тариф страховых взносов на ОПС в 2018 году
Плательщики, находящиеся на ОСН и применяющие основной тариф страховых взносов 01 НР
Плательщики, находящиеся на УСН и применяющие основной тариф страховых взносов 02
Плательщики, уплачивающие ЕНВД и применяющие основной тариф страховых взносов 03
Организации, осуществляющие деятельность в области информационных технологий 06 ОДИТ
ИП, применяющие патентную систему налогообложения 12 ПНЭД
Хозяйственные общества, применяющие и внедряющие результаты интеллектуальной деятельности 04 ХО
Организации, получившие статус участников проекта Сколково 13 ИЦС
Аптечные организации и ИП, имеющие лицензию на фармацевтическую деятельность и уплачивающие ЕНВД 09 АСБ
Некоммерческие организации на УСН, осуществляющие деятельность в области социального обслуживания граждан, образования, здравоохранения 10
Благотворительные организации, применяющие УСН 11
Организации, производящие выплаты и иные вознаграждения членам экипажей судов 07 ЧЭС
Плательщики страховых взносов на УСН, основной вид деятельности которых указан в пп. 5 п. 1 ст. 427 НК 08 ПНЭД
Резиденты технико-внедренческих, промышленно-производственных и туристско-рекреационных особых экономических зон 05 ТВЭЗ
Участники свободной экономической зоны на территориях Республики Крым и города Севастополя 14 КРС
Резиденты территории опережающего социально-экономического развития 15 ТОР
Резиденты свободного порта Владивосток 16 СПВЛ
Резиденты особой экономической зоны в Калининградской области 17 КЛН

Расчет по страховым взносам в 2021 году

Новая форма РСВ 2021 вступает в силу в феврале 2021 года — предоставлять отчёт за 2020 год нужно уже по ней. Приказ ФНС № ЕД-7-11/[email protected], который внёс изменения, был опубликован 15 октября 2020 года на официальном сайте налоговой службы.

Расчёт по страховым взносам теперь заполняется по новым стандартам: изменения коснулись титульного листа и кодов, было добавлено новое приложение. Нововведения в первую очередь актуальны для IT-компаний, в особенности — добавленное приложение 5.1.

В этой статье мы рассмотрим основные изменения, которые внёс октябрьский Приказ ФНС.

Новый РСВ с I квартала 2021 года
С чем связаны нововведения

В документ внесли изменения в связи со вступлением в силу ряда Федеральных законов: N 265-ФЗ от 31 июля 2020 г., N 102-ФЗ от 1 апреля 2020 г, N 5-ФЗ от 28 января 2020 г. Эти законы вносят поправки, в частности, в Налоговый кодекс РФ: введение среднесписочной численности в отчёт РСВ, снижение налоговой ставки IT-компаний и т.д. На основе этих законов и был издан соответствующий Приказ ФНС.

Что изменилось в декларации

Все нововведения в документ можно разделить на три группы:

  1. Дополнения на титульном листе.

  2. Добавление новых кодов.

  3. Введение нового приложения.

Титульный лист декларации был дополнен новой строкой — «Среднесписочная численность (чел.)». Это связано с тем, что отдельный отчёт о количестве работников был отменён (п. 3 ст. 80 НК РФ).

Среднесписочная численность, которая теперь будет выставляться на титульном листе расчёта по страховым взносам, определяется по нормам, описанным в Приказе Росстата от 27.11.2019 № 711. Это означает, что сам порядок определения количества работников не изменился.

Отменённый отдельный отчёт подавался не позднее 20 января, в составе РСВ сведения нужно подавать не позднее 1 февраля. Это правило действует с начала 2021 года, а значит подавать расчёт нужно уже в составе декларации.

Новые коды были добавлены в XXI раздел Приказа ФНС N ММВ-7-11/[email protected], где указан порядок заполнения персонифицированных сведений о застрахованных лицах. Они были добавлены в приложения № 5 и 7.

Коды 20 и 21 уже использовались в заполнении приложений № 1 и 2 к разделу 1 за полугодие 2020 года (Письма ФНС № БС-4-11/[email protected] от 09.06.2020 и БС-4-11/[email protected] от 07.04.2020). Однако, изменения в форму были привнесены только со вступлением в силу нового приказа.

В Приложение № 5 «Коды тарифа плательщика страховых взносов» было добавлено следующее:

20 Плательщики страховых взносов, признаваемые субъектами малого или среднего предпринимательства в соответствии с Федеральным законом от 24 июля 2007 года N 209-ФЗ «О развитии малого и среднего предпринимательства в Российской Федерации» (Собрание законодательства Российской Федерации, 2007, N 31, ст. 4006; 2020, N 24, ст. 3743)
21 Плательщики страховых взносов, применяющие пониженные тарифы страховых взносов в соответствии с Федеральным законом от 8 июня 2020 года N 172-ФЗ «О внесении изменений в часть вторую Налогового кодекса Российской Федерации» (Собрание законодательства Российской Федерации, 2020, N 24, ст. 3746)
22 Плательщики страховых взносов, осуществляющие деятельность по проектированию и разработке изделий электронной компонентной базы и электронной (радиоэлектронной) продукции; применяется начиная с отчётного периода первый квартал 2021 года.

В Приложении № 7 «Коды категории застрахованного лица» было добавлено следующее:

МС Физические лица, которым с части выплат и вознаграждений, определяемой по итогам каждого календарного месяца как превышение над величиной минимального размера оплаты труда, установленного федеральным законом на начало расчётного периода, исчисляются страховые взносы плательщиками, признаваемыми субъектами малого или среднего предпринимательства в соответствии с Федеральным законом от 24 июля 2007 года N 209-ФЗ «О развитии малого и среднего предпринимательства в Российской Федерации»
КВ Физические лица, с выплат и вознаграждений которым исчисляются страховые взносы плательщиками в соответствии с Федеральным законом от 8 июня 2020 года N 172-ФЗ «О внесении изменений в часть вторую Налогового кодекса Российской Федерации»
ЭКБ Физические лица, с выплат и вознаграждений которым исчисляются страховые взносы организациями, осуществляющими деятельность по проектированию и разработке изделий электронной компонентной базы и электронной (радиоэлектронной) продукции; применяется начиная с отчётного периода первый квартал 2021 года

Для иностранных граждан также были добавлены соответствующие коды, но под другими названиями:

  • МС → ВЖМС и ВПМС;

  • КВ → ВЖКВ и ВПКВ;

  • ЭКБ → ВЖЭК и ВПЭК.

В Приложении 6 код для обозначения свидетельства о предоставлении временного убежища на территории Российской Федерации был изменён с 18 на 19.

Приложение 5.1 было добавлено в 1 раздел расчёта. Приложение добавлено для плательщиков, указанных в пп. 3 и пп. 18 п. 1 ст. 427 НК РФ. К ним относятся IT-компании, которые разрабатывают и реализуют программы или базы данных, а также компании, которые проектируют и разрабатывают электронную продукцию или компонентную базу.

Представителям данных видов деятельности заполнять приложение 5.1 нужно для того, чтобы подтвердить своё право на использование пониженного тарифа. Чтобы получить льготы, организациям также нужно соответствовать трём условиям:

  1. Среднесписочная численность сотрудников за расчётный период должна быть не меньше 7 человек.

  2. Основной вид деятельности должен приносить не менее 90% общего дохода.

  3. IT-компании должны иметь госаккредитацию, а проектировщики и разработчики электронной продукции должны быть включёнными в соответствующий реестр.

Важно: заполнять новое приложение в расчёте за 2020 год не нужно.

В приложении 5.1 в поле 001 указывается код плательщика 1 для IT-компаний, код 2 — для компаний, которые проектируют или разрабатывают электронную продукцию или компонентные базы.

Строка 060 в этом приложении заполняется только плательщиками из пп. 3 п.1 ст. 427 НК РФ. Все остальные строки нужно заполнять и тем, кто указывает код плательщика 1 и тем кто указывает код плательщика 2.

Как заполнить строку 090 в расчёте по страховым взносам

В разных частях расчёта номера строк могут повторятся. Строка 090 встречается во всех разделах — 1, 2 и 3, — и приложениях к ним.

В приложении 2 к разделу 1 в строке 090 указывается сумма страховых взносов, подлежащих к уплате. Показателем, которые нужно указывать в строке, является разница между исчисленными страховыми взносами и производственными расходами, увеличенная на сумму возмещённых расходов.

Упрощённая формула выглядит следующим образом:

Стр. 190 прил. 2 разд. 1 = (стр. 060 прил. 2 разд. 1 – стр. 070 прил. 2 разд. 1) + стр. 080 прил. 2 разд. 1

Признак строки 090 может принимать значение:

  • 1, если сумма, исчисленная по формуле, больше или равно нулю;

  • 2, если сумма, исчисленная по формуле, меньше нуля.

Подробные разъяснения по заполнению дала ФНС в Приказе от 18.09.2019 N ММВ-7-11/[email protected]

Образец заполнения строки 090 для приложения 2 к разделу 1

Как заполнить приложение 9 к разделу 1 расчёта по страховым взносам

Приложение 9 к разделу 1 заполняется в соответствии с разъяснениями ФНС, изложенными в Письме от 13 февраля 2020 г. № БС-4-11/243. В приложении заполняются сведения, необходимые для применения пп. 1 п. 3 ст. 422 НК РФ, то есть выплат, которые не включаются в базу для исчисления страховых взносов.

Выплаты, которые получают ученики профессиональных и высших образовательных организаций за деятельность в студенческом отряде, не облагаются страховыми взносами. Студенческий отряд должен быть включён в реестр молодёжных и детских объединений, а выплаты должны осуществляться по трудовым договорам или по договорам ГПХ.

Приложение 9 разделено на четыре части:

  1. Итоги выплат.

  2. Сведения об обучающихся.

  3. Сведения о форме обучения.

  4. Сведения о студенческом отряде.

Отдельные вопросы вызывают строки 010 и 080. В Письме ФНС данные конкретные разъяснения: в строках отражается база для исчисления страховых взносов на обязательное социальное страхование. Сумма отражается в пределах установленной предельной величины базы с начала расчётного периода, за последние три месяца расчётного периода, а также с трёх последних месяцев расчётного периода.

Изменилась декларация, но не изменился срок подачи документа: расчёт по страховым взносам в 2021 году должен быть отправлен в контролирующий орган не позднее 1 февраля.

Новую декларацию можно посмотреть и скачать здесь → «Форма расчёта по страховым взносам». Заполнить и отправить её можно в сервисе «Астрал.Отчёт 5.0» для сдачи отчётности по актуальным формам во все контролирующие органы.

правила заполнения и бланк новой формы РСВ-1, корректировка расчета — Контур.Экстерн

Расчет по страховым взносам в ПФР с 2014 года

В 2015 году Расчет по страховым взносам в ПФР и ФОМС (форма РСВ-1) необходимо представлять ежеквартально в бумажном виде до 15-го числа,  а в электронном виде до 20 числа второго календарного месяца, следующего за отчетным периодом. 

Последними датами сдачи отчетности в бумажном виде в 2015 году являются:

  • 16 февраля 2015 года — отчет за 2014 год;
  • 15 мая 2015 года за 1 квартал 2015 года;
  • 17 августа 2015 года за полугодие 2015 года;
  • 16 ноября 2015 года за 9 месяцев 2915 года.

​А при подаче отчетности в электронном виде:

  • 20 февраля 2015 года — отчет за 2014 год;
  • 20 мая 2015 года за 1 квартал 2015 года;
  • 20 августа 2015 года за полугодие 2015 года;
  • 20 ноября 2015 года за 9 месяцев 2915 года.

В каком виде?

Расчет представляется на бумажном носителе или в электронной форме в соответствии с законодательством Российской Федерации. При этом организации со среднесписочной численностью персонала 25 человек и более с 01.01.2015 года должны сдавать отчетность в ПФР по форме РСВ-1 только в электронном виде.

С первого квартала 2014 года действует новая форма РСВ-1 — Расчет по начисленным и уплаченным страховым взносам.

Утверждена Постановлением Правления ПФ РФ от 16 января 2014 года № 2П «Об утверждении формы расчета по начисленным и уплаченным страховым взносам на обязательное пенсионное страхование в Пенсионный фонд Российской Федерации и на обязательное медицинское страхование в Федеральный фонд обязательного медицинского страхования плательщиками страховых взносов, производящими выплаты и иные вознаграждения физическим лицам, и Порядка ее заполнения». (Зарегистрировано в Минюсте 18.02.2014 г. регистрационный № 31344)

Появились ли в форме РСВ-1 новые строки или разделы, поменялись ли правила заполнения?

На титульном листе появилось новое поле «тип корректировки», в котором следует указывать код причины предоставления уточненного  Расчета:

1 — уточнение Расчета в части показателей, касающихся  уплаты страховых взносов на обязательное пенсионное страхование (в том числе по дополнительным тарифам),

2 — уточнение Расчета в части изменения сумм начисленных страховых взносов на обязательное пенсионное страхование (в том числе по дополнительным тарифам),

3 — уточнение данных Расчета в части взносов на обязательное медицинское страхование или других показателей, не затрагивающих сведения индивидуального учета по застрахованным лицам.

В реквизитах страхователей не стало полей ОГРН (ОГРНИП) и Код по ОКАТО. Также не требуется теперь заполнять адрес регистрации страхователя.

В Разделе 1 выделены специальные графы для отражения начисленных и уплаченных взносов за отчетные периоды с 2014 года (графа 3) и для отражения уплаченных взносов на страховую и накопительную части за периоды 2010 — 2013 гг. (графы 4 и 5 соответственно).

Исчезла строка 145.

Раздел 2 по прежнему называется “Расчет страховых взносов по тарифу и по дополнительному тарифу”, но в нем появились новые подразделы:

2.4. Расчет страховых взносов по дополнительному тарифу для отдельных категорий плательщиков страховых взносов, указанных в части 2.1 статьи 58.3 Федерального закона от 24 июля 2009 г. № 212-ФЗ

2.5. Сведения по пачкам документов, содержащих расчет сумм начисленных страховых взносов в отношении застрахованных лиц (замена АДВ-6-2).

А в подразделе 2.1 стало меньше строк, в связи с тем, что отпала необходимость разделять суммы по застрахованным лицам на разные возрастные группы и делить взносы на страховую и накопительную части. В Разделе 2 введена новая кодировка строк.

В Разделе 3 не надо заполнять список работников-инвалидов на выплаты, которых начислены взносы по пониженному тарифу. В связи с изъятием подраздела 3.1 перенумерованы все последующие подразделы Раздела 3 и исключен подраздел 3.8 (заполнялся организациями, оказывающими инжиниринговые услуги).

В Разделе 4 выделены графы для отражения доначисленных взносов на ОПС за отчетные периоды, начиная с 2014 года (графы 6 и 7) и для отражения доначисленных взносов на страховую и накопительную части за периоды 2010-2013 гг. (графы 8 — 10). А также добавлены графы для отражения доначисленных взносов по дополнительному тарифу в соответствии с  частью 2.1 статьи 58. 3 Федерального закона от 24 июля 2009 г. № 212-ФЗ  (графа 3 — код основания, графа 13 — суммы).

Добавлен новый Раздел 6. Сведения о сумме выплат и иных вознаграждений и страховом стаже застрахованного лица (замена СЗВ).

Заполняется на всех застрахованных лиц, в пользу которых в последние 3 месяца отчетного периода начислены выплаты в рамках трудовых отношений и  гражданско-правовых договоров, доначислены взносы за прошлые периоды или есть неоплачиваемые периоды стажа. Раздел 6 формируется в пачки, в количестве не более 200 штук.

Раздел 3 расчета по страховым взносам


Заполнение раздела 3 расчета по страховым взносам

Расчет по страховым взносам плательщики представляют в налоговый орган с 2017 года. Именно он курирует платежи по обязательному пенсионному, медицинскому и социальному страхованию. Раздел 3 единого расчета по взносам содержит данные персонифицированного учета. В свою очередь, налоговики передают их в Пенсионный фонд. От правильного оформления этих сведений зависит, как лягут данные на лицевых счетах физлиц в фонде.

Форма расчета утверждена приказом ФНС РФ от 18.09.2019 № ММВ-7-11/[email protected].

ВАЖНО! С отчетности за 2020 год расчет по страх.взносам оформляйте на бланке, утв. приказом ФНС России от 18.09.2019 № ММВ-7-11/[email protected] Подробнее о новшествах читайте в нашем обзоре.

Персонифицированные сведения раздела 3 состоят из двух блоков.

Первый несет информацию об отчетности: говорит о виде расчета (первичный он или корректировка) и периоде сдачи, отражает номер сведений каждого сотрудника и дату представления отчетности. Эта часть раздела содержит личные и паспортные данные работников (подраздел 3.1).

Более полную информацию по теме вы можете найти в КонсультантПлюс.
Пробный бесплатный доступ к системе на 2 дня.

Второй блок состоит из двух подразделов. Первый, за номером 3.2.1, отражает сведения о начисленных выплатах за последние три месяца, а также суммы страховых взносов по пенсионному страхованию. Второй подраздел, за номером 3.2.2, заполняют в случае начисления взносов по дополнительному тарифу. При заполнении раздела 3 расчета по страховым взносам следует уделить большое внимание верному отражению персональных данных.

Пример заполнения раздела 3

Даже если ошибиться в одной букве Ф. И. О. работника, необходимо будет представить уточненный расчет. Рассмотрим как заполнить уточненку в случае, если допустили ошибку в разд.3.

Показатели раздела 3 единого расчета по взносам при ГПД 

Раздел 3 заполняйте персонифицированными сведениями и в отношении физлиц, работавших в отчетном периоде по договору гражданско-правового характера (ГПХ).

Порядок заполнения раздела 3 по физлицам, работающим по договору ГПХ несколько отличается от привычного.

На доходы физлица, выполняющего работы по договору ГПХ, не начисляются соцвзносы на временную нетрудоспособность и в связи с материнством (ВНИМ), за исключением случаев, когда обязательства по социальному страхованию прописаны в договоре. Значит, признак лица в системе страхования по строке 180 указываем 2.

Также не забываем заполнять строку 230 в подразделе 3.2.1.

Подпишитесь на рассылку

Рассмотрим порядок заполнения раздела 3 на работника по гражданско-правовому договору.

Скачать образец заполнения строки 230

Корректировка раздела 3 и ее особенности

Оформление корректировки раздела 3 расчета по страховым взносам зависит от того, в каком подразделе допущена ошибка. Налоговый орган представил пояснения в письме от 28.06.2017 № БС-4-11/[email protected] Рассмотрим варианты заполнения:

  1. Ошибка в индивидуальных сведениях работника в подразделе 3. 1.

    Необходимо обнулить сведения. Создаем корректировку раздела 3 расчета, где данные раздела 1 оставляем без изменений. В разделе 3 работаем только с данными того сотрудника, у которого есть ошибки.

    Итак, редактируем сведения, которые были отражены в расчете. Для этого информацию в подразделе 3.1 оставляем прежней, а в подразделе 3.2 в строках 190–300 ставим 0. Создаем новый блок сведений по данному сотруднику, где в строке 010 ставим номер корректировки — 1. В подраздел 3.1 вносим верные данные о сотруднике. В подраздел 3.2 вносим аналогичную информацию с первичного отчета.Скачать образец заполнения корректировочного раздела 3

  2. Ошибка в подразделе 3.2.

    Если забыли внести сведения о сотруднике. В этом случае корректировка раздела 3 расчета по страховым взносам заключается в добавлении данных по новому работнику и изменении показателей раздела 1.

    Если отразили лишних сотрудников. Тогда в уточненном расчете в разделе 3 указываем сведения по этим сотрудникам, а в строках 190–300 подраздела 3. 2 во всех знакоместах ставим 0. Также проводим корректировку раздела 1.

    Если нужно просто внести изменения в показатели подраздела, меняем сведения и по необходимости редактируем раздел 1.

Расчет по взносам без сведений из раздела 3

Если учреждение не ведет хозяйственную деятельность и наемных работников нет (только учредитель), за ним сохраняется обязанность предоставлять расчет (письмо ФНС от 12.04.2017 № БС-4-11/[email protected]). В этом случае показатели выплат в пользу физических лиц принимают значение 0, а количество застрахованных лиц — значение 1. Заполнить необходимо раздел 1, приложения 1 и 2 расчета. Также отразить персональные данные учредителя в разделе 3, без заполнения подраздела 3.2.

Перечень документов при увольнении работника

Наряду с привычными документами, которые сотрудник получает в день увольнения, организация обязана предоставить информацию персонифицированного учета. Это отражено в абз. 2 п. 4 ст. 11 закона 27-ФЗ (ред. от 29. 07.2018). Далее более подробно о документах:

  1. Выписка сведений из формы СЗВ-СТАЖ.
    Информацию из СЗВ-СТАЖ по конкретному сотруднику необходимо предоставлять с 2017 года. Выписка должна содержать персональные сведения только увольняющегося сотрудника. Датировать документ надо датой увольнения.
  2. Выписка из формы СЗВ-М.
    Предоставлять копии СВЗ-М, которые содержат информацию обо всех сотрудниках, нельзя. Это прямое нарушение требований о защите персональных данных. Необходимо сгруппировать сведения в выписку по форме СЗВ-М. Оформить ее нужно в последний рабочий день работника.
  3. Копии раздела 3.
    Сведения раздела 3 расчета при увольнении сотрудника можно скопировать из уже сданной отчетности.

Выдавать ли копию раздела 3 расчета по страховым взносам работнику при увольнении

Актуальная в 2021 году форма РСВ вступила в действие с 1 января 2021 года. Значит, с этого времени нужно предоставлять копии раздела 3 расчета по страховым взносам своим сотрудникам. Обязанности работодателя по этому вопросу отражены в п. 4 ст. 11 закона «Об индивидуальном (персонифицированном) учете в системе обязательного пенсионного страхования» от 01.04.1996 № 27-ФЗ (ред. от 29.07.2018).

Данная процедура носит заявительный характер. Сотрудник может обратиться в бухгалтерию с просьбой предоставить сведения раздела 3. По сданным расчетам оформляем копии по этому работнику. Если расчет представляем в электронном виде, достаточно его распечатать.

Как быть при обращении в середине квартала? В этом случае оформляем индивидуальные сведения раздела 3 на дату обращения. Срок предоставления — 5 календарных дней с момента обращения.

Выписка из раздела 3 сотруднику при увольнении

За период с начала квартала и до момента увольнения информацию раздела 3 расчета по взносам нужно оформить в виде выписки. При заполнении акцентируем внимание на расчетном периоде (код) по строке 020. Код указываем тот, который соответствует дате увольнения.

В сведениях подраздела 3. 2.1 раздела 3 отражаем месяцы работы с начала квартала до даты расторжения трудовых обязательств. За отработанные периоды указываем суммы выплат, базу для начисления взносов и их размер. Также эти сведения отражаем всего за последние три месяца отчетного периода. При необходимости заполняем подраздел 3.2.2.

Копии и выписку раздела 3 расчета выдаем сотруднику при увольнении в его последний рабочий день вместе с расчетом и другими документами. Предоставляем эти данные не только работникам, принятым по трудовым договорам, но и тем, кто оказывает услуги по гражданско-правовым.



При заполнении раздела 3 расчета следует правильно отражать все показатели. При необходимости — вносить в расчет корректирующие данные. Сведения раздела 3 организация должна предоставлять в обязательном порядке сотрудникам при увольнении, а также всем работникам в заявительном порядке.

Еще больше материалов по теме — в рубрике «Страховые взносы».

Как сделать корректировку в разделе 3 по страховым взносам для ифнс

Подпишитесь на рассылку, и мы поможем вам разобраться в требованиях законодательства, подскажем, что делать в спорных ситуациях, и научим больше зарабатывать. Конференции Узнать больше. Не пропустите новые публикации Подпишитесь на рассылку, и мы поможем вам разобраться в требованиях законодательства, подскажем, что делать в спорных ситуациях, и научим больше зарабатывать. Подписка на бумажную версию журнала. В избранное. Необходимо сдать уточненный РСВ за 9 месяцев года.

ВИДЕО ПО ТЕМЕ: Видео инструкция заполнение Расчета по страховым взносам (2017)

Дорогие читатели! Наши статьи рассказывают о типовых способах решения юридических вопросов, но каждый случай носит уникальный характер.

Если вы хотите узнать, как решить именно Вашу проблему – обращайтесь в форму онлайн-консультанта справа или звоните по телефонам, представленным на сайте. Это быстро и бесплатно!

Корректировка Расчета по страховым взносам 2019

Если до подачи уточненки вы уплатите сумму недоимки по взносам и пени, то штраф вам не грози т пп. По НК вы обязаны представить уточненный расчет по взносам только в том случае, если из-за ошибки занижена сумма взносов к уплате. Тогда уточненку нужно подать за период, в котором допущена ошибк а пп. Хотя вряд ли найдется организация, которая захочет подарить деньги бюджету. Поэтому при переплате, как правило, тоже подают уточненку. Если в расчете по взносам отражены неверные суммы, которые не привели к недоплате взносов, штрафа за недостоверные сведения не будет.

Наиболее часто встречающиеся ситуации, когда из-за ошибки сумма взносов не меняется, таковы:. Ведь они показываются сначала в составе объекта обложения, а потом отдельной строкой как необлагаемые.

Приказом ФНС от Например, многие плательщики не отразили в расчете пособия, выплачиваемые женщинам, которые находятся в отпуске по уходу за ребенком до полутора лет, документально подтвержденные командировочные расходы на проезд и проживание и др. Однако если вы получили из ИФНС требование представить пояснения или подать уточненку и обнаружили ошибку, которая не привела к недоплате взносов, но хотите, чтобы у вас в расчете все было верно, лучше его исправить.

Из Порядка заполнения расчета по взносам следует, что исправлять ошибки в расчете нужно так же, как и в налоговых декларация х п. То есть нельзя подать расчет только на разницу, нужно вписывать все правильные данные. Ведь даже из-за одной неверной цифры в номере инспекция может завернуть расчет по взносам. При этом порядок представления уточненных расчетов тако й пп. То есть те же разделы, подразделы и приложения, только уже с верными суммами, которые получились после исправления ошибки.

Если же какие-то данные не поменялись, их просто переносите из ранее сданного расчета;. Но не всегда понятно, как применить этот Порядок на практике. Налоговой службе пришлось выпускать новые письма с разъяснениями. Они сводятся к следующему. Ошибка в персональных данных физлица. Вообще-то, в НК прямо сказано, что инспекции не должны принимать расчет по взносам, если в нем указаны недостоверные персональные сведения физли ц п.

Поэтому в НК и предусмотрели, что при получении расчета с неверными данными ИФНС направляет плательщику уведомление об этом и дает срок на исправление. При исправлении персональных данных в этом случае ни о какой уточненке не может быть и речи.

Налоговики отказывают в приеме расчета и в случае, если в нем неверно указан ИНН физлица, хотя и не должны. Совсем иначе обстоят дела, если расчет с неверными данными все-таки был принят инспекцией. Именно поэтому и важно сейчас все исправить. Именно они и останутся в базе инспекции как верные. Ведь на сумму взносов на ОПС к уплате это никак не повлияет, поскольку их база останется прежней. Ведь необлагаемые суммы показываются дважд ы пп.

Техника порой подводит. Поэтому напоминаем еще раз: не откладывайте представление электронного РСВ на последний день срока сдачи. Разумеется, это неправильно. Если у вас работает высококвалифицированный иностранный специалист, то с его выплат взносы начислять не нужно. Остальных работников в раздел включать не надо п. Однако плательщики взносов разных регионов столкнулись с тем, что сдать уточненный расчет именно в таком порядке не получается. Некоторые ИФНС при приеме отчета в электронном виде высылают фирмам отказ в принятии из-за того, что не выполняется контрольное соотношение.

Вот как эту ситуацию нам прокомментировал специалист ФНС. Подача уточненного расчета при изменении данных по отдельным работникам.

Поэтому при приеме уточненного расчета по страховым взносам действует определенный алгоритм проверки, предусматривающий проверку не уточненного расчета, а первично представленного с внесенными уточнениями. Отказывать в приеме такого уточненного расчета нет никаких оснований. Такое возможно, например, когда:. Ведь здесь будет затронута только сумма взносов на ВНиМ, подлежащая уплате в бюджет.

Письмо ФНС от Напомним, что сумма возмещения увеличивает сумму взносов к уплате в бюджет. Никаких сроков для представления уточненного расчета по взносам НК не установлено. Используется для индексации зарплаты. Используется для регулирования зарплаты. Используется для расчёта отдельных показателей. Москва , Компания “АйСи Групп”. Задавать вопросы и отвечать на них могут только зарегистрированные пользователи.

Авторизуйтесь или Зарегистрируйтесь. Пробный доступ дается один раз в полгода и привязывается к номеру телефона. Журнал и сервисы для бухгалтеров. Подписаться на журнал. Получить демодоступ к журналу. Связаться с нами. Шаронова, ведущий эксперт. Внимание Если до подачи уточненки вы уплатите сумму недоимки по взносам и пени, то штраф вам не грози т пп. Внимание Если в расчете по взносам отражены неверные суммы, которые не привели к недоплате взносов, штрафа за недостоверные сведения не будет.

Справка Налоговики отказывают в приеме расчета и в случае, если в нем неверно указан ИНН физлица, хотя и не должны. Подписывайтесь на наш канал в Я ндекс. Осталось 2 дня. НДФЛ с выплат работникам, уплата за ноябрь г. Конструктор учетной политики — Послушать новости. Формы отчетности: какие применять по налогам и взносам. Календарь сдачи отчетности в году.

Cроки уплаты налогов в году. Производственный календарь на год. Новый бухгалтерский семинар от Издательства. Изменения в зачете и возврате налогов. Оформляете зарплатный проект — отправьте уведомление в Роскомнадзор.

Прощаемся с бумажной трудовой книжкой. Сокращенная рабочая неделя установлена, но не для всех и не везде.

Отсутствие счетов-фактур: что за это будет. Расхождение в суммах НДС в декларации и книге продаж — это нормально. Получение подарка от супруга родственника: нужно ли платить НДФЛ. Калькулятор отпускных в году. Калькулятор пеней по налогам и страховым взносам. Оформить подписку Оформить подписку на журнал Заказать книги издательства Подписаться на новостную рассылку. Сообщить свое мнение О чем хотите прочитать в журнале Нашли ошибку в журнале?

Пожаловаться Нашли ошибку на этой странице? Опросы издательства. Получить подарки Конкурсы издательства. Предложить сотрудничество Реклама в журнале “Главная книга” Опубликовать свою статью в журнале Партнеры. Зарегистрировано в Роскомнадзоре Технические вопросы: support glavkniga. Нашли ошибку на сайте? Отправьте описание найденной ошибки, и мы оперативно исправим её. Ваш e-mail. Мы постараемся исправить найденную вами ошибку в ближайшее время. Если вы уже подписаны на журнал, авторизуйтесь или активируйте код доступа с карты подписчика.

Если хотите оформить подписку, заполните заявку. Пожалуйста, введите корректный электронный адрес. Извините, неверный email или пароль. Невозможно завершить сессию, открытую на первом устройстве.

Запомнить логин. Восстановить пароль.

Заполнение Раздела 3 расчета по страховым взносам и его корректировка

Ваша версия браузера не поддерживает современные технологии, поэтому некоторые страницы могут отображаться некорректно. Предлагаем Вам скачать самые современные браузеры. Они бесплатны, легко устанавливаются и просты в использовании. Подготовить документы в ФНС. Заявка на звонок.

Компании и ИП, использующие труд наемных специалистов, обязаны ежеквартально представлять налоговикам отчетность, отражающую порядок расчета бюджетных обязательств по взносам. Если бухгалтер при составлении формы допустил ошибку, ему нужно сдать фискалам уточнения. В противном случае компании грозят штрафные санкции.

Если до подачи уточненки вы уплатите сумму недоимки по взносам и пени, то штраф вам не грози т пп. По НК вы обязаны представить уточненный расчет по взносам только в том случае, если из-за ошибки занижена сумма взносов к уплате. Тогда уточненку нужно подать за период, в котором допущена ошибк а пп. Хотя вряд ли найдется организация, которая захочет подарить деньги бюджету. Поэтому при переплате, как правило, тоже подают уточненку.

Исправление ошибок в РСВ: на словах и на деле

Эксперты техподдержки Контур. Рассмотрим самые частые сценарии. Например, Контур. Чтобы проверить корректировку, используйте следующий алгоритм. Экстерн, задача проще. Вот какие есть подсказки:. Неиспользованные номера можно добавлять новым сотрудникам.

Как сдать уточненный РСВ по одному работнику?

Скачать бланк расчета по взносам на год. Заполнить уточненный РСВ онлайн. Санкции за иные налоговые нарушения — в таблице. Однако страхователь освобождается от штрафа, если представил уточненный ЕРСВ до того, как инспекторы обнаружили ошибку п. Так что уточненный расчет по страховым взносам необходимо заполнять и сдавать, если в первичной отчетности вы допустили ошибку, и она привела к недоплате взносов.

Если организация или ИП обнаружит, что в сданном Расчете по страховым взносам по какой-либо причине оказалась занижена сумма подлежащих уплате взносов, необходимо будет представить в налоговую инспекцию уточненный Расчет п. Представить новый Расчет придется, если п.

Корректирующий расчет по страховым взносам подается в случае обнаружения ошибки, допущенной в основном отчете. Существуют некоторые правила для заполнения подобных отчетов, которые и будут рассмотрены в статье. Если корректируются показатели и более ранних годов, то сдавать измененный отчет потребуется в Пенсионный фонд. Если речь идет о корректировке периодов начиная с года, то новый расчет подается в налоговый орган по месту регистрации.

Уточненный расчет по страховым взносам в 2019 году: пример заполнения



Корректировка расчета по страховым взносам в 2019 году


Что делать, если ошибочно не начисляли взносы по дополнительному тарифу одному из работников? Как сдать уточненный расчет по страховым взносам? листе и в разделе 3 поставьте номер корректировки по порядку, письма ФНС от № БС/@, письмо ФНС.


Уточненный расчет по страховым взносам






Респираторно-синцитиальный вирус (RSV): симптомы, лечение и профилактика

RSV означает респираторно-синцитиальный вирус. Чаще всего встречается с осени до весны, но поймать его можно в любое время года. Почти все дети когда-нибудь заболевают RSV – большинство из них до двухлетнего возраста. Для здоровых младенцев это все равно что простудиться. Но у некоторых младенцев RSV может быть очень серьезным. Это может вызвать пневмонию, серьезное заболевание легких или даже смерть. Каждый год тысячи младенцев должны оставаться в больнице из-за RSV.

Признаки и симптомы

Эти признаки RSV могут показаться просто простудой:

RSV может очень быстро стать серьезным. Позвоните врачу вашего ребенка , если ваш ребенок:

  • Простуда, моложе 6 месяцев
  • Имеются проблемы с дыханием (хрипы или кашель, учащенное дыхание, синий или серый цвет кожи)
  • Простужен и подвержен высокому риску заражения RSV
  • Выглядит очень больным или испытывает проблемы с едой, питьем или сном

Диагностика и лечение

Врач осмотрит вашего ребенка и может назначить рентген грудной клетки или другие тесты, включая мазок из носа вашего ребенка, чтобы определить, есть ли у него RSV. Ваш ребенок, вероятно, почувствует себя лучше через несколько дней. RSV проходит сам по себе, но для полного выздоровления вашему ребенку может потребоваться неделя или две. RSV может вернуться, поэтому, если вашему ребенку стало лучше, а затем снова появились признаки тяжелого RSV, позвоните его или ее врачу.

Предотвращение распространения RSV

Взрослые тоже могут заразиться RSV. Если вы простудились, будьте осторожны с малышом. Вот несколько советов по предотвращению распространения RSV:

  • Чихайте или кашляйте в ткань и вдали от младенцев и детей.Не подпускайте к ребенку простудных людей. Сюда входят братья и сестры.
  • Часто мойте руки – перед тем, как прикасаться к ребенку и перед тем, как брать пищу. Мойте руки после чихания или кашля, прикосновения к домашним животным или смены подгузников и попросите других сделать то же самое.
  • Часто стирайте игрушки и одежду малыша.
  • Не используйте совместно пустышки, полотенца, тряпки для мытья посуды, зубные щетки, стаканы, чашки, вилки или ложки.
  • Не курите рядом с ребенком.Не позволяйте другим курить вокруг себя.

Домашнее лечение

Антибиотики (например, пенициллин) не используются, потому что они не убивают вирус, вызывающий инфекцию RSV. Но есть кое-что, что вы можете сделать, чтобы вашему ребенку было удобнее:

  • Используйте испаритель холодного тумана. Влажный воздух может облегчить дыхание и уменьшить кашель.
  • Для детей старше 6 месяцев давайте много жидкости, например, воды и фруктового сока.
  • Дети младше 6 месяцев Не следует пить фруктовый сок или воду. Вместо этого чаще кормите грудью или кормите из бутылочки небольшими порциями.
  • Чтобы избавиться от «заложенности носа», вы можете использовать соленую воду (физиологический раствор), капли в нос и шприц с грушей ( Рис. 2 ). (См. «Рука помощи , Отсасывание носа с помощью шприца с шариком», HH-II-24 и , «Приготовление солевого раствора (соленой воды)», HH-II-50 .) Сообщите своему врачу, если выделения из носа становятся желтыми , зеленый или серый.Этого можно ожидать при инфекции.
  • Дайте ацетаминофен (например, Тайленол®) или ибупрофен (Мотрин®) при лихорадке. Не давайте аспирин. Применение аспирина у детей с вирусными заболеваниями связывают с синдромом Рейе, очень серьезным заболеванием.

Когда звонить врачу

Позвоните врачу вашего ребенка, если произойдет что-либо из перечисленного:

  • Лихорадка выше 101ºF в подмышечной области (под мышкой)
  • Кашель, продолжающийся более 4 дней
  • Густая слизь из носа или рта желтого, зеленого или серого цвета
  • Боль в груди или затрудненное дыхание
  • Синий или серый цвет губ, кожи или ногтей
  • Ребенок кажется «ленивым» и ведет себя не так, как обычно.

О чем спросить у детского врача

Спросите у врача вашего ребенка:

  • Если у вашего ребенка высокий риск заражения RSV.RSV может быть серьезным заболеванием для детей, которые родились рано или имеют проблемы с легкими.
  • Если вам следует держать ребенка дома и не посещать школу или детский сад.

Если у вас возникнут вопросы, обязательно спросите их у врача или медсестры.

Респираторно-синцитиальный вирус (RSV) (PDF)

HH-I-171 5/05, рассмотрено 15 апреля Copyright 2005, Национальная детская больница

GSK запускает Фазу III программу вакцинации кандидатов от RSV для пожилых людей

Только для СМИ и инвесторов

Выдано: Лондон, Великобритания

  • Связанные с RSV заболевания нижних дыхательных путей (LRTD), по оценкам, вызывают около 360 000 госпитализаций и 24 000 смертей среди пожилых людей (60+) ежегодно в развитых странах
  • Первое исследование фазы III оценивает иммуногенность, безопасность, реактогенность и стойкость, после чего будет проведено отдельное исследование фазы III, оценивающее эффективность вакцины
  • Положительные результаты фазы I / II подтвердили устойчивую иммуногенность вакцины-кандидата в целевой популяции

GlaxoSmithKline plc (LSE / NYSE: GSK) объявила о начале дозирования пациента в рамках клинической программы фазы III, посвященной изучению иммуногенности, безопасности, реактогенности и устойчивости вакцины-кандидата на респираторно-синцитиальный вирус (RSV) для пожилых людей (GSK3844766A). после публикации положительных результатов фазы I / II по безопасности, реактогенности и иммуногенности (представленных на конгрессе ID Week в октябре 2020 г.).

RSV представляет собой значительную угрозу здоровью пожилых людей (> 60 лет): ежегодно в развитых странах 360 000 госпитализаций и 24 000 случаев смерти, связанных с RSV-инфекциями, оцениваются в [1] . Без рутинного тестирования на РСВ и надежных систем эпиднадзора в нескольких странах глобальные данные о бремени РСВ у пожилых людей либо отсутствуют, либо, вероятно, в значительной степени недооценивают его значение. Ожидается, что по мере старения населения мира заболеваемость и смертность от респираторных инфекций, включая RSV, будет неуклонно расти.Вакцина против RSV для пожилых людей поможет предотвратить первичную инфекцию, а также поможет сохранить независимость, здоровье и качество жизни.

Эммануэль Ханон, старший вице-президент и руководитель отдела исследований и разработок в области вакцин GSK, сказал : «RSV – одна из наиболее значительных оставшихся неудовлетворенных медицинских потребностей пожилых людей, при этом 1 из 6 инфицированных RSV требует госпитализации [2] . Благодаря нашей уникальной комбинации технологий, предварительного слияния F-антигена и нашей собственной адъювантной системы, мы смогли вызвать сильный иммунный ответ, как гуморальных, так и клеточных компонентов, до уровней, обычно наблюдаемых у здоровых взрослых ».

Вакцина-кандидат от RSV для пожилых людей содержит рекомбинантный субъединичный пре-слитный антиген RSV (RSVPreF3) в сочетании с запатентованным адъювантом GSK AS01 [3] , который также используется в вакцине GSK от опоясывающего лишая. Вакцина-кандидат продемонстрировала многообещающую безопасность и иммуногенность в исследовании фазы I / II как у молодых, так и у пожилых людей и хорошо переносилась (данные представлены на Конгрессе ID Week в октябре 2020 года). Результаты показали, что через месяц после иммунизации вакцина-кандидат вызвала устойчивый гуморальный и клеточный иммунитет по сравнению с исходным уровнем, с почти 10-кратным увеличением нейтрализующих антител RSV-A и более чем 12-кратным увеличением антител IgG к RSVPreF3, индуцированным в вакцинированная группа.Эти результаты показывают, что вакцина-кандидат может стимулировать иммунную систему пожилых людей к выработке такого же уровня антител, как и у молодых людей, что имеет решающее значение для защиты этой уязвимой группы населения. Кроме того, вакцина-кандидат была способна восстанавливать более низкие уровни ранее существовавших RSV-специфических Т-клеток, наблюдаемые у пожилых людей до вакцинации, до аналогичных уровней, наблюдаемых у молодых людей после вакцинации.

Эта вакцина-кандидат является частью портфеля вакцин против RSV, разрабатываемого GSK, который включает в себя вакцины-кандидаты для материнской и детской вакцины.Три вакцины-кандидата основаны на различных новых технологиях, адаптированных к потребностям различных групп населения, наиболее затронутых этим заболеванием, для обеспечения широкого преимущества против инфекций RSV. Все три вакцины-кандидаты получили ускоренную оценку FDA. Исследование эффективности фазы III кандидатной вакцины против RSV для матери началось в ноябре 2020 года, в то время как исследование фазы I / II (у младенцев, ранее не инфицированных RSV) с педиатрической вакциной-кандидатом RSV, продолжается.

Об исследовании AReSVi

Исследование под названием AReSVi 004 представляет собой рандомизированное открытое исследование фазы III (NCT04732871) с участием до 1650 взрослых и оценивает безопасность, реактогенность, иммуногенность и долгосрочную устойчивость иммунного ответа в течение 3 лет после вакцинации наша вакцина-кандидат от RSV для взрослых в возрасте 60 лет и старше.Ожидается, что исследование завершится в начале 2024 года, а промежуточные результаты будут доступны во второй половине 2022 года.

Ожидается, что в ближайшие месяцы начнется второе исследование (AReSVi 006), посвященное изучению эффективности вакцины-кандидата для защиты пожилых людей от заболеваний нижних дыхательных путей, вызванных RSV.

Ожидается, что в целом более 10 000 участников будут зачислены в программу фазы III для вакцины-кандидата от RSV для пожилых людей, поскольку это стандарт для поздних стадий клинических испытаний, где коррелят защиты еще не установлен.

О вакцине-кандидате от RSV для пожилых людей GSK ( GSK3844766A)

Эта вакцина-кандидат содержит рекомбинантный субъединичный пре-слитный антиген RSV (RSVPreF3) в сочетании с запатентованным адъювантом GSK AS01, который также используется в вакцине GSK от опоясывающего лишая. Данные фазы I / II промежуточной безопасности, реактогенности и иммуногенности вакцины-кандидата от RSV GSK для молодых людей и пожилых людей в возрасте от 60 до 80 лет (NCT03814590), представленные на ID Week в октябре 2020 года, показали, что в течение одного месяца после иммунизации адъювант Вакцина-кандидат, а также другие испытанные составы вакцины хорошо переносились и индуцировали устойчивый гуморальный и клеточный иммунитет по сравнению с исходным уровнем.Выбранный состав вакцины-кандидата показал в вакцинах 60-80-летней давности через месяц после вакцинации:

  • Были индуцированы высокие уровни антител IgG к RSVPreF3 (средние геометрические концентрации антител были в 12,4 раза выше) и нейтрализующих антител к RSV-A (средние геометрические титры антител были в 9,5 раз выше).
  • Перед вакцинацией у пожилых людей наблюдался дефицит RSVPreF3-специфических Т-клеток (предположительно способствующих очищению от вирусов) по сравнению с более молодыми людьми.После вакцинации устойчивый ответ RSVPreF3 CD4 + Т-клеток у пожилых людей был усилен до уровня, аналогичного тому, который наблюдается у молодых людей.

О респираторно-синцитиальном вирусе

Хотя инфекция RSV может возникнуть в любом возрасте, она может вызвать более серьезные респираторные заболевания у наших младенцев и пожилых людей. В глобальном масштабе, хотя качество данных различается в разных странах, по оценкам, ежегодно регистрируется 33 миллиона случаев RSV у детей в возрасте до 5 лет, из которых около 3 миллионов госпитализируются и примерно 120 000 ежегодно умирают от осложнений, связанных с инфекцией.Почти половина этих педиатрических госпитализаций и смертей приходится на младенцев в возрасте до 6 месяцев [1] . По данным Центров по контролю и профилактике заболеваний, практически все дети в США заражаются RSV-инфекцией к тому времени, когда им исполнится 2 года, и 1-2 из каждых 100 детей в возрасте до 6 месяцев с RSV-инфекцией могут нуждаться в заражении. госпитализированы [2] . Он также представляет собой серьезную угрозу для здоровья пожилых людей (> 60 лет): ежегодно в развитых странах 360 000 госпитализаций и 24 000 смертей, связанных с инфекциями RSV, оцениваются [3] .Ежегодно примерно 1 миллион человек в мире старше 65 лет умирает от респираторных инфекций [4] , и примерно каждому шестому пожилому человеку, инфицированному RSV, потребуется госпитализация [5] .

Без надежных систем эпиднадзора в нескольких странах глобальные данные о бремени РСВ у пожилых людей либо отсутствуют, либо, вероятно, недооценивают его значение. Ожидается, что по мере старения населения мира заболеваемость и смертность от респираторных инфекций, в том числе связанных с RSV, будет неуклонно расти.

О компании GSK

GSK – это научная глобальная медицинская компания, имеющая особую цель: помогать людям делать больше, чувствовать себя лучше и жить дольше. Для получения дополнительной информации посетите www.gsk.com/about-us.

Предупреждение относительно заявлений о перспективах

GSK предупреждает инвесторов, что любые прогнозные заявления или прогнозы, сделанные GSK, в том числе сделанные в этом объявлении, подвержены рискам и неопределенностям, которые могут привести к тому, что фактические результаты будут существенно отличаться от прогнозируемых.К таким факторам относятся, помимо прочего, факторы, описанные в пункте 3.D «Факторы риска» годового отчета компании по форме 20-F за 2019 год и указанные в разделе GSK «Основные риски и неопределенности» результатов за 4 квартал. и любые последствия пандемии COVID-19.

Список литературы

[1] Ши Т. и др., Journal of Infectious Diseases , 2020, 2 октября; 222 (приложение 7): S577-S583; Данные представлены на 7-й конференции ESWI по гриппу, 6–9 декабря 2020 г.

[2] Ши Т.и др., Journal of Infectious Diseases , 2020, 2 октября; 222 (приложение 7): S577-S583

[3] Запатентованная GSK адъювантная система AS01 содержит адъювант QS-21 Stimulon TM , лицензированный от Agenus Inc. (NASDAQ: AGEN)

[4] Shi T. et al., Lancet . 2017; 390: 946–58


[5] CDC – https://www.cdc.gov/rsv/high-risk/infants-young-children.html

[6] Ши Т. и др., Journal of Infectious Diseases , 2020, 2 октября; 222 (приложение 7): S577-S583; Данные представлены на 7-й конференции ESWI по гриппу, 6–9 декабря 2020 г.

[7] GBD 2015 LRI Соавторы.Оценки глобальной, региональной и национальной заболеваемости, смертности и этиологии инфекций нижних дыхательных путей в 195 странах: систематический анализ для исследования глобального бремени болезней 2015. Lancet Infect Dis 2017; 17 (11): 1133-1161.

[8] Ши Т. и др., Journal of Infectious Diseases , 2020, 2 октября; 222 (приложение 7): S577-S583

Симптомы, лечение и время обращения к врачу

Респираторно-синцитиальный вирус или RSV – это вирусная инфекция, которая может вызывать серьезные симптомы у младенцев в возрасте до 2 лет.Однако большинство младенцев, зараженных вирусом, испытывают симптомы простуды и выздоравливают без проблем.

RSV может иметь серьезные последствия для определенных групп, в том числе:

  • младенцев младше 6 месяцев
  • младенцев, рожденных недоношенными
  • младенцев с заболеванием легких или иммунной системы

RSV – это вирус, который присутствует в виде капель от кашля и чихания человека. Эти микробы могут передаваться напрямую от человека к человеку или при контакте с зараженным предметом, например дверной ручкой или игрушкой.

Это чаще встречается в зимние и весенние месяцы, чем в другое время года.

В этой статье мы исследуем RSV у младенцев, включая симптомы, которые они могут испытывать, и то, что лица, осуществляющие уход, могут помочь им в их лечении. Мы также узнаем, когда следует обратиться к врачу и как предотвратить распространение вируса.

Симптомы RSV похожи на сильную простуду и могут включать:

  • насморк
  • лихорадка
  • плохое питание или сон
  • низкая энергия
  • кашель
  • хрипы
  • затрудненное дыхание
  • грудная стенка втягивание с дыханием
  • быстрое дыхание
  • остановка дыхания

RSV также является наиболее частой причиной бронхиолита и пневмонии у детей младше 1 года.Эти состояния вызывают отек легких, что может привести к заполнению дыхательных путей слизью. Такое сочетание слизи и отека может затруднить дыхание.

Каждый младенец испытывает RSV немного по-своему. У некоторых есть очень легкие симптомы, в то время как у других могут быть проблемы, опасные для жизни.

RSV – это вирус, и существует несколько специальных методов его лечения.

Антибиотики не действуют на вирусы, и вакцины для предотвращения болезни не существует. Вместо этого лечение RSV обычно направлено на устранение симптомов и предотвращение осложнений.

Большинство случаев RSV у младенцев проходят без лечения через 1-2 недели. Иногда воспитатели могут лечить младенцев дома, пока вирус не пройдет.

Некоторые простые домашние средства могут помочь, в том числе:

  • Поощрение приема жидкости . Если ребенку больше 6 месяцев, попробуйте дать ему больше воды. Поощряйте детей, находящихся на грудном вскармливании, кормить как можно больше, поскольку это может предотвратить обезвоживание и потребность в более агрессивной гидратации.
  • Лекарства, отпускаемые без рецепта .Ацетаминофен снимает дискомфорт и снижает температуру. Важно проконсультироваться с врачом перед тем, как давать ребенку ацетаминофен, если он никогда не принимал его раньше или ему меньше 3 месяцев.
  • Удаление слизи из дыхательных путей . Удаление лишней слизи изо рта или носа ребенка с помощью шприца с грушей может облегчить ребенку дыхание и прием пищи.
  • Сидеть в душной . Включите горячий душ в закрытой ванной и дайте ей наполниться паром. Пар помогает уменьшить воспаление дыхательных путей, разжижать слизь и облегчить дыхание.

Всегда консультируйтесь с врачом перед тем, как давать детям и младенцам лекарства от простуды или кашля. Некоторые лекарства содержат вещества, не подходящие для детей младше 6 лет. Людям не следует давать детям младше 2 лет большинство лекарств от простуды и кашля.

Если у ребенка наблюдаются тяжелые симптомы RSV, варианты лечения, которые могут принести облегчение, включают:


Если у ребенка затруднено дыхание, уровень кислорода в его крови упадет, что может быть очень опасно, если его не лечить.

Когда ребенок пытается дышать, ему нужно использовать гораздо больше энергии. В конце концов, у ребенка может развиться дыхательная недостаточность и он может перестать дышать, что является чрезвычайной ситуацией.

Дополнительный кислород может повысить уровень кислорода в крови и уменьшить усилие, необходимое для дыхания.


Младенцы, которым трудно дышать, могут не иметь энергии, чтобы поесть, или им трудно пить достаточно жидкости. Очень маленькие дети, особенно больные, могут очень быстро обезвоживаться.

Если ребенок не пьет достаточно, ему может потребоваться внутривенное введение жидкости или зонд для кормления, чтобы помочь ему избежать обезвоживания.


В некоторых ситуациях врачи могут прописать лекарства, чтобы открыть дыхательные пути ребенка, чтобы помочь ему дышать.

Очень больным младенцам или младенцам из группы повышенного риска могут потребоваться противовирусные препараты, чтобы помочь иммунной системе атаковать или удалить вирус из их организма.

Очень важно немедленно вызвать врача или обратиться за неотложной помощью, если у ребенка появляются какие-либо признаки затрудненного дыхания, например:

  • усталость
  • учащенное дыхание
  • стенка грудной клетки втягивается при дыхании
  • синий оттенок вокруг губ или ногтей

Другие причины обратиться к врачу включают, если ребенок:

  • не ест и не пьет достаточно
  • становится слабым или не таким активным, как обычно
  • имеет симптомы простуды, которые являются серьезными или ухудшаются вместо лучшего
  • кашляет, который не проходит.

RSV очень заразен, а это означает, что он очень легко распространяется между людьми.

Некоторые простые меры могут помочь людям избежать заражения или передачи болезни другим. Вот некоторые из этих мер:

  • Избегать близких контактов с больными. Контакт включает поцелуи, объятия и рукопожатия.
  • Не делиться зараженными предметами с другими людьми. Чашки, бутылки и игрушки – все это потенциальные переносчики вируса, который может выжить на них часами.
  • Часто мытье рук.
  • Не прикасаться к лицу, глазам, рту или носу.

В большинстве случаев RSV вызывает легкое простудное заболевание у младенцев или маленьких детей, которые будут полностью выздоравливать.

Однако RSV может вызывать опасные для жизни осложнения у некоторых младенцев, особенно у детей с риском респираторных заболеваний или недоношенных детей.

Воспитатели, которые подозревают, что у их детей может быть RSV, должны внимательно следить за ними на предмет затрудненного дыхания и обезвоживания и поговорить со своим врачом, если у них есть какие-либо проблемы.

Нирсевимаб продемонстрировал защиту от респираторно-синцитиального вируса у здоровых младенцев в испытании фазы 3

Нирсевимаб продемонстрировать d защитить ion от респираторно-синцитиального вируса болезнь у здоровых младенцев в Испытание фазы 3

  • Респираторно-синцитиальный вирус (RSV) является основной причиной госпитализации всех младенцев. 1 5
  • Нирсевимаб исследуется как первая в своем классе иммунизация однократной дозой для защиты всех младенцев, вступающих в свой первый сезон RSV.
  • Нирсевимаб достиг своей основной конечной точки фазы 3 раньше, чем ожидалось; Подача нормативных документов по показаниям для всех младенцев начнется в 2022 году.

PARIS – 26 апреля 2021 г. – Положительные результаты исследования фазы 3 MELODY показали, что нирсевимаб снижает инфекцию нижних дыхательных путей (НИПТ), требующих медицинской помощи (в стационаре) или амбулаторно) из-за респираторно-синцитиального вируса (RSV) у здоровых недоношенных и доношенных детей.RSV является наиболее частой причиной инфекций нижних дыхательных путей и основной причиной госпитализаций всех младенцев. 1- 5

Нирсевимаб достиг своей основной конечной точки, достигнув статистически значимого абсолютного снижения LRTI, вызванного RSV, у здоровых недоношенных и доношенных детей по сравнению с плацебо в течение типичного сезона RSV. Не наблюдалось клинически значимых различий в результатах по безопасности между группами нирсевимаба и плацебо. Общий профиль безопасности нирсевимаба в исследовании остается в соответствии с ранее сообщенными результатами.

Результаты будут представлены на предстоящем научном конгрессе и, как ожидается, лягут в основу нормативных документов.

« Несмотря на то, что респираторно-синцитиальный вирус является основной причиной пневмонии и бронхиолита в первый год жизни , в настоящее время не существует стандартного профилактического метода, одобренного для всех младенцев », – сказал доктор Уильям. Мюллер, доцент кафедры педиатрии Медицинской школы им. Файнберга Северо-Западного университета и научный директор, клинические и общественные испытания, Энн и Роберт Х.Детская больница Лурье в Чикаго, Иллинойс, США, и главный исследователь исследования MELODY Phase III . Эти захватывающие данные испытаний демонстрируют потенциал нирсевимаба изменить ландшафт профилактики не только путем обеспечения защиты широкой популяции младенцев в течение всего сезона респираторно-синцитиального вируса, но и путем достижения этого с помощью одного доза. ”

Нирсевимаб, разрабатываемый в сотрудничестве с AstraZeneca, является первым исследуемым моноклональным антителом (mAb) с увеличенным периодом полужизни, направленным на защиту всех младенцев, вступающих в свой первый сезон RSV, когда они подвергаются наибольшему риску тяжелого RSV-заболевания. 1, 6, 7 Вместе с нирсевимабом защитное антитело вводится непосредственно младенцу с целью обеспечения быстрой защиты.

В отличие от других разрабатываемых вариантов RSV, таких как материнские вакцины, нирсевимаб был разработан для введения при рождении младенцам, родившимся во время сезона RSV, или в начале сезона для младенцев, родившихся до этого сезона.

«Респираторно-синцитиальный вирус является основной причиной госпитализаций всех младенцев », – сказал Жан-Франсуа Туссен, руководитель глобального отдела исследований и разработок Sanofi Pasteur . « Фактически, большинство госпитализаций происходит у здоровых доношенных детей. Понятно, что всем младенцам нужна защита от RSV, и мы надеемся, что нирсевимаб станет важным дополнением к обычным графикам иммунизации ».

«Эти новаторские результаты знаменуют собой крупный научный прогресс в наших усилиях. обеспечивают защиту от респираторно-синцитиального вируса для всех младенцев . Почти все дети заразятся вирусом в возрасте до двух лет, что приведет к почти 30 миллионам острых инфекций нижних дыхательных путей во всем мире каждый год », – сказала Мене Пангалос, исполнительный вице-президент отдела исследований и разработок биофармацевтических препаратов, AstraZeneca. Нирсевимаб потенциально может принести значительную пользу общественному здравоохранению в качестве первого иммунизации против респираторно-синцитиального вируса z для всего младенческого населения, и эти данные приближают нас на один шаг к предоставлению нирсевимаба младенцам во всем мире.

Нирсевимаб также оценивается в исследовании MEDLEY фазы II / III, в котором будет оцениваться безопасность и переносимость нирсевимаба по сравнению с синагисом (паливизумаб) среди недоношенных детей и детей с хроническими заболеваниями легких (ХЗЛ) и врожденными пороками сердца (CHD) вступают в свой первый и второй сезоны RSV. Ожидается, что испытание фазы II / III будет досрочно завершено, и первые данные ожидаются в ближайшие месяцы.

Около Фаза 3 МЕЛОДИЯ Исследование

Исследование Фазы 3 представляет собой рандомизированное плацебо-контролируемое испытание, разработанное для определения частоты инфекций нижних дыхательных путей (ИДП) под медицинским наблюдением, вызванных полимеразой обратной транскриптазы Цепная реакция (RT-PCR) подтвердила RSV через 150 дней после введения дозы по сравнению с плацебо у здоровых младенцев, вступающих в свой первый сезон RSV.Здоровые поздние недоношенные и доношенные дети с гестационным возрастом 35 недель 0 дней и более были рандомизированы (2: 1) для получения однократной внутримышечной инъекции 50 мг (для детей с массой тела <5 кг) или 100 мг (для детей с массой тела ≥ 5 кг) нирсевимаба или плацебо. В период с июля 2019 года по февраль 2021 года около 1500 младенцев получали дозу нирсевимаба или плацебо в начале сезона RSV. Исследование проводилось AstraZeneca в 21 стране. Еще 1500 младенцев будут зачислены в Северное и Южное полушария для завершения оценки безопасности.

В июле прошлого года подробные результаты положительного исследования фазы 2b для нирсевимаба были опубликованы в NEJM, которые показали значительное сокращение числа обслуживаемых врачом инфекций нижних дыхательных путей, в основном бронхиолита и пневмонии, и госпитализаций, вызванных респираторно-синцитиальным вирусом (RSV) у здоровых недоношенных. младенцы.


RSV – это распространенный заразный вирус, который поражает дыхательные пути, вызывая миллионы госпитализаций во всем мире среди младенцев, и является наиболее частой причиной бронхиолита и пневмонии у детей младше одного года. 1-5,8,9 Показатели госпитализаций из-за RSV-инфекции неизменно самые высокие в первый год жизни – младенцы до одного года составляют 75% госпитализаций RSV среди детей до 5 лет. 2 , 10 , 11 Большинство госпитализаций по поводу RSV происходит у здоровых доношенных детей. 2,1 1- 13 Более того, ИДП, требующие медицинского вмешательства, связаны с повышенными расходами для системы здравоохранения. 14

Примерно n ирсевимаб

Нирсевимаб – это mAb против РСВ с увеличенным периодом полужизни, разрабатываемое в качестве пассивной иммунизации для предотвращения ИДП, вызванного РСВ.Он разработан для широкого круга детей младшего возраста, включая всех младенцев, перенесших свой первый сезон RSV, и младенцев с врожденным пороком сердца или хроническим заболеванием легких, вступающих в первый и второй сезон RSV. 1 5 , 1 6

Нирсевимаб разработан для обеспечения защиты от RSV с помощью антител, вводимых непосредственно младенцу, чтобы помочь предотвратить LRTI, вызванные RSV, в отличие от активной иммунизации, когда иммунная система человека активируется на предотвратить инфекцию или бороться с ней с помощью вакцины. 1 7 Пассивная иммунизация может обеспечить быструю защиту в отличие от активной иммунизации, для выработки которой могут потребоваться недели. 1 7

В марте 2017 года AstraZeneca и Sanofi объявили о соглашении о разработке и коммерциализации нирсевимаба. В соответствии с условиями соглашения AstraZeneca руководит всей деятельностью по разработке посредством первоначальных разрешений и сохраняет производственную деятельность, а Санофи будет вести деятельность по коммерциализации. Нирсевимаб в настоящее время проходит клинические испытания, и его безопасность и эффективность не рассматривались ни одним регулирующим органом.

Примечание редактора: В январе 2021 года нирсевимаб получил обозначение перспективной инновационной медицины (PIM) от Агентства по регулированию лекарственных средств и медицинских товаров Великобритании (MHRA), а также было присвоено звание прорывной терапии (BTD) Китайским центром лекарств. Оценка (CDE) в рамках Национального управления по медицинским изделиям. В феврале 2019 года Управление по санитарному надзору за качеством пищевых продуктов и медикаментов США присвоило нирсевимабу статус прорывной терапии для профилактики ИДПТ, вызванного RSV, а Европейское агентство по лекарственным средствам (EMA) предоставило доступ к своей схеме PRIority MEdicines (PRIME) по тем же показаниям.В Японии нирсевимаб был также выбран Японским агентством медицинских исследований и разработок (AMED) в качестве «лекарства для приоритетных разработок» в рамках Проекта по выбору лекарств для содействия разработке новых лекарств в педиатрии.

О Санофи

Санофи стремится поддерживать людей в решении их проблем со здоровьем. Мы – глобальная биофармацевтическая компания, ориентированная на здоровье человека. Мы предотвращаем болезни с помощью вакцин, предлагаем инновационные методы лечения боли и облегчения страданий.Мы поддерживаем тех немногих, кто страдает редкими заболеваниями, и миллионы людей с длительными хроническими заболеваниями.

С более чем 100 000 сотрудников в 100 странах, Санофи трансформирует научные инновации в решения для здравоохранения по всему миру.

Санофи, Empowering Life

Связь со СМИ s
Эшли Косс
Тел .: +1 (908) 205-2572
Эшли[email protected]

Николас Крессманн
Тел .: +1 (732) 532 53-18
[email protected]

Связи с инвесторами Контакты Париж
Ева Шефер-Янсен 906 Арно Делепин

Связи с инвесторами Контакты Северная Америка
Феликс Лаушер
Фара Берковиц
Сюзанна Греко

Основная линия IR:
Тел .: +33 (0) 1 53 77 45 45
инвестор[email protected]


Заявления о перспективах Санофи
Этот пресс-релиз содержит прогнозные заявления, как это определено в Законе о реформе судебных разбирательств по частным ценным бумагам 1995 года с поправками. Заявления прогнозного характера – это заявления, которые не являются историческими фактами. Эти заявления включают прогнозы и оценки и лежащие в их основе предположения, заявления относительно планов, целей, намерений и ожиданий в отношении будущих финансовых результатов, событий, операций, услуг, развития продукта и потенциала, а также заявления относительно будущих результатов.Прогнозные заявления обычно идентифицируются словами «ожидает», «ожидает», «полагает», «намеревается», «оценивает», «планирует» и аналогичными выражениями. Хотя руководство Санофи считает, что ожидания, отраженные в таких прогнозных заявлениях, являются разумными, инвесторов предупреждают, что прогнозная информация и заявления подвержены различным рискам и неопределенностям, многие из которых трудно предсказать и, как правило, находятся вне контроля Санофи. которые могут привести к тому, что фактические результаты и развитие событий будут существенно отличаться от тех, которые выражены, подразумеваются или прогнозируются в прогнозной информации и заявлениях.Эти риски и неопределенности включают, среди прочего, неопределенности, присущие исследованиям и разработкам, будущим клиническим данным и анализу, в том числе постмаркетинговым, решениям регулирующих органов, таких как FDA или EMA, относительно того, следует ли и когда одобрять какое-либо лекарство, устройство. или биологическая заявка, которая может быть подана для любых таких продуктов-кандидатов, а также их решения относительно маркировки и других вопросов, которые могут повлиять на доступность или коммерческий потенциал таких продуктов-кандидатов, тот факт, что кандидаты в продукты в случае утверждения могут не иметь коммерческого успеха, будущее одобрение и коммерческий успех терапевтических альтернатив, способность Санофи извлекать выгоду из возможностей внешнего роста, завершать связанные сделки и / или получать разрешения регулирующих органов, риски, связанные с интеллектуальной собственностью, и любые связанные с ними незавершенные или будущие судебные разбирательства, а также конечный результат такого судебного разбирательства, тенденции в обменные курсы и преобладающие процентные ставки , неустойчивые экономические и рыночные условия, инициативы по сдерживанию затрат и последующие изменения в них, а также влияние COVID-19 на нас, наших клиентов, поставщиков, продавцов и других деловых партнеров, а также на финансовое состояние любого из них, как а также на наших сотрудников и на мировую экономику в целом.Любое существенное влияние COVID-19 на все вышеперечисленное также может негативно повлиять на нас. Эта ситуация быстро меняется, и могут возникнуть дополнительные воздействия, о которых мы в настоящее время не знаем, и которые могут усугубить другие ранее выявленные риски. Риски и неопределенности также включают неопределенности, обсуждаемые или выявленные в публичных документах, поданных в SEC и AMF, сделанные Санофи, в том числе те, которые перечислены в разделах «Факторы риска» и «Предупреждающее заявление в отношении прогнозных заявлений» в годовом отчете Санофи по форме 20. -F за год, закончившийся 31 декабря 2020 г.За исключением случаев, предусмотренных действующим законодательством, Санофи не берет на себя никаких обязательств по обновлению или пересмотру какой-либо прогнозной информации или заявлений.

1. Shi T, et al. Глобальные, региональные и национальные оценки бремени острых респираторных инфекций нижних дыхательных путей, вызванных респираторно-синцитиальным вирусом, у детей младшего возраста в 2015 г .: систематический обзор и исследование на основе моделирования. Lancet 2017; 390: 946–58.
2. Rha B et al. Госпитализации детей раннего возраста, связанные с респираторно-синцитиальным вирусом: 2015–2016 гг. Педиатрия . 2020; 146 (1): e20193611.
3. Лидер С. и др. Последние тенденции в распространении тяжелого респираторно-синцитиального вируса (РСВ) среди младенцев в США, 1997–2000 гг. J Pediat r ics . 2003; том 143: S127-S132.
4. Зал CB. Растущее бремя респираторно-синцитиального вируса среди детей. Заражение Расстройство Наркотики . 2012; 12 (2): 92-97
5. Reeves RM et al. Оценка бремени респираторно-синцитиального вируса (РСВ) на госпитализацию респираторных заболеваний у детей младше пяти лет в Англии, 2007-2012 гг. Вирусы гриппа, другие респираторы . 2017; 11 (2): 122-129
6. Санофи Пастер. Данные файла . Санофи Пастер MarketScan® Внутренний анализ
7. Роуз Э. Б. и др. Сезонность респираторно-синцитиального вируса – США, 2014–2017 гг. MMWR Morb Mortal Wkly Rep . 2018; 67: 71–76
8. Пьедимонте G, Perez MK. Респираторно-синцитиальная вирусная инфекция и бронхиолит. Педиатр Ред. . 2014; 35 (12): 519-530
9.Oymar K et al. Острый бронхиолит у грудных детей, обзор. Scand J Trauma Resusc Emerg Med . 2014; 22: 23
10. Hall CB, et al. Бремя респираторно-синцитиальной вирусной инфекции у детей раннего возраста. N Engl J Med . 2009; 360 (6): 588–598
11. Hall CB, et al. Госпитализации, связанные с респираторно-синцитиальным вирусом, среди детей в возрасте до 24 месяцев. Педиатрия . 2013; 132 (2): e341-e348
12.Arriola CS et al. Расчетное бремя госпитализаций, связанных с респираторно-синцитиальным вирусом, среди детей в возрасте <2 лет в США, 2014–2015 гг. J Детский инфекционный Dis Soc . 2019: DOI: 10.1093 / jpids / piz087
13. Крылов Л.Р. и др. Влияние политики иммунопрофилактики Американской академии педиатрии в 2014 г. на частоту, тяжесть и стоимость госпитализаций недоношенных детей, вызванных респираторно-синцитиальным вирусом. Am J Perinatol . 2020 Янв; 37 (2): 174-183
14.Leistner R, et al. «Приписываемые затраты на ИВЛ-ассоциированную инфекцию нижних дыхательных путей (ИДПТ), приобретенную в отделениях интенсивной терапии: ретроспективно сопоставленное когортное исследование». Устойчивость к противомикробным препаратам и инфекционный контроль , vol. 2, вып. 1, 4 апреля 2013 г., стр. 13., DOI: 10.1186 / 2047-2994-2-13
15. Clinicaltrials.gov. Исследование по оценке безопасности и эффективности MEDI8897 для профилактики инфекций нижних дыхательных путей, вызванных РСВ, у здоровых поздних недоношенных и доношенных детей (MELODY). https: // клинические испытания.gov / ct2 / show / NCT03979313. По состоянию на апрель 2021 г.
. 16. Clinicaltrials.gov. Исследование по оценке безопасности MEDI8897 для профилактики инфекции нижних дыхательных путей (ИНДП), вызываемой медицинским наблюдением, респираторно-синцитиальным вирусом (РСВ) у детей из группы высокого риска. https://clinicaltrials.gov/ct2/show/NCT03959488. По состоянию на апрель 2021 г.
17. Центры по контролю и профилактике заболеваний. Вакцины и иммунизация. 18 августа 2017 г. https://www.cdc.gov/vaccines/vac-gen/immunity-types.htm. По состоянию на апрель 2021 г.

Исследование Ad26.Схема на основе RSV.preF для предотвращения полимеразной цепной реакции с обратной транскриптазой (ОТ-ПЦР) -Подтвержденная респираторно-синцитиальная вирусная (RSV) -зависимая болезнь нижних дыхательных путей у взрослых в возрасте 65 лет и старше – Просмотр полного текста

Оптимально Исследования
Хантсвилл, Алабама, США, 35802
Synexus Clinical Research US, Inc
Chandler, Arizona, United States, 85224
Synexus Clinical Research US, Inc
Phoenix, Arizona, United States, 85018
Central Phoenix Medical Clinic
Phoenix, Arizona, United States, 85020
Anaheim Clinical Trials, LLC
Анахайм, Калифорния, США, 92801
Paradigm Clinical Research Center, Inc.
Реддинг, Калифорния, США, 96001
Benchmark Research
Сакраменто, Калифорния, США, 95684
Оптимальное исследование
Сан-Диего, Калифорния, США, 92108
Synexus Clinical Research US, Inc
Аврора, Колорадо, США, 80014
Lynn Institute
Колорадо-Спрингс, Колорадо, США, 80920
Оптимальное исследование
Мельбурн, Флорида, США, 32934
Расширенные клинические исследования
Бойсе, Айдахо, США, 83642
Optimal Research
Пеория, Иллинойс, США, 61614
Synexus Clinical Research US, Inc
Evansville, Indiana, United States, 47714
Клиника Айовы
West Des Moines, Iowa, United States, 50266
Hutchinson Clinic
Хатчинсон, Канзас, США, 67502
Клинические испытания округа Джонсон
Ленекса, Канзас, США, 66219
Heartland Research Associates, LLC
Newton, Канзас, США, 67114
Heartland Research Associates, LLC
Уичито, Канзас, США, 67205
Оптимальное исследование
Роквилл, Мэриленд, США, 20850
Synexus Clinical Research US, Inc
Ричфилд, Миннесота, США, 55432
Центр фармацевтических исследований
Канзас-Сити, Миссури, США, 64114
Sundance Clinical Research
Сент-Луис, штат Миссури, США, 63141
Synexus Clinical Research US, Inc
Сент-Луис, штат Миссури, США, 63141
Synexus Clinical Research US, Inc
Элкхорн, Небраска, США, 68022
Synexus Clinical Research US, Inc
Омаха, Небраска, США, 68144
United Medical Associates
Бингемтон, Нью-Йорк, США, 13901
Regional Clinical Research, Inc.
Endwell, New York, United States, 13760
Рочестерский университет / больница общего профиля в Рочестере
Рочестер, Нью-Йорк, США, 14621
Synexus Clinical Research US, Inc
Акрон, Огайо, США, 44311
Synexus Clinical Research US, Inc
Цинциннати, Огайо, США, 45236
Rapid Medical Research
Кливленд, Огайо, США, 44122
Lynn Health Science Institute
Оклахома-Сити, Оклахома, США, 73112
Omega Medical Research
Warwick, Род-Айленд, США, 02886
Исследовательский центр прибрежной Каролины
Mount Pleasant, Южная Каролина, США, 29464
Optimal Research
Остин, Техас, США, 78705
Ventavia Research Group, LLC
Форт-Уэрт, Техас, США, 76104
Synexus Clinical Research US, Inc
Мюррей, Юта, США, 84123
Расширенные клинические исследования
Солт-Лейк-Сити, Юта, США, 84123
Расширенные клинические исследования
West Jordan, Utah, United States, 84088

Мощный широко нейтрализующий человеческий RSV-антител является мишенью для консервативного сайта IV гибридного гликопротеина

Человеческие субъекты

Информированное согласие добровольцев было получено в соответствии с Хельсинкской декларацией. 1975 г. (одобрен Советом по институциональной проверке Merck Sharp & Dohme, дочерней компании Merck & Co., Inc., Кенилворт, Нью-Джерси, США). РВМС от выбранных доноров очищали из крови, собранной в пробирки с ЭДТА, центрифугированием в градиенте плотности в гистопаке над пробирками Accuspin TM (Sigma Aldrich, Кат. №: A2055) в соответствии с инструкциями производителя. Затем PBMC замораживали в 90% инактивированном нагреванием FBS с добавлением 10% диметилсульфоксида и хранили в жидком азоте до оттаивания для использования в экспериментах.

RSV post-Fusion F-специфическое выделение B-клеток памяти

Метод выделения post-F-специфических B-клеток памяти и антител из них был выполнен аналогично методу, описанному в Cox et al. 41 . В частности, криоконсервированные PBMC размораживали в день сортировки, промывали стерильным PBS с добавлением 1% FBS и инкубировали в течение 25 минут с биотинилированным белком Post-F. Клетки промывали и окрашивали анти-CD3 BV421 (каталожный № 562426, BD Biosciences), анти-CD19 FITC (кат. № 555412, BD Biosciences), анти-IgG APC (кат. № 550931, BD Biosciences) и стрептавидином. ПЭ (каталожный № 349023, BD Biosciences) в течение 25 минут в объеме, рекомендованном производителем, на тест и промывали. Клетки, связывающие белок CD3- / CD19 + / IgG + / Post-F, сортировали с помощью BD FACS Jazz в одноклеточном режиме в 96-луночный планшет.Отсортированные клетки культивировали в RPMI с FBS в присутствии облученных фидерных клеток, экспрессирующих CD40L, в концентрации 4,0 × 10 4 клеток / лунку (клеточная линия собственного производства) и IL-21 (Sino Biologicals cat. # 10584-HNAE-20) при 50 нг / мл для преобразования в секретирующие антитела клетки. Супернатанты переносили в новые планшеты и анализировали на связывание с белком F RSV и активность по нейтрализации вирусов. Осадки клеток в планшетах лизировали в 50 мкл на лунку буфера RLT (Qiagen) с добавлением 1% 2-меркаптоэтанола (2-ME) (Sigma Aldrich Chemicals) и быстро замораживали на сухом льду.Затем планшеты переносили в морозильную камеру -80 ° C для хранения.

Экспрессия и очистка слитых белков RSV

Плазмиды, кодирующие оптимизированные по кодонам млекопитающие белки RSV F до слияния (DS-Cav1) и после слияния (F∆FP), использовали для трансфекции клеток Expi 293 F (ThermoFisher cat. # A14527), а белки очищали из культуральных супернатантов 18,17 . В частности, супернатанты клеточных культур собирали на 3-й (F∆FP) или 7-й (DS-Cav1) день после плазмидной трансфекции, и белки F RSV очищали с использованием хроматографии на Ni-сефарозе (GE healthcare).Супернатанты замороженных культур клеток размораживали и повторно осветляли при 14260 × г в течение 30 минут при 5 ° C. PH супернатанта доводили путем добавления 1 M HEPES, pH 7,5 (обычно 50 мл / л) и добавляли 2 M имидазола (pH 7,5) до конечной концентрации 10 мМ. После добавления супернатант перемешивали и фильтровали через 1 л вакуумный фильтр Nalgene Rapid-Flow (0,45 микрон / PES). Белки F RSV очищали с помощью хроматографии на Ni-сефарозе (GE healthcare). F∆FP дополнительно очищали с помощью хроматографии на Strep-Tactin (Strep-Tactin Superflow Plus, Qiagen).Метки удаляли с DS-Cav1 и F∆FP путем расщепления тромбином в течение ночи. Для удаления примесей IMAC и нерасщепленного белка F DS-Cav1 подвергали второй стадии хроматографии на Ni-сефарозе. И DS-Cav1, и F∆FP очищали гель-фильтрационной хроматографией (Superdex 200, GE Healthcare) и хранили в буфере 50 мМ HEPES pH 7,5, 300 мМ NaCl. Очистку всех колонок проводили в системе очистки GE Healthcare AKTA Purifier System при комнатной температуре. Все буферы перед использованием фильтровали под вакуумом (0.22 мкм, CA).

Иммуноферментный анализ слитого белка RSV

Планшеты Nunc C96 Maxisorp Nunc-Immuno покрывали 50 мкл на лунку белка RSV Pre-F или Post-F в концентрации 1 мкг / мл при 4 ° C в течение ночи. Планшеты промывали PBS / 0,05% Tween 20, а затем блокировали PBS / 0,05% Tween 20/3% обезжиренного молока при комнатной температуре в течение 1 часа. Затем добавляли 50 мкл на лунку 3-кратно серийно титрованных mAb и инкубировали при комнатной температуре в течение 90 мин. Планшеты промывали и добавляли по 50 мкл на лунку конъюгированного с HRP козьего античеловеческого IgG (1: 2000) (Southern Biotech cat.№ 2040–05). После 60 мин инкубации при комнатной температуре планшеты промывали и добавляли по 100 мкл на лунку раствора SuperBlu-Turbo TMB (ViroLabs). Планшеты инкубировали при комнатной температуре в течение 5 минут и реакцию останавливали добавлением 100 мкл на лунку стоп-раствора для TMB ELISA (ViroLabs). Затем планшеты считывали на счетчике VICTOR Multilabel Counter (Wallac / Perkin Elmer) при 450 нм.

Извлечение последовательностей антител из культуры В-клеток памяти

Хранимые в замороженном виде отсортированные и культивируемые 96-луночные планшеты, содержащие лизированные В-клетки в буфере RLT, размораживали при комнатной температуре.Экстракцию тотальной РНК для иммуноанализа проводили с помощью набора Qiagen RNeasy Micro Kit (Qiagen) в соответствии с инструкциями производителя.

Экстрагированную тотальную РНК использовали в качестве матрицы в ОТ-ПЦР для амплификации генов антител человека с помощью набора для одностадийной ОТ-ПЦР Qiagen (Qiagen). Реакцию RT проводили при 50 ° C в течение 30 мин для синтеза первой цепи кДНК. Реакция ПЦР была запущена при 95 ° C в течение 15 минут для инициирования горячего старта для ДНК-полимеразы HotStarTaq, представленной в смеси RT-PCR, с последующими 40 циклами 94 ° C в течение 30 секунд, 55 ° C в течение 30 секунд, 72 ° C в течение 1 мин, затем 10 мин элонгации при 72 ° C и выдержке 4 ° C для кратковременного хранения.Продукты ОТ-ПЦР использовали непосредственно (без очистки) в качестве матриц во вложенной ПЦР для амплификации вариабельных областей антитела с помощью ДНК-полимеразы pfx50 (Invitrogen). Условия ПЦР для амплификации вариабельных областей тяжелой, каппа, легкой цепи остались прежними: 94 ° C в течение 2 минут, затем 10 циклов 94 ° C в течение 30 секунд, 50 ° C в течение 30 секунд, 68 ° C в течение 1 минуты, затем 30 циклов: 94 ° C в течение 30 секунд, 60 ° C в течение 30 секунд, 68 ° C в течение 1 минуты, затем 7-минутное удлинение при 68 ° C и 4 ° C для кратковременного хранения. Затем вложенные продукты ПЦР использовали в качестве матриц в перекрывающейся ПЦР для соединения легкой и тяжелой цепей антитела.Условия перекрывающейся ПЦР для соединения легкой цепи (каппа или лямбда) и тяжелой цепи с линкером: 94 ° C в течение 2 минут, затем 10 циклов 94 ° C в течение 30 секунд, 60 ° C в течение 30 секунд, 68 ° C в течение 2 минут. с последующими 30 циклами 94 ° C в течение 30 секунд, 65 ° C в течение 30 секунд, 68 ° C в течение 2 минут, затем 7-минутное удлинение при 68 ° C и выдержка при 4 ° C для кратковременного хранения. Перекрывающийся продукт ПЦР субклонировали с помощью набора для клонирования HD для инфузии (Clontech) в соответствии с инструкциями производителя и секвенировали. Праймеры для клонирования В-клеток человека представлены в дополнительной таблице 1.

Выравнивание вариабельной области RB1 с зародышевой линией человека

Аминокислотная последовательность антитела RB1 была выровнена с последовательностью зародышевой линии антитела человека с использованием IgBlast (https://ftp.ncbi.nih.gov/blast/executables/igblast / release / LATEST) и определяющую комплементарность область антитела (CDR) тяжелой цепи (обозначенной как RB1_VH) и легкой цепи (обозначенной как RB1_VK) определяли в соответствии с системой нумерации Kabat.

Производство рекомбинантных антител

Были синтезированы естественные парные последовательности вариабельной области тяжелой и легкой цепей, которые затем были субклонированы в вектор pTT5 для CHO-3E7 (Национальный исследовательский совет Канады, кат.# 11992) выражение ячейки. Клетки CHO-3E7 выращивали в суспензии в бессывороточной среде для экспрессии FreeStyle CHO Expression Medium (Life Technologies). Рекомбинантные плазмиды, кодирующие тяжелые и легкие цепи каждого антитела, временно котрансфицировали в клетки CHO-3E7 и культивировали в течение 6 дней. Супернатант клеточной культуры собирали, центрифугировали и фильтровали. Отфильтрованный супернатант загружали в колонку Protein A CIP (GenScript). После промывки и элюирования элюат заменяли буферным раствором на 1 × фосфатно-солевой буферный раствор (PBS) при pH 7.2.

Оценка аффинности связывания с помощью SPR

Связывание Fab RB1 с белками F RSV до и после слияния характеризовали с помощью поверхностного плазмонного резонанса с использованием системы Biacore T200 (GE Healthcare, Piscataway, NJ). Для белка перед слиянием приблизительно 5000 RU антитела D25 загружали в каналы 1 и 2 сенсорного чипа Series S Protein A (GE Healthcare), и DS-Cav1 пропускали через канал 2 в условиях, которые позволяли захват 50 RU рекомбинантного белка. Двухкратные серийные разведения моновалентного Fab RB1 пропускали через оба канала со скоростью 50 мкл / мин в течение 30 с, после чего следовали период диссоциации 300 с для 0.Концентрации RB1 Fab от 31 нМ до 10 нМ или 1800 с для концентрации 20 нМ RB1 Fab. Для анализа связывания с F после слияния 5000 RU антитела Synagis загружали на чип белка A для захвата 50 RU рекомбинантного белка F после слияния. RB1 Fab пропускали в двукратных серийных разведениях от концентрации 200 нМ до 3,12 нМ с последующим 40-секундным периодом диссоциации. Поверхности белка А регенерировали для каждого цикла после двух 20-секундных инъекций 10 мМ глицинового буфера, pH 1,5, при скорости потока 30 мкл / мин. Сенсограммы были скорректированы на фон сенсора (канал 2–1) и двойные ссылки после вычитания аналита с использованием холостого (0 нМ) инъекции RB1 Fab.Полученные наборы данных были подогнаны к модели связывания Ленгмюра 1: 1 с использованием оценочного программного обеспечения Biacore T200 (версия 2.0) для определения константы скорости ассоциации ( k a ) и диссоциации ( k d ), и константа равновесной диссоциации K D .

Анализ микронейтрализации RSV

RB1 разводили в EMEM, содержащем 2% FBS (инактивированный нагреванием), начиная с 10 мкг / мл, с последующими 3-кратными серийными разведениями. Разведения RB1 смешивали со 100 БОЕ RSV A (Long, ATCC cat.№: VR-26) или штамм RSV B (Вашингтон, АТСС, кат. №: VR-1580) и инкубировали в течение 1 часа при 37 ° C. После 1 ч инкубации в планшеты добавляли клетки HEp-2 (ATCC, кат. № CCL-23) в количестве 1,5 × 10 4 клеток / лунку. Чашки инкубировали при 37 ° C в течение 3 дней. После этого клетки промывали и фиксировали ледяным 80% ацетоном в PBS в течение 15 мин. Мышиные mAb против RSV-F и против RSV-N (созданные в компании, клон 143-F3-1B8 и 34C9, соответственно) в концентрации 1,25 мкг / мл каждое добавляли в планшеты и инкубировали в течение 1 ч при комнатной температуре.Затем планшеты промывали и добавляли биотинилированный лошадиный антимышиный IgG (Vector Laboratories Cat. # BA-2000) в разведении 1: 200. Через час планшеты промывали и проявляли с помощью двухканальной системы обнаружения в ближней инфракрасной области (NID) (Licor Odyssey Sa). В 96-луночные планшеты добавляли инфракрасный краситель-стрептавидин для обнаружения специфического сигнала RSV и два окрашивания клеток для нормализации анализа. Планшеты инкубировали 1 ч в темноте, промывали и сушили в темноте 20 мин. Затем планшеты считывали с помощью автоматизированной системы визуализации Licor Aerius® с использованием 700-канального лазера для нормализации клеток и 800-канального лазера для обнаружения специфического сигнала RSV.Рассчитывали соотношения 800/700 и определяли титры нейтрализации сыворотки с помощью четырехпараметрической аппроксимации кривой в GraphPad Prism.

Анализ микронейтрализации уменьшения бляшек HMPV

Моноклональные тестируемые антитела разводили в среде для анализа OTI-MEM (Gibco 31985-070) в серийных 3-кратных разведениях. Разведения антител смешивали со 100 БОЕ вируса HMPV HMPV A (штамм HMPV 16 типа A1: IA10-2003, ZepoMetrix, Ref # 0810161CF) или HMPV B (штамм hMPV-8: Peru6-2003 B2, ZepoMetrix Ref # 0810159CF) и инкубировали. в течение 1 ч при 37 ° C.После 1 ч инкубации в 96-луночные планшеты добавляли 50 мкл клеток LLC-MK2 (ATCC # CCL-7.1) в концентрации 1,2 × 10 6 клеток / мл. Планшеты инкубировали при 37 ° C в течение 1 ч, затем центрифугировали при 250 × g в течение 10 минут, покрывали 1% -ным покрытием из метилцеллюлозы и инкубировали при 37 ° C в течение 3 дней. На третий день накладку удаляли с лунок, используя 12-канальную вакуумную машину для промывки планшетов, и оставшуюся смесь клеток / вирусов фиксировали 10% формалином. Планшеты инкубировали при температуре окружающей среды в течение 30 мин и фиксатор удаляли.Планшеты промывали шесть раз блокированным PBS-0,05% Tween-20 (каталог Odessey № 927-4000) в течение 30 мин. Блокирующий буфер удаляли, и планшеты инкубировали с mab против HMPV (EMD Millipore Cat. # MAB80124) 1: 1000 в блокирующем буфере в течение 1 часа. Планшеты промывали шесть раз PBS-0,05% Tween-20, и антитело детектировали с использованием вторичного антитела, конъюгированного с IgG Alexa 488 (Invitrogen # A11017) 1: 500. Планшеты инкубировали в течение 1 ч при температуре окружающей среды и считывали с помощью планшет-ридера EnSight (Perkin Elmer).

Анализы последовательностей RSV

Полные последовательности гликопротеинов RSV F из 3600 заявок были получены из GenBank для анализа (https://www.ncbi.nlm.nih.gov/genbank/; по состоянию на апрель 2019 г.). Из них 3058 содержали полный внеклеточный домен и не содержали неоднозначных аминокислот в антигенном сайте IV. Запись Genbank AHA61614 была исключена из анализа из-за атипично большой степени расхождения последовательностей с другими последовательностями RSV A и RSV B согласно нашему собственному анализу и, как сообщалось в Souza, et al. 42 . Последовательности выравнивали с использованием модифицированной программы Seq2Logo 43 и определяли аминокислотную частоту в каждом положении. Последовательности гликопротеина F RSV из дополнительной панели из 47 клинических изолятов были секвенированы.

Анализ дендрограммы гликопротеина F RSV

Внеклеточный домен гликопротеина F RSV включает аминокислоты с 27 по 529, согласно аннотации Uniprot (Консорциум UniProt). Используя алгоритм биоинформатики clustalW http: // www.clustal.org/ 44 , всего 391 последовательность внеклеточного домена были сгруппированы. 391 последовательность включает 345 уникальных последовательностей GenBank и последовательности из 47 клинических изолятов. Кластеризованные данные визуализировали с помощью FigTree версии 1.4.3 (http://tree.bio.ed.ac/software/figtree/).

Сбор и приготовление клинических изолятов RSV

Для анализа нейтрализации in vitro была отобрана панель из 47 клинических изолятов RSV, содержащих аминокислотные изменения в слитом гликопротеине F.Клинические изоляты RSV размножали в клетках HEp-2 (ATCC, кат. № CCL-23); Для анализа готовили запасы вирусов с низким числом пассажей. Титры исходных вирусных исходных клинических изолятов с малым пассажем определяли с использованием иммуноокрашивания бляшек. Эти исходные вирусы впоследствии использовали в анализе нейтрализации инфекции in vitro.

Модель профилактического заражения хлопковых крыс in vivo

Пять самок хлопковых крыс в возрасте 4-7 недель ( Sigmodon hispidus ) на каждую дозовую группу (SAGE Animals, Boyertown, PA или Envigo, Somerset, NJ) были пассивно иммунизированы , внутримышечно с RB1 (рис.4a – d), или с RB1, RB1-LALA (рис. 4e), паливизумабом или паливизумаб-LALA (рис. 4f). Для каждого эксперимента разведения антител начинались с 2,5 мг / кг, а затем серийно разводились в 3 раза до 0,03. мг / килограмм (в частности, было протестировано всего пять дозовых групп антител (5 животных / группа): 2,5, 0,83, 0,27, 0,09 и 0,03 мг / кг). Для расчета дозы использовали единичный вес, полученный при усреднении шести случайных животных. Животным вводили антитело в левую четырехглавую мышцу в объеме 100 мкл в день 1 под изофлурановой анестезией.Также была включена контрольная группа, состоящая из наивных животных. Образцы сыворотки были собраны для определения концентрации антител в сыворотке с последующим интраназальным введением животным 10 5 БОЕ вируса RSV A2 (ATCC VR-1540) или RSV B 18537 (Вашингтон, ATCC VR-1580) в объеме 0,1 мл на 2-й день. примерно через 24 ± 2 часа после переноса RB1 под анестезией. Через четыре дня после инокуляции животных умерщвляли путем ингаляции СО2, и доли левого легкого, а также носовые раковины удаляли и гомогенизировали в 10 объемах сбалансированного солевого раствора Хэнкса (Lonza), содержащего фосфатный буфер сахарозы (SPG), на влажном льду.Образцы осветляли центрифугированием при 300 × g в течение 10 минут, разделяли на аликвоты, мгновенно замораживали и немедленно хранили замороженными при -70 ° C до размораживания для титрования вирусов. Исследования на животных были одобрены Merck Sharp & Dohme Corp., дочерней компанией Merck & Co., Inc., Кенилворт, штат Нью-Джерси, США, Институциональным комитетом по уходу и использованию животных, и проводились в соответствии с руководящими принципами по уходу за животными.

Анализ бляшек RSV для исследований заражения хлопковых крыс

Гомогенаты легких и носа хлопковых крыс тестировали с помощью анализа бляшек для определения бляшкообразующих единиц на грамм (БОЕ / г) ткани.Гомогенаты разводили в бессывороточной среде Williams E и добавляли в двух экземплярах в 24-луночные планшеты, содержащие конфлюэнтные клетки HEp-2 (ATCC, кат. № CCL-23). После 1-часового инфицирования при 37 ° C испытуемые образцы удаляли, и клетки покрывали 1 мл 0,75% метилцеллюлозы в Williams E с добавлением 1,6% фетальной бычьей сыворотки. После инкубации при 37 ° C в течение 5 дней клетки фиксировали / окрашивали раствором кристаллического фиолетового, содержащим 5% глутарового альдегида. Бляшки подсчитывали визуально с помощью препаровального микроскопа и использовали для расчета БОЕ / г.


Белок pre-F или post-F RSV наносили на 96-луночные планшеты в концентрации 2 мкг / мл в 1 × (PBS) в течение ночи. Планшеты промывали и блокировали 3% молоком в PBS, содержащем 0,05% Tween 20, в течение 1 часа. Образцы сыворотки разводили 1:50 в блокирующем буфере с последующими 4-кратными серийными разведениями. Сто (100) мкл каждого разбавленного образца сыворотки и стандарта добавляли в 96-луночные планшеты и инкубировали в течение двух часов. Для каждого анализа стандартным контролем было соответствующее антитело. Например, для исследований на хлопковых крысах, которым вводили дозу RB1, в качестве стандарта использовали серийно разведенный RB1 с определенной количественной концентрацией.После инкубации планшеты промывали и добавляли 50 мкл конъюгированного с пероксидазой хрена (HRP) античеловеческого IgG (Invitrogen # 62-7120), разведенного 1: 2000 в блокирующем буфере, и инкубировали в течение 1 часа. Планшеты промывали и проявляли SuperBlu Turbo TMB и стоп-раствором. Планшеты считывали на Molecular Devices VersaMax при OD 450 нм. Программное обеспечение Softmax использовалось для построения 4-параметрической кривой для получения концентрации антитела в каждом образце.

Расчет EC


для хлопковой крысы Значения EC 50 для каждого штамма RSV рассчитывали следующим образом: Концентрацию антител в сыворотке измеряли для каждого животного на 1 день после введения с использованием описанного иммуноанализа концентрации лекарственного средства антитела в сыворотке.Инфекционные титры RSV также определяли на 5 день с использованием анализа бляшек RSV. Значения EC 50 и 95% доверительные интервалы для mAb в ткани оценивали с помощью ингибирующего сигмоидального анализа зависимости реакции от дозы с переменным наклоном (GraphPad Prism ® , версия 6).

Данные были нанесены на график следующим образом: ось x представляет собой log10 концентрацию трансформированного антитела в сыворотке на 1 день в мкг / мл, где: 100 мкг / мл = 2 log (мкг / мл). Ось y представляет собой log10-трансформированный вирусный титр, где: 1 × 10 5 БОЕ / г ткани = 5 log (БОЕ / г ткани) на 5-й день.Подбор 4-параметрической кривой соответствовал следующим ограничениям: нижняя часть кривой была ограничена, чтобы равняться пределу обнаружения анализа бляшек, 2 log БОЕ / г ткани для легкого и 1,6 log БОЕ / г ткани для носа и верхняя часть кривой ограничена значением среднего титра необработанных контролей.

Статистический анализ исследований антител к LALA хлопковых крыс

Статистический анализ выполняли с использованием двустороннего непарного теста t с использованием статистического программного обеспечения GraphPad (GraphPad Prism ® , версия 6).Для выполнения анализа данные от каждого животного использовались в качестве точки данных, когда каждое тестировалось один раз (5 животных на группу в группе с пятью дозами).

Получение и секвенирование мутантов ускользания RSV (MARMS)

Создание мутантов ускользания RSV in vitro осуществляли аналогично тому, как описано в X. Zhao, et al и L. Tome, et al. 45,46 . В частности, 3,5–4,5 × 10 5 клеток HEp-2 (ATCC, кат. № CCL-23) высевали на лунку в 6-луночные планшеты. Культуральную среду удаляли через 24 часа, и клетки инфицировали штаммом RSV A2 при MOI 10 (~ 7.5 × 10 6 БОЕ / лунку) или штамм B Washington (1,7 × 10 6 БОЕ / лунку) при MOI 4 в присутствии субоптимальных концентраций антител в 3 мл среды EMEM / 2% FBS. Клетки и супернатанты собирали с использованием скребка для клеток при значительном CPE. Сборы переносили в пробирки на 15 мл и быстро замораживали на бане сухой лед / этанол, а затем размораживали на водяной бане при 37 ° C. Затем пробирки центрифугировали при 300 × g при комнатной температуре в течение 10 мин. 1 мл супернатанта использовали для заражения новых клеток HEp-2 в следующем раунде 2 мл свежей среды, содержащей такие же или повышенные концентрации mAb.Затем вирус собирали из лунок, содержащих более высокие концентрации mAb и показывающих CPE, и использовали в следующем раунде заражения. Процедуру повторяли до тех пор, пока концентрация mAb не достигала 10 мкг / мл, всего за 9 раундов отбора.

Мутанты Escape представляют собой отдельные бляшки, выбранные под микроскопом и используемые для инфицирования клеток HEp-2 в 24-луночных планшетах. Культуры HEp-2, инфицированные единичной бляшкой, применяли для последующей экстракции РНК с помощью Qiagen RNeasy Mini Kit (Qiagen, каталожный номер 74104) в соответствии с инструкциями производителя.Затем РНК применяли в ОТ-ПЦР-амплификации RSV F. В реакции ОТ-ПЦР использовали набор QIAGEN One-Step RT-PCR (Qiagen, каталожный номер 210212), условия ПЦР следующие: 50 ° C 30 мин для реакции RT, затем инкубация при 95 ° C 15 мин, затем 40 циклов 94 ° C 30 с, 57 ° C 30 с, 72 ° C 2 мин, затем 10 мин при 72 ° C для элонгации и 4 ° C для временного хранения. Последовательность прямого праймера – 5’ATGGAGTTGCTAATCCTCAAAG, а последовательность обратного праймера – 5 ’GTTACTAAATGCAAT ATTATTTATACCACTCAG.Продукты ПЦР секвенировали и анализировали с помощью Sequencher (Gene Codes Corp.) и Vector NTI (Invitrogen).

ELISA для связывания RB1 с мутантными белками по последовательности MARMS.

Плазмидные конструкции

MARM, содержащие желаемые точечные мутации, были созданы на фоне DS-Cav1 компанией Genewiz (South Plainfield, NJ 07080). Плазмидную ДНК использовали для временной трансфекции клеток Expi293F (ThermoFisher cat. # A14527). Экспифектамин (ThermoFisher, номер по каталогу A14525) использовали в качестве реагента для трансфекции для трансфекций.Клетки трансфицировали до конечной плотности клеток 2,6 × 10 6 жизнеспособных клеток / мл. На каждые 30 мл трансфекционной клеточной культуры использовали 30 мкг плазмидной ДНК и 80 мкл экспифектамина. Трансфекция была завершена в соответствии с рекомендациями производителя для реагента Expifectamine. Все культуры клеток инкубировали в инкубаторе при 37 ° C с увлажненной атмосферой, 8% CO 2 на орбитальном шейкере, вращающемся со скоростью 125 оборотов в минуту с шагом 1 дюйм. На 3 и 7 день после трансфекции 10 мл каждой трансфекции собирали центрифугированием при 2800 × g при комнатной температуре.Осветленные супернатанты подвергали денатурированию, восстановлению SDS-PAGE и вестерн-блоттингу с использованием для подтверждения желаемой экспрессии белка. Затем планшеты Nunc C96 Maxisorp Nunc-Immuno покрывали белком RSV Pre-F или вариантами белка F, которые включали изменения последовательностей, обнаруженные в MARMS. Планшеты инкубировали при 4 ° C в течение ночи, промывали PBS / 0,05% Tween 20 и затем блокировали PBS / 0,05% Tween 20/3% обезжиренного молока при комнатной температуре в течение 1 часа. Затем добавляли 50 мкл на лунку 3-кратно серийно титрованного RB1 и инкубировали при комнатной температуре в течение 90 мин.Планшеты промывали и добавляли по 50 мкл на лунку конъюгированного с HRP козьего античеловеческого IgG (1: 2000) (Southern Biotech Cat. # 2040-05). После 60 мин инкубации при комнатной температуре планшеты промывали и добавляли по 100 мкл на лунку раствора SuperBlu-Turbo TMB (ViroLabs). Планшеты инкубировали при комнатной температуре в течение 5 минут и реакцию останавливали добавлением 100 мкл на лунку стоп-раствора для TMB ELISA (ViroLabs). Затем планшеты считывали на счетчике VICTOR Multilabel Counter (Wallac / Perkin Elmer) при 450 нм.

Картирование эпитопов с помощью мутагенеза дробовиком

Картирование эпитопов сайта связывания RB1 на гликопротеине F RSV было выполнено Integral Molecular, Inc. (Филадельфия, США). В методе использовали гликопротеиновую последовательность RSV F, полученную из RSV-A2, номер ссылки FJ614814 Национального центра биотехнологической информации (NCBI). Мутагенез со сканированием аланином экспрессионной конструкции для гликопротеина F RSV нацелился на 368 открытых остатков, идентифицированных из кристаллических структур как до, так и после слияния конформации RSV F 17,18 .Каждый представляющий интерес остаток индивидуально мутировали в аланин, при этом нативные остатки аланина мутировали в серин. Полученные в результате 368 мутантных конструкций экспрессии гликопротеина RSV F подтверждали последовательность и помещали в 384-луночный планшет с одной мутацией на лунку. Мутации внутри клонов были определены как критические для эпитопа, связывающего антитело, если они не поддерживали реактивность по отношению к тестируемому антителу (например, RB1), но поддерживали реактивность контрольного антитела (например, D25 или паливизумаб). Эта стратегия встречного скрининга, включающая второе антитело против RSV, облегчает исключение мутантов гликопротеина F RSV, которые были неправильно свернуты или имели дефект экспрессии.Алгоритмы и интерпретация мутагенеза дробовика были выполнены в Intergrol Molecular, как описано в Davidson et al. 28

Кристаллизация гликопротеина слияния RB1 и RSV

Для образования комплекса RB1 / DS-Cav1 mAb RB1 расщепляли на моновалентный Fab с использованием набора для подготовки Fab (Pierce) в соответствии с инструкциями производителя. Расщепленный Fab RB1 инкубировали с очищенным DS-Cav1 при 4 ° C в течение ночи при соотношении антигена к Fab от 1 до 1,3 (вес / вес). Комплекс антиген / Fab очищали с помощью эксклюзионной хроматографии на колонке Superdex 200 (GE Healthcare) в 50 мМ HEPES, pH 7.5 и 300 мМ NaCl. Комплекс RB1-DSCav1 концентрировали до 10 мг / мл в буфере, содержащем 20 мМ HEPES pH 7,5 и 100 мМ NaCl. Кристаллы получали в условиях, содержащих 100 мМ Трис pH 8,5, 12% PEG 8000 и 200 мМ сульфата аммония. Хотя кристаллы появлялись легко, исходные кристаллы не подвергались дифракции с достаточным разрешением. Комбинация кристаллов затравки, дегидратации и просеивания дала кристаллы, дифрагированные более 3,5 ангстрем. Кристалл обезвоживали в течение четырех дней в буфере, содержащем 100 мМ Трис, pH 8.5 и 35% PEG 1500. Кристалл остекловывали для сбора данных непосредственно из буфера для дегидратации путем быстрого погружения в жидкий азот.

Сбор данных и решение для структурирования

Данные были собраны в канадском источнике света, Beamline 8ID-1, с использованием монокристалла. Сбор проводился при 100 К с использованием падающего рентгеновского излучения при 0,97490 Å. После обработки данных с помощью Autoproc 47 фазы были определены путем молекулярного замещения с помощью программы Phaser 48 , реализованной в пакете Phenix 49 .Решение было получено с использованием структуры DS-CAV1 (PDB: 4MMT 16 ) и Fab (код PDB: 1HZH 50 ) с удаленными областями, определяющими комплементарность, в качестве моделей поиска. Были обнаружены две копии DS-Cav1 и одна копия Fab. Поиск по двум и более фабрикам решений не дал. После уточнения с использованием Buster 51 другие пять копий Fab были созданы с помощью операций симметрии, основанных на ожидаемом связывании одного Fab с каждым мономером в пределах двух тримеров.Структура была уточнена с помощью итерационных циклов перестройки в Coot 52 и уточнения с помощью Buster или Phenix. Конечная структура имеет 94,9% остатков в благоприятной области графика Рамачандрана, 4,9% в разрешенной области и 0,2% в области выбросов. Структура комплекса между RB1 и RSV-F (DS-cav1) депонирована в wwPDB (код: 6OUS). Pymol (PyMOL Molecular Graphics System, Version 2.2 Schrödinger, LLC.) Использовался для создания молекулярных фигур и выполнения структурного выравнивания для моделирования взаимодействий RB1 с F.

Доступность материалов

Антитело RB1 не является общедоступным. В настоящее время образцы и дополнительное описание не будут предоставляться по запросу. Читатели могут связаться с соответствующим автором, запрашивающим реагенты или материалы, через Соглашение о передаче материалов (MTA), которое будет рассматриваться в индивидуальном порядке.

Краткое изложение отчета

Дополнительная информация о дизайне исследования доступна в Резюме отчета по исследованию природы, связанном с этой статьей.

Глобальный прогноз рынка лечения респираторно-синцитиального вируса человека (RSV) до 2027 года – AstraZeneca, Arrow Therapeutics, Alnylam

Отчет о рынке лечения респираторно-синцитиального вируса человека (РСВ), история и прогноз на 2016-2027 гг., Данные по компаниям, ключевым регионам, типам и применению

Отчет о лечении респираторно-синцитиального вируса человека (RSV) Market предлагает обзор нескольких важных стран, расположенных в разных географических регионах по всему миру.Экзамен оценивает различные рыночные модели, элементы, движущие силы развития и препятствия на пути развития рынка. Изображение предмета, расположение предметов, отраслевая структура и различные участники были частью основных элементов, рассмотренных во время исследования.

Получите образец копии этого отчета @


Основными участниками рынка лечения респираторно-синцитиального вируса человека (RSV) являются @ AstraZeneca, Arrow Therapeutics, Alnylam

Основная цель распространения этой информации – дать описательный анализ того, как тенденции могут потенциально повлиять на предстоящее будущее рынка лечения респираторно-синцитиального вируса человека (RSV) в течение прогнозируемого периода.Это рынки конкурентоспособных производителей, и будущие производители изучаются с их подробным исследованием. Выручка, производство, цена, рыночная доля этих игроков указаны с точной информацией.

G Рынок лечения лобального респираторно-синцитиального вируса человека (RSV): анализ регионального сегмента

В этом отчете представлен точный анализ изменения динамики конкуренции. Он предлагает перспективный взгляд на различные факторы, способствующие или ограничивающие рост рынка.Он предоставляет пятилетний прогноз, оцениваемый на основе прогнозируемого роста рынка лечения респираторно-синцитиального вируса человека (РСВ). Это помогает понять ключевые сегменты продукта и их будущее, а также помогает принимать обоснованные бизнес-решения, имея полное представление о рынке и делая углубленный анализ сегментов рынка.

Ключевые вопросы, на которые даны ответы в отчете, включают:

Каким будет размер рынка и темпы роста в 2026 году?

Каковы ключевые факторы развития мирового рынка средств лечения респираторно-синцитиального вируса человека (RSV)?

Каковы основные рыночные тенденции, влияющие на рост мирового рынка препаратов для лечения респираторно-синцитиального вируса человека (RSV)?

Каковы проблемы для роста рынка?

Кто являются основными поставщиками на мировом рынке средств лечения респираторно-синцитиального вируса человека (RSV)?

Каковы рыночные возможности и угрозы, с которыми сталкиваются поставщики на мировом рынке препаратов для лечения респираторно-синцитиального вируса человека (RSV)?

Факторы тенденций, влияющие на рыночные доли в Северной и Южной Америке, Азиатско-Тихоокеанском регионе, Европе и MEA.

Отчет состоит из шести частей, касающихся:

1.) Основная информация;

2.) Азиатский рынок лечения респираторно-синцитиального вируса человека (RSV);

3.) Североамериканский рынок лечения респираторно-синцитиального вируса человека (RSV);

4.) Европейский рынок лечения респираторно-синцитиального вируса человека (RSV);

5.) Выход на рынок и инвестиционная целесообразность;

6.) Заключение отчета.

Все отчеты об исследованиях составляются с использованием двух методов: первичного и вторичного исследования.У бизнеса есть различные динамические характеристики, такие как потребности клиентов и отзывы клиентов. Прежде чем (название компании) подготовить какой-либо отчет, он тщательно изучил все динамические аспекты, такие как отраслевая структура, применение, классификация и определение.

Отчет фокусируется на некоторых очень важных моментах и ​​дает полную информацию о доходах, производстве, цене и доле на рынке.

В отчете о рынке лечения респираторно-синцитиального вируса человека (RSV)

будут перечислены все разделы и исследования по каждому пункту без указания неопределенности компании.

Причины покупки этого отчета

В этом отчете содержится точечный анализ изменения динамики конкуренции.

Он дает перспективный взгляд на различные факторы, способствующие или сдерживающие рост рынка

Он предоставляет шестилетний прогноз, оцененный на основе прогнозируемого роста рынка

Помогает понять ключевые сегменты продукции и их будущее

Обеспечивает точечный анализ меняющейся динамики конкуренции и позволяет вам опережать конкурентов

Помогает принимать обоснованные бизнес-решения благодаря полному пониманию рынка и глубокому анализу рыночных сегментов.


1 Обзор отчета

2 Глобальные тенденции роста

3 Доля рынка по ключевым игрокам

4 Разбивка данных по типу и применению


6 Европа

7 Китай

8 Япония

9 Юго-Восточная Азия

10 Индия

11 Центральная и Южная Америка

Профили 12 международных игроков

13 Прогноз рынка 2019-2025

14 Точки зрения аналитика / выводы

15 Приложение

Получите скидку до 20% на этот премиум-отчет @

https: // www.infinitybusinessinsights.com/request_sample.php?id=513852

Если у вас есть особые требования, сообщите нам, и мы предложим вам отчет, какой вы хотите.

О нас:

Infinity Business Insights – компания, занимающаяся исследованиями рынка, которая предлагает аналитические исследования рынка и бизнеса по всему миру. Мы специализируемся на предоставлении услуг в различных отраслевых вертикалях, чтобы признать их наибольшую ценность, решить их самые аналитические задачи и изменить их работу.

Мы достигаем особого и нишевого спроса в отрасли, при этом стабилизируем объем стандартов с указанным временем и отслеживаем важнейшие изменения как на национальном, так и на общемировом уровне. Конкретные продукты и услуги, предоставляемые Infinity Business Insights, охватывают важные технологические, научные и экономические разработки в промышленных, фармацевтических и высокотехнологичных компаниях.

Свяжитесь с нами:

Амит Дж.